KCTD15

Summary

KCTD15 (potassium channel tetramerization domain containing 15, HGNC:23297) is a protein-coding gene on chromosome 19q13.11, encoding BTB/POZ domain-containing protein KCTD15 (Q96SI1). During embryonic development, it is involved in neural crest formation.

Enables identical protein binding activity. Predicted to be involved in negative regulation of DNA-templated transcription. Predicted to be located in nucleus.

Source: NCBI Gene 79047 — RefSeq curated summary.

At a glance

• Gene–disease (curated): frontonasal dysplasia (Limited, GenCC)
• GWAS associations: 31
• Clinical variants (ClinVar): 55 total
• MANE Select transcript: NM_001129994

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:23297
Approved symbol	KCTD15
Name	potassium channel tetramerization domain containing 15
Location	19q13.11
Locus type	gene with protein product
Status	Approved
Aliases	MGC25497
Ensembl gene	ENSG00000153885
Ensembl biotype	protein_coding
OMIM	615240
Entrez	79047

Gene structure

Transcript identifiers

Ensembl transcripts: 30 — 28 protein_coding, 1 retained_intron, 1 protein_coding_CDS_not_defined

ENST00000284006, ENST00000430256, ENST00000587559, ENST00000587658, ENST00000588637, ENST00000588881, ENST00000589786, ENST00000590385, ENST00000590771, ENST00000590906, ENST00000592210, ENST00000592363, ENST00000683859, ENST00000892923, ENST00000892924, ENST00000892925, ENST00000892926, ENST00000892927, ENST00000892928, ENST00000892929, ENST00000892930, ENST00000892931, ENST00000912137, ENST00000912138, ENST00000912139, ENST00000912140, ENST00000965518, ENST00000965519, ENST00000965520, ENST00000965521

RefSeq mRNA: 3 — MANE Select: NM_001129994 NM_001129994, NM_001129995, NM_024076

CCDS: CCDS12434, CCDS46039

Canonical transcript exons

ENST00000683859 — 7 exons

Exon	Start	End
ENSE00001012862	33798668	33798766
ENSE00002227001	33801167	33801342
ENSE00002228171	33811247	33811552
ENSE00002245652	33806863	33807007
ENSE00003683934	33800428	33800520
ENSE00003920958	33796870	33796987
ENSE00003922487	33812790	33815761

Expression profiles

Bgee: expression breadth ubiquitous, 259 present calls, max score 94.99.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 4.0665 / max 56.2339, expressed in 1316 samples.

FANTOM5 promoters (3 alternative TSS)

Promoter ID	TPM avg	Samples expressed
175098	2.1832	967
175097	1.2736	769
175096	0.6098	366

Top tissues by expression

285 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
ventricular zone	UBERON:0003053	94.99	gold quality
ganglionic eminence	UBERON:0004023	94.93	gold quality
left uterine tube	UBERON:0001303	93.68	gold quality
skin of hip	UBERON:0001554	93.66	gold quality
skin of abdomen	UBERON:0001416	93.29	gold quality
right coronary artery	UBERON:0001625	93.21	gold quality
body of uterus	UBERON:0009853	92.96	gold quality
skin of leg	UBERON:0001511	92.94	gold quality
ectocervix	UBERON:0012249	92.57	gold quality
lower esophagus	UBERON:0013473	92.50	gold quality
lower esophagus muscularis layer	UBERON:0035833	92.49	gold quality
cortical plate	UBERON:0005343	92.46	gold quality
penis	UBERON:0000989	92.21	gold quality
zone of skin	UBERON:0000014	92.19	gold quality
popliteal artery	UBERON:0002250	92.19	gold quality
muscle layer of sigmoid colon	UBERON:0035805	92.18	gold quality
tibial artery	UBERON:0007610	92.16	gold quality
saphenous vein	UBERON:0007318	92.15	gold quality
esophagogastric junction muscularis propria	UBERON:0035841	91.87	gold quality
lower esophagus mucosa	UBERON:0035834	91.39	gold quality
esophagus	UBERON:0001043	91.38	gold quality
endocervix	UBERON:0000458	91.35	gold quality
aorta	UBERON:0000947	90.79	gold quality
left coronary artery	UBERON:0001626	90.77	gold quality
upper leg skin	UBERON:0004262	90.72	gold quality
esophagus mucosa	UBERON:0002469	90.70	gold quality
nipple	UBERON:0002030	90.57	gold quality
coronary artery	UBERON:0001621	90.28	gold quality
body of pancreas	UBERON:0001150	89.93	gold quality
vagina	UBERON:0000996	89.83	gold quality

Single-cell (SCXA)

Detected in 2 experiment(s), a significant marker in 1.

Experiment	Marker?	Max mean expression
E-ANND-3	yes	4.13
E-MTAB-8060	no	55.65

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

150 targeting KCTD15, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-3163	100.00	77.23	8605
HSA-MIR-29A-3P	100.00	73.11	1835
HSA-MIR-29B-3P	100.00	73.18	1833
HSA-MIR-29C-3P	100.00	73.15	1833
HSA-MIR-4455	100.00	65.48	1587
HSA-MIR-186-5P	99.99	70.83	3707
HSA-MIR-4487	99.96	64.58	1252
HSA-MIR-493-5P	99.96	72.47	2382
HSA-MIR-9718	99.94	68.91	918
HSA-MIR-6772-5P	99.94	67.01	577
HSA-MIR-381-3P	99.93	71.87	2854
HSA-MIR-338-5P	99.92	72.34	2951
HSA-MIR-300	99.92	71.76	2856
HSA-MIR-6768-5P	99.92	67.36	1942
HSA-MIR-4731-5P	99.89	67.23	2537
HSA-MIR-548AR-3P	99.85	71.26	3889
HSA-MIR-4447	99.85	67.81	2900
HSA-MIR-3663-3P	99.84	70.39	798
HSA-MIR-4639-5P	99.81	67.37	1028
HSA-MIR-139-5P	99.80	69.50	1399
HSA-MIR-4319	99.76	69.83	2586
HSA-MIR-1976	99.74	65.48	1127
HSA-MIR-4306	99.72	70.50	3630
HSA-MIR-4255	99.72	67.70	1541
HSA-MIR-1200	99.71	70.42	1838
HSA-MIR-670-5P	99.67	69.94	1565
HSA-MIR-580-3P	99.67	69.23	1841
HSA-MIR-4527	99.66	67.43	714
HSA-MIR-4676-3P	99.65	69.31	1733
HSA-MIR-892C-3P	99.65	69.38	1745

Literature-anchored findings (GeneRIF, showing 8)

• Data show the synthetic effect of SNPs on the indices of adiposity and risk of obesity in Chinese girls, but failed to replicate the effect of five separate variants of SEC16B rs10913469, SH2B1 rs4788102, PCSK1 rs6235, KCTD15 rs29941 and BAT2 rs2844479. (PMID:23121087)
• results indicate that Kctd15 acts in the embryo at least in part by specifically binding to the activation domain of AP-2alpha, thereby blocking the function of this critical factor in the neural crest induction hierarchy. (PMID:23382213)
• These data suggest that the non-SUMOylated form of Kctd15 functions in neural crest development. (PMID:24086424)
• SEC16B, MC4R, MAP2K5 and KCTD15 (rs17782313, rs543874, rs2241423 and rs11084753) polymorphisms are associated with the risk for children obesity in China. (PMID:25637721)
• The KCTD15 rs287103 T variant allele was associated with increased risk of bulimia nervosa and with scores of psychopathological scales of these patients. (PMID:28948079)
• KCTD15 deregulation is associated with alterations of the NF-kappaB signaling in both pathological and physiological model systems. (PMID:34521919)
• KCTD1/KCTD15 complexes control ectodermal and neural crest cell functions, and their impairment causes aplasia cutis. (PMID:38113115)
• BTB domain mutations perturbing KCTD15 oligomerisation cause a distinctive frontonasal dysplasia syndrome. (PMID:38296633)

Cross-species orthologs

6 orthologs

Organism	Symbol	Gene ID
danio_rerio	kctd15a	ENSDARG00000045893
		ENSDARG00000105225
mus_musculus	Kctd15	ENSMUSG00000030499
rattus_norvegicus	Kctd15	ENSRNOG00000021137
drosophila_melanogaster	twz	FBGN0034636
caenorhabditis_elegans	F32B4.5	WBGENE00009315

Paralogs (13): KCTD1 (ENSG00000134504), KCTD14 (ENSG00000151364), KCTD18 (ENSG00000155729), KCTD6 (ENSG00000168301), KCTD19 (ENSG00000168676), KCTD12 (ENSG00000178695), KCTD4 (ENSG00000180332), KCTD16 (ENSG00000183775), KCTD8 (ENSG00000183783), KCTD21 (ENSG00000188997), KCNRG (ENSG00000198553), KCTD11 (ENSG00000213859), KCTD7 (ENSG00000243335)

Protein

Protein identifiers

BTB/POZ domain-containing protein KCTD15 — Q96SI1 (reviewed: Q96SI1)

Alternative names: Potassium channel tetramerization domain-containing protein 15

All UniProt accessions (7): Q96SI1, K7EIF1, K7EM48, K7EN63, K7EPF0, K7EQS3, V9GYY8

UniProt curated annotations — full annotation on UniProt →

Function. During embryonic development, it is involved in neural crest formation. Inhibits AP2 transcriptional activity by interaction with its activation domain.

Subunit / interactions. Forms oligomers, predominantly homopentamers. Interacts with KCTD1, probably forming heteropentamers depending on its abundance in a cell-type dependent manner. Interacts with TFAP2A; this interaction inhibits TFAP2A transcriptional activation.

Subcellular location. Nucleus.

Disease relevance. Defects in KCTD15, affecting the BTB domain of the protein, may be the cause of a distinctive frontonasal dysplasia syndrome characterized by a midline mass containing fatty or hamartomatous tissue that overlies the frontonasal region, sparse scalp hair, and aplasia cutis of the scalp. Additionally, congenital heart disease has been observed in one family.

Isoforms (2)

UniProt ID	Names	Canonical?
Q96SI1-1	1	yes
Q96SI1-2	2

RefSeq proteins (3): NP_001123466, NP_001123467, NP_076981 (=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR000210	BTB/POZ_dom	Domain
IPR003131	T1-type_BTB	Domain
IPR011333	SKP1/BTB/POZ_sf	Homologous_superfamily
IPR045904	KCTD15_T1-type_BTB	Domain
IPR048595	KCTD1-15-like_C	Domain

Pfam: PF02214, PF20871

UniProt features (22 total): helix 5, strand 4, sequence variant 3, modified residue 3, splice variant 2, chain 1, domain 1, turn 1, region of interest 1, compositionally biased region 1

Structure

Experimental structures (PDB)

2 structures.

PDB	Method	Resolution (Å)
8PNM	X-RAY DIFFRACTION	1.94
8PNR	X-RAY DIFFRACTION	2.25

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q96SI1-F1	82.92	0.59

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Post-translational modifications (3): 31, 35, 38

Function

Pathways and Gene Ontology

Reactome pathways

5 pathways

ID	Pathway
R-HSA-8866904	Negative regulation of activity of TFAP2 (AP-2) family transcription factors
R-HSA-212436	Generic Transcription Pathway
R-HSA-73857	RNA Polymerase II Transcription
R-HSA-74160	Gene expression (Transcription)
R-HSA-8864260	Transcriptional regulation by the AP-2 (TFAP2) family of transcription factors

MSigDB gene sets: 188 (showing top): TGGTGCT_MIR29A_MIR29B_MIR29C, RNGTGGGC_UNKNOWN, FREAC2_01, HNF3ALPHA_Q6, NKX25_02, GOZGIT_ESR1_TARGETS_DN, RACCACAR_AML_Q6, LHX3_01, FOXD3_01, SRF_C, CREIGHTON_ENDOCRINE_THERAPY_RESISTANCE_1, MYCMAX_01, BILD_E2F3_ONCOGENIC_SIGNATURE, HEN1_01, HFH8_01

GO Biological Process (2): negative regulation of DNA-templated transcription (GO:0045892), protein homooligomerization (GO:0051260)

GO Molecular Function (3): transcription corepressor activity (GO:0003714), identical protein binding (GO:0042802), protein binding (GO:0005515)

GO Cellular Component (1): nucleus (GO:0005634)

Reactome top-level categories

Rollup of top-4 pathways:

Category	Pathways
Transcriptional regulation by the AP-2 (TFAP2) family of transcription factors	1
RNA Polymerase II Transcription	1
Gene expression (Transcription)	1
Generic Transcription Pathway	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
DNA-templated transcription	1
regulation of DNA-templated transcription	1
negative regulation of RNA biosynthetic process	1
protein complex oligomerization	1
transcription coregulator activity	1
negative regulation of DNA-templated transcription	1
protein binding	1
binding	1
intracellular membrane-bounded organelle	1

Protein interactions and networks

STRING

618 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
KCTD15	TMEM18	Q96B42	956
KCTD15	GNPDA2	Q8TDQ7	955
KCTD15	NEGR1	Q7Z3B1	933
KCTD15	MTCH2	Q9Y6C9	917
KCTD15	SH2B1	Q9NRF2	917
KCTD15	MC4R	P32245	907
KCTD15	FTO	Q9C0B1	866
KCTD15	SEC16B	Q96JE7	812
KCTD15	FAIM2	Q9BWQ8	720
KCTD15	ETV5	P41161	657
KCTD15	TFAP2B	Q92481	647
KCTD15	BCDIN3D	Q7Z5W3	646
KCTD15	PTER	Q96BW5	604
KCTD15	QPCTL	Q9NXS2	578
KCTD15	KCTD5	Q9NXV2	576

IntAct

41 interactions, top by confidence:

A	B	Type	Score
HSPA8	GAK	psi-mi:“MI:0914”(association)	0.760
RUVBL2	POLR3A	psi-mi:“MI:0914”(association)	0.640
CA10	WDHD1	psi-mi:“MI:0914”(association)	0.640
KCTD15	KCTD1	psi-mi:“MI:0915”(physical association)	0.560
NOTCH2NLA	KCTD15	psi-mi:“MI:0915”(physical association)	0.560
KCTD1	KCTD15	psi-mi:“MI:0915”(physical association)	0.560
KCTD15	NOTCH2NLA	psi-mi:“MI:0915”(physical association)	0.560
KCTD15	KCTD15	psi-mi:“MI:0407”(direct interaction)	0.520
KCTD15	ATXN1	psi-mi:“MI:0915”(physical association)	0.370
HIF1AN	CNOT1	psi-mi:“MI:0914”(association)	0.350
TMEM184A	NRDC	psi-mi:“MI:0914”(association)	0.350
KCTD3	PCMT1	psi-mi:“MI:0914”(association)	0.350
NSMF	RBPJ	psi-mi:“MI:0914”(association)	0.350
PRPF39	ZNF318	psi-mi:“MI:0914”(association)	0.350
M		psi-mi:“MI:0914”(association)	0.350
CEP192	WASL	psi-mi:“MI:0914”(association)	0.350
hspa1a_hspa1b_human-1	SHTN1	psi-mi:“MI:0914”(association)	0.350
S100P	PLEKHG3	psi-mi:“MI:0914”(association)	0.350
MBD3L2	AHCYL1	psi-mi:“MI:0914”(association)	0.350
KCTD3	DNAJA2	psi-mi:“MI:0914”(association)	0.350
KCTD19	ECT2L	psi-mi:“MI:0914”(association)	0.350

BioGRID (103): KCTD1 (Two-hybrid), NOTCH2NL (Two-hybrid), KCTD15 (Affinity Capture-MS), KCTD15 (Affinity Capture-MS), KCTD15 (Affinity Capture-MS), KCTD15 (Affinity Capture-MS), KCTD15 (Affinity Capture-MS), KCTD15 (Affinity Capture-MS), KCTD15 (Affinity Capture-MS), KCTD15 (Affinity Capture-MS), KCTD15 (Affinity Capture-MS), KCTD15 (Affinity Capture-MS), KCTD15 (Reconstituted Complex), TFAP2A (Reconstituted Complex), YWHAQ (Affinity Capture-MS)

ESM2 similar proteins: A3KMV1, B9EHT4, D3YWQ0, D5SHR0, F1MAB7, F5HB62, O42406, O75426, O75592, O75912, O95343, P03177, P0C5J9, P42859, P51111, P59114, P59438, Q04725, Q08274, Q0VD00, Q1HVD1, Q2TAL5, Q3KSQ2, Q3V0G7, Q4G017, Q4R327, Q4VC12, Q5R686, Q5U464, Q5VVW2, Q6NRL1, Q6P7W2, Q7TPH6, Q80TM9, Q80VW5, Q810W9, Q8BFX3, Q8CH72, Q8CI12, Q8K0E1

Diamond homologs: A3KMV1, A4IFB4, A5PKG7, A6H6X4, B1WC97, B5DEL1, D5SHR0, G5EFC3, O65555, P0C5J9, P15388, P17971, P17972, P25122, P48547, P59994, P59995, Q01956, Q03607, Q03719, Q0VD00, Q0VFV7, Q14003, Q14681, Q29RJ0, Q2HJ48, Q2TUM3, Q3URF8, Q4G0X4, Q50H33, Q52PG9, Q54KH0, Q5DTY9, Q5M956, Q5XJ34, Q5ZJP7, Q62897, Q63881, Q63959, Q68DU8

SIGNOR signaling

0 interactions.

Disease & clinical

Clinical variants and AI predictions

ClinVar

55 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	46
Likely benign	0
Benign	0

Top pathogenic / likely-pathogenic (0)

SpliceAI

1307 predictions. Top by Δscore:

Variant	Effect	Δscore
19:33796988:G:GA	donor_loss	1.0000
19:33796989:T:G	donor_loss	1.0000
19:33798659:T:TA	acceptor_gain	1.0000
19:33801159:A:AG	acceptor_gain	1.0000
19:33801160:T:G	acceptor_gain	1.0000
19:33801162:TCTA:T	acceptor_loss	1.0000
19:33801163:CTAG:C	acceptor_loss	1.0000
19:33801164:TAG:T	acceptor_loss	1.0000
19:33801164:TAGG:T	acceptor_gain	1.0000
19:33801165:A:AG	acceptor_gain	1.0000
19:33801165:A:G	acceptor_loss	1.0000
19:33801165:AG:A	acceptor_gain	1.0000
19:33801165:AGGA:A	acceptor_gain	1.0000
19:33801165:AGGAG:A	acceptor_gain	1.0000
19:33801166:G:GA	acceptor_gain	1.0000
19:33801166:GG:G	acceptor_gain	1.0000
19:33801166:GGA:G	acceptor_gain	1.0000
19:33801166:GGAG:G	acceptor_gain	1.0000
19:33801166:GGAGG:G	acceptor_gain	1.0000
19:33801339:CCAG:C	donor_loss	1.0000
19:33801340:CAG:C	donor_loss	1.0000
19:33801341:AG:A	donor_loss	1.0000
19:33801342:GG:G	donor_loss	1.0000
19:33806861:A:AG	acceptor_gain	1.0000
19:33806861:AGG:A	acceptor_loss	1.0000
19:33806862:G:GG	acceptor_gain	1.0000
19:33807003:TTAAG:T	donor_gain	1.0000
19:33807004:TAAG:T	donor_gain	1.0000
19:33807005:AAG:A	donor_gain	1.0000
19:33807005:AAGG:A	donor_loss	1.0000

AlphaMissense

0 scored. Top likely-pathogenic:

dbSNP variants (sampled 300 via entrez): RS1000205617 (19:33812689 G>A), RS1000225232 (19:33797053 C>G), RS1000313717 (19:33800927 T>C), RS1000438558 (19:33796822 GGAGGGGTGGGTGGGGGGAGGGTTGGGGGCGA>G), RS1000620068 (19:33806452 T>C,G), RS1000638699 (19:33812873 T>C), RS1000688016 (19:33802125 GC>G), RS1000701732 (19:33796706 AGGCGGCGGCGGC>A,AGGC,AGGCGGC,AGGCGGCGGC,AGGCGGCGGCGGCGGC), RS1000725383 (19:33801789 C>T), RS1000943422 (19:33811188 C>A,G,T), RS1001045491 (19:33812708 G>A), RS1001148328 (19:33795478 G>A,C), RS1001424341 (19:33815891 A>T), RS1001452312 (19:33794378 C>A,T), RS1001507918 (19:33796326 G>A,T)

Disease associations

OMIM: gene MIM:615240 | disease phenotypes:

GenCC curated gene-disease

Disease	Classification	Inheritance
frontonasal dysplasia	Limited	Autosomal dominant

Mondo (1): frontonasal dysplasia (MONDO:0016643)

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

31 associations (top):

Study	Trait	p-value
GCST000296_10	Body mass index	7.000000e-12
GCST000298_4	Body mass index	2.000000e-08
GCST000299_9	Weight	5.000000e-09
GCST000830_16	Body mass index	3.000000e-09
GCST001762_747	Obesity-related traits	1.000000e-06
GCST001850_2	Major depressive disorder	3.000000e-07
GCST001850_24	Major depressive disorder	5.000000e-06
GCST002783_105	Body mass index	8.000000e-06
GCST002783_189	Body mass index	2.000000e-08
GCST002783_343	Body mass index	2.000000e-08
GCST004495_116	BMI (adjusted for smoking behaviour)	1.000000e-08
GCST004497_139	Body mass index (joint analysis main effects and smoking interaction)	2.000000e-08
GCST004497_91	Body mass index (joint analysis main effects and smoking interaction)	9.000000e-06
GCST004499_47	BMI in non-smokers	8.000000e-07
GCST004557_114	Body mass index	3.000000e-06
GCST004557_119	Body mass index	7.000000e-10
GCST004557_169	Body mass index	5.000000e-07
GCST004557_247	Body mass index	4.000000e-10
GCST004558_110	Body mass index (joint analysis main effects and physical activity interaction)	5.000000e-07
GCST004558_167	Body mass index (joint analysis main effects and physical activity interaction)	3.000000e-10
GCST004558_4	Body mass index (joint analysis main effects and physical activity interaction)	2.000000e-09
GCST004559_1	Body mass index in physically active individuals	1.000000e-08
GCST004559_111	Body mass index in physically active individuals	3.000000e-08
GCST004559_60	Body mass index in physically active individuals	3.000000e-06
GCST004904_204	Body mass index	2.000000e-10
GCST005359_26	Disease progression in age-related macular degeneration	3.000000e-06
GCST006291_98	Spherical equivalent or myopia (age of diagnosis)	8.000000e-09
GCST007060_5	Response to SSRI (symptom remission)	2.000000e-06
GCST007061_2	Response to antidepressants (symptom remission)	3.000000e-06
GCST009266_16	Dental caries (decayed and filled deciduous tooth surfaces)	1.000000e-06

EFO canonical traits (8, from GWAS)

EFO ID	Trait name
EFO:0004340	body mass index
EFO:0004338	body weight
EFO:0003939	energy intake
EFO:0004318	smoking behavior
EFO:0008002	physical activity measurement
EFO:0008336	disease progression measurement
EFO:0004847	age at onset
EFO:0005658	response to selective serotonin reuptake inhibitor

MeSH disease descriptors (1)

Descriptor	Name	Tree numbers
C538065	Frontonasal dysplasia (supp.)

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

54 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Valproic Acid	affects cotreatment, decreases expression, affects expression	8
(+)-JQ1 compound	decreases expression	2
Air Pollutants	increases abundance, increases expression, affects expression, affects methylation	2
Benzo(a)pyrene	affects methylation, increases mutagenesis	2
Particulate Matter	increases abundance, increases expression, affects expression, affects methylation	2
aristolochic acid I	decreases expression	1
FR900359	increases phosphorylation	1
bisphenol F	affects cotreatment, decreases methylation	1
TAK-243	increases sumoylation	1
dicrotophos	increases expression	1
methyleugenol	increases expression	1
triphenyl phosphate	affects expression	1
propionaldehyde	decreases expression	1
trichostatin A	decreases expression	1
beta-lapachone	increases expression	1
tris(1,3-dichloro-2-propyl)phosphate	increases expression	1
butyraldehyde	decreases expression	1
potassium chromate(VI)	increases expression	1
propionic acid	decreases expression	1
aflatoxin B2	increases methylation	1
nickel sulfate	decreases expression	1
1-nitropyrene	increases expression	1
pentanal	decreases expression	1
perfluoro-n-nonanoic acid	increases expression	1
entinostat	decreases expression	1
4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	affects cotreatment, decreases expression	1
ICG 001	increases expression	1
abrine	decreases expression	1
dorsomorphin	affects cotreatment, decreases expression	1
4-(4-((5-(4,5-dimethyl-2-nitrophenyl)-2-furanyl)methylene)-4,5-dihydro-3-methyl-5-oxo-1H-pyrazol-1-yl)benzoic acid	increases expression	1

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.