KLHL17

Summary

KLHL17 (kelch like family member 17, HGNC:24023) is a protein-coding gene on chromosome 1p36.33, encoding Kelch-like protein 17 (Q6TDP4). Substrate-recognition component of some cullin-RING-based BCR (BTB-CUL3-RBX1) E3 ubiquitin-protein ligase complexes.

The protein encoded by this gene is expressed in neurons of most regions of the brain. It contains an N-terminal BTB domain, which mediates dimerization of the protein, and a C-terminal Kelch domain, which mediates binding to F-actin. This protein may play a key role in the regulation of actin-based neuronal function.

Source: NCBI Gene 339451 — RefSeq curated summary.

At a glance

• GWAS associations: 4
• Clinical variants (ClinVar): 223 total — 1 likely-pathogenic
• Druggable target: yes
• MANE Select transcript: NM_198317

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:24023
Approved symbol	KLHL17
Name	kelch like family member 17
Location	1p36.33
Locus type	gene with protein product
Status	Approved
Ensembl gene	ENSG00000187961
Ensembl biotype	protein_coding
OMIM	619262
Entrez	339451

Gene structure

Transcript identifiers

Ensembl transcripts: 10 — 7 protein_coding, 2 retained_intron, 1 nonsense_mediated_decay

ENST00000338591, ENST00000463212, ENST00000466300, ENST00000481067, ENST00000887516, ENST00000887517, ENST00000935109, ENST00000935110, ENST00000955597, ENST00000955598

RefSeq mRNA: 1 — MANE Select: NM_198317 NM_198317

CCDS: CCDS30550

Canonical transcript exons

ENST00000338591 — 12 exons

Exon	Start	End
ENSE00001365077	963109	963253
ENSE00001368267	962704	962917
ENSE00001372585	964963	965719
ENSE00001375296	962355	962471
ENSE00001375324	964107	964180
ENSE00001727488	961293	961552
ENSE00002291218	960584	960800
ENSE00002988116	961629	961750
ENSE00003185989	961826	962047
ENSE00003479668	964349	964530
ENSE00003600458	963337	963504
ENSE00003624001	963920	964008

Expression profiles

Bgee: expression breadth ubiquitous, 161 present calls, max score 95.69.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 6.3599 / max 91.3195, expressed in 1638 samples.

FANTOM5 promoters (1 alternative TSS)

Promoter ID	TPM avg	Samples expressed
41	6.3599	1638

Top tissues by expression

242 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
lower esophagus mucosa	UBERON:0035834	95.69	gold quality
right hemisphere of cerebellum	UBERON:0014890	90.24	gold quality
granulocyte	CL:0000094	89.55	gold quality
stromal cell of endometrium	CL:0002255	89.04	gold quality
cerebellar hemisphere	UBERON:0002245	88.80	gold quality
cerebellar cortex	UBERON:0002129	88.44	gold quality
metanephros cortex	UBERON:0010533	88.09	gold quality
right testis	UBERON:0004534	87.10	gold quality
esophagus mucosa	UBERON:0002469	86.97	gold quality
adenohypophysis	UBERON:0002196	86.83	gold quality
left testis	UBERON:0004533	86.71	gold quality
endocervix	UBERON:0000458	86.19	gold quality
mucosa of transverse colon	UBERON:0004991	85.98	gold quality
cerebellum	UBERON:0002037	85.86	gold quality
spleen	UBERON:0002106	85.64	gold quality
body of stomach	UBERON:0001161	85.63	gold quality
ectocervix	UBERON:0012249	85.46	gold quality
esophagus	UBERON:0001043	85.41	gold quality
right frontal lobe	UBERON:0002810	85.36	gold quality
apex of heart	UBERON:0002098	85.21	gold quality
minor salivary gland	UBERON:0001830	85.19	gold quality
right lobe of liver	UBERON:0001114	85.17	gold quality
pituitary gland	UBERON:0000007	85.15	gold quality
lower esophagus	UBERON:0013473	84.86	gold quality
lower esophagus muscularis layer	UBERON:0035833	84.80	gold quality
skin of leg	UBERON:0001511	84.78	gold quality
skin of abdomen	UBERON:0001416	84.71	gold quality
cortical plate	UBERON:0005343	84.71	gold quality
esophagogastric junction muscularis propria	UBERON:0035841	84.67	gold quality
left uterine tube	UBERON:0001303	84.47	gold quality

Single-cell (SCXA)

Detected in 1 experiment(s), a significant marker in 0.

Experiment	Marker?	Max mean expression
E-ANND-3	no	1.22

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

15 targeting KLHL17, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-5692A	100.00	74.40	6850
HSA-MIR-1252-5P	100.00	69.80	2774
HSA-MIR-19A-3P	99.98	75.33	2762
HSA-MIR-19B-3P	99.98	75.44	2754
HSA-MIR-3910	99.95	71.13	2227
HSA-MIR-95-5P	99.89	72.17	3973
HSA-MIR-137-3P	99.87	74.74	2401
HSA-MIR-4447	99.85	67.81	2900
HSA-MIR-577	99.78	69.13	2479
HSA-MIR-4757-5P	99.12	64.51	981
HSA-MIR-4477A	98.83	69.75	2952
HSA-MIR-1233-5P	98.19	66.71	1201
HSA-MIR-6778-5P	98.19	66.59	1239
HSA-MIR-6511B-5P	97.98	65.64	823
HSA-MIR-6811-5P	97.98	64.96	848

Cross-species orthologs

3 orthologs

Organism	Symbol	Gene ID
danio_rerio	klhl17	ENSDARG00000037324
mus_musculus	Klhl17	ENSMUSG00002076083
rattus_norvegicus	Klhl17	ENSRNOG00000020302

Paralogs (54): KLHL13 (ENSG00000003096), KLHL20 (ENSG00000076321), KEAP1 (ENSG00000079999), KLHL42 (ENSG00000087448), KLHL22 (ENSG00000099910), KLHL4 (ENSG00000102271), KLHL2 (ENSG00000109466), KLHL5 (ENSG00000109790), BACH2 (ENSG00000112182), KLHL18 (ENSG00000114648), KLHL24 (ENSG00000114796), IVNS1ABP (ENSG00000116679), KLHL12 (ENSG00000117153), KLHL29 (ENSG00000119771), KBTBD7 (ENSG00000120696), KLHL7 (ENSG00000122550), KLHL31 (ENSG00000124743), KLHDC7B (ENSG00000130487), KLHL36 (ENSG00000135686), KLHL8 (ENSG00000145332), KLHL3 (ENSG00000146021), KLHL35 (ENSG00000149243), KLHL1 (ENSG00000150361), BACH1 (ENSG00000156273), KLHL40 (ENSG00000157119), KLHL10 (ENSG00000161594), KLHL21 (ENSG00000162413), KLHDC8A (ENSG00000162873), KBTBD8 (ENSG00000163376), KBTBD6 (ENSG00000165572), KLHL26 (ENSG00000167487), KLHL30 (ENSG00000168427), KBTBD2 (ENSG00000170852), KLHL6 (ENSG00000172578), KLHL15 (ENSG00000174010), KLHL38 (ENSG00000175946), KBTBD11 (ENSG00000176595), KLHDC7A (ENSG00000179023), KLHL28 (ENSG00000179454), KBTBD3 (ENSG00000182359)

Protein

Protein identifiers

Kelch-like protein 17 — Q6TDP4 (reviewed: Q6TDP4)

Alternative names: Actinfilin

All UniProt accessions (2): Q6TDP4, J3QLT4

UniProt curated annotations — full annotation on UniProt →

Function. Substrate-recognition component of some cullin-RING-based BCR (BTB-CUL3-RBX1) E3 ubiquitin-protein ligase complexes. The BCR(KLHL17) complex mediates the ubiquitination and subsequent degradation of GLUR6. May play a role in the actin-based neuronal function.

Subunit / interactions. Interacts with F-actin; the interaction disrupts the F-actin structures and leads to marked changes of neuronal morphology. Component of a complex, composed of PDZK1, SYNGAP1, KLHL17 and NMDA receptors. Interacts directly with PDZK1 (via PDZ1 domain); the interaction is important for integrity of actin cytoskeleton structures in neurons. Interacts with DLG4 and SYNGAP1. Interacts (via kelch repeats) with GRIK2 (via C-terminus); the interaction targets GRIK2 for degradation via ubiquitin-proteasome pathway. Interacts with GRIK1. Interacts with (via BTB domain) CUL3; the interaction regulates surface GRIK2 expression.

Subcellular location. Postsynaptic density. Synapse.

Pathway. Protein modification; protein ubiquitination.

RefSeq proteins (1): NP_938073* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR000210	BTB/POZ_dom	Domain
IPR006652	Kelch_1	Repeat
IPR011043	Gal_Oxase/kelch_b-propeller	Homologous_superfamily
IPR011333	SKP1/BTB/POZ_sf	Homologous_superfamily
IPR011705	BACK	Domain
IPR015915	Kelch-typ_b-propeller	Homologous_superfamily
IPR017096	BTB-kelch_protein	Family

Pfam: PF00651, PF01344, PF07707

UniProt features (46 total): strand 27, turn 6, repeat 6, region of interest 3, domain 2, chain 1, compositionally biased region 1

Structure

Experimental structures (PDB)

1 structures.

PDB	Method	Resolution (Å)
6HRL	X-RAY DIFFRACTION	2.6

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q6TDP4-F1	87.45	0.74

Function

Pathways and Gene Ontology

Reactome pathways

0 pathways

MSigDB gene sets: 83 (showing top): BENPORATH_ES_WITH_H3K27ME3, GOBP_MACROMOLECULE_CATABOLIC_PROCESS, GOBP_POST_TRANSLATIONAL_PROTEIN_MODIFICATION, GOMF_ACTIN_BINDING, NRF2_01, GCM_NF2, GOBP_PROTEASOMAL_PROTEIN_CATABOLIC_PROCESS, TGCCTTA_MIR124A, GOBP_PROTEIN_CATABOLIC_PROCESS, GOCC_TRANSFERASE_COMPLEX, GOCC_POSTSYNAPSE, GOCC_SYNAPSE, GOBP_PROTEOLYSIS, GOCC_CULLIN_RING_UBIQUITIN_LIGASE_COMPLEX, GOCC_CUL3_RING_UBIQUITIN_LIGASE_COMPLEX

GO Biological Process (3): protein ubiquitination (GO:0016567), actin cytoskeleton organization (GO:0030036), proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)

GO Molecular Function (4): actin binding (GO:0003779), molecular adaptor activity (GO:0060090), ubiquitin-like ligase-substrate adaptor activity (GO:1990756), protein binding (GO:0005515)

GO Cellular Component (6): obsolete extracellular space (GO:0005615), cytoplasm (GO:0005737), postsynaptic density (GO:0014069), actin cytoskeleton (GO:0015629), Cul3-RING ubiquitin ligase complex (GO:0031463), synapse (GO:0045202)

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
binding	2
protein modification by small protein conjugation	1
cytoskeleton organization	1
actin filament-based process	1
ubiquitin-dependent protein catabolic process	1
proteasomal protein catabolic process	1
cytoskeletal protein binding	1
molecular_function	1
enzyme-substrate adaptor activity	1
intracellular anatomical structure	1
cellular anatomical structure	1
asymmetric synapse	1
postsynaptic specialization	1
cytoskeleton	1
cullin-RING ubiquitin ligase complex	1
cell junction	1

Protein interactions and networks

STRING

928 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
KLHL17	CUL3	Q13618	715
KLHL17	GRIK1	P39086	541
KLHL17	SYNGAP1	Q96PV0	538
KLHL17	KARS1	Q15046	527
KLHL17	SAMD11	Q96NU1	511
KLHL17	GRIK2	Q13002	483
KLHL17	NUDT17	P0C025	452
KLHL17	PDZK1	Q5T2W1	439
KLHL17	NPHP4	O75161	415
KLHL17	MGAT4C	Q9UBM8	408
KLHL17	POLR3C	Q9BUI4	405
KLHL17	TDP2	O95551	401
KLHL17	CHORDC1	Q9UHD1	399
KLHL17	PUSL1	Q8N0Z8	389
KLHL17	YJEFN3	A6XGL0	370

IntAct

35 interactions, top by confidence:

A	B	Type	Score
TSPAN5	ADAM10	psi-mi:“MI:0914”(association)	0.800
PRKN	KLHL17	psi-mi:“MI:0915”(physical association)	0.560
VHL	KLHL17	psi-mi:“MI:0915”(physical association)	0.560
ATXN1	KLHL17	psi-mi:“MI:0915”(physical association)	0.560
TARDBP	KLHL17	psi-mi:“MI:0915”(physical association)	0.560
CUL3	RHOBTB1	psi-mi:“MI:0914”(association)	0.530
DCN	KLHL17	psi-mi:“MI:0914”(association)	0.530
FBXL17	KLHL2	psi-mi:“MI:0914”(association)	0.530
CUL3	PXDNL	psi-mi:“MI:0914”(association)	0.350
PDZK1P1	ZBTB5	psi-mi:“MI:0914”(association)	0.350
KLHL2	DCTN6	psi-mi:“MI:0914”(association)	0.350
KLHL12	SKP1	psi-mi:“MI:0914”(association)	0.350
FBXL17	ZBTB5	psi-mi:“MI:0914”(association)	0.350
KLHL2	SKP1	psi-mi:“MI:0914”(association)	0.350
FBXL17	ENC1	psi-mi:“MI:0914”(association)	0.350
PDZK1	ZBTB5	psi-mi:“MI:0914”(association)	0.350
KLHL3	CEP290	psi-mi:“MI:0914”(association)	0.350

BioGRID (26): KLHL17 (Affinity Capture-MS), KLHL17 (Affinity Capture-MS), KLHL17 (Affinity Capture-MS), KLHL17 (Affinity Capture-MS), KLHL17 (Affinity Capture-MS), KLHL17 (Affinity Capture-MS), KLHL17 (Affinity Capture-MS), KLHL17 (Affinity Capture-MS), KLHL17 (Affinity Capture-MS), RABGGTA (Affinity Capture-MS), DAK (Affinity Capture-MS), KLHL17 (Affinity Capture-MS), HARS2 (Affinity Capture-MS), RHOA (Affinity Capture-MS), KLHL17 (Affinity Capture-MS)

ESM2 similar proteins: A0A2R8Q1W5, A6QQY2, B0WWP2, B3NDN0, B4HIK1, B4L0G9, B4LIG6, B4PD06, D3Z8N4, E0CZ16, E1B932, E7F6F9, E9Q4F2, F1LZ52, O94889, P28575, P57790, P59280, Q08DK3, Q14145, Q16RL8, Q2T9Z7, Q53G59, Q5R774, Q5R7B8, Q5U374, Q5ZKD9, Q5ZLD3, Q684M4, Q6DFF6, Q6JEL2, Q6JEL3, Q6NRH0, Q6TDP3, Q6TDP4, Q6ZPT1, Q7QGL0, Q80TF4, Q8BZM0, Q8K430

Diamond homologs: A0A1B8YAB1, A1YPR0, B0WWP2, B1H285, B3M9V8, B3NDN0, B4GRJ2, B4HIK1, B4J045, B4L0G9, B4LIG6, B4MXW3, B4PD06, B4QLQ2, C9JR72, D3Z8N4, E0CZ16, G3X9X1, O15062, O88939, O93567, O95365, P28575, P41182, P41183, Q08CL3, Q08DK3, Q13105, Q16RL8, Q2M0J9, Q3UQV5, Q52KB5, Q5EXX3, Q5R7B8, Q5RDY3, Q5TC79, Q5ZI33, Q5ZKD9, Q5ZM39, Q60821

SIGNOR signaling

2 interactions.

A	Effect	B	Mechanism
KLHL17	“down-regulates quantity by destabilization”	GRIK2	binding
KLHL17	“up-regulates activity”	“Cullin 3-RBX1-Skp1”	binding

Enriched among interaction partners

Reactome pathways and GO biological processes over-represented among this gene’s 23 IntAct physical interaction partners (hypergeometric vs the genome-wide background, BH-FDR, gene-set size 15–500, ranked by fold). A functional readout of the neighbourhood — distinct from this gene’s own memberships above, and biased toward well-studied / hub proteins, so read it as themes rather than proof.

Reactome pathways:

Pathway	Partners	Fold	FDR
Neddylation	5	14.8×	1e-03
Antigen processing: Ubiquitination & Proteasome degradation	6	13.9×	4e-04

GO biological processes:

GO term	Partners	Fold	FDR
proteasome-mediated ubiquitin-dependent protein catabolic process	8	19.0×	1e-06
protein ubiquitination	8	15.1×	4e-06

Disease & clinical

Clinical variants and AI predictions

ClinVar

223 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	1
Uncertain significance	180
Likely benign	11
Benign	9

Top pathogenic / likely-pathogenic (1)

Variant ID	HGVS	Classification
916564	NM_198317.3(KLHL17):c.1682C>A (p.Ala561Glu)	Likely pathogenic

SpliceAI

2324 predictions. Top by Δscore:

Variant	Effect	Δscore
1:961553:G:GG	donor_gain	1.0000
1:961557:G:GG	donor_gain	1.0000
1:961623:CCGCA:C	acceptor_loss	1.0000
1:961624:CGCA:C	acceptor_loss	1.0000
1:961625:GCA:G	acceptor_loss	1.0000
1:961626:CA:C	acceptor_loss	1.0000
1:961627:A:AG	acceptor_gain	1.0000
1:961627:AGAT:A	acceptor_gain	1.0000
1:961628:G:GG	acceptor_gain	1.0000
1:961628:GAT:G	acceptor_gain	1.0000
1:961628:GATG:G	acceptor_gain	1.0000
1:961628:GATGA:G	acceptor_gain	1.0000
1:961749:AGGTG:A	donor_loss	1.0000
1:961750:GGTGA:G	donor_loss	1.0000
1:961752:T:A	donor_loss	1.0000
1:961822:GTA:G	acceptor_loss	1.0000
1:961824:A:AG	acceptor_gain	1.0000
1:961825:G:GG	acceptor_gain	1.0000
1:962045:CAGGT:C	donor_loss	1.0000
1:962046:AGGTA:A	donor_loss	1.0000
1:962047:GGTAA:G	donor_loss	1.0000
1:962049:T:G	donor_loss	1.0000
1:962470:GG:G	donor_gain	1.0000
1:962471:GG:G	donor_gain	1.0000
1:962697:A:AG	acceptor_gain	1.0000
1:962698:C:G	acceptor_gain	1.0000
1:962700:CCAG:C	acceptor_loss	1.0000
1:962702:A:AG	acceptor_gain	1.0000
1:962702:AG:A	acceptor_loss	1.0000
1:962703:G:A	acceptor_loss	1.0000

AlphaMissense

4152 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
1:961463:A:T	D93V	1.000
1:961472:T:A	L96Q	1.000
1:961472:T:C	L96P	1.000
1:961506:A:C	K107N	1.000
1:961506:A:T	K107N	1.000
1:961514:T:A	L110Q	1.000
1:961514:T:C	L110P	1.000
1:961517:C:A	A111D	1.000
1:961525:A:C	S114R	1.000
1:961527:C:A	S114R	1.000
1:961527:C:G	S114R	1.000
1:961531:T:A	Y116N	1.000
1:961531:T:C	Y116H	1.000
1:961535:T:C	F117S	1.000
1:961547:T:C	F121S	1.000
1:961698:T:C	L146P	1.000
1:961706:T:C	F149L	1.000
1:961708:T:A	F149L	1.000
1:961708:T:G	F149L	1.000
1:961830:T:C	L165P	1.000
1:961833:T:A	L166H	1.000
1:961833:T:C	L166P	1.000
1:961839:C:A	A168D	1.000
1:961841:G:C	A169P	1.000
1:961842:C:A	A169D	1.000
1:961851:T:C	L172P	1.000
1:961866:T:A	V177D	1.000
1:961878:G:A	C181Y	1.000
1:961879:C:G	C181W	1.000
1:961886:T:C	F184L	1.000

dbSNP variants (sampled 300 via entrez): RS1000008901 (1:958723 A>G), RS1002240891 (1:960751 C>A), RS1002374994 (1:963849 G>A,C), RS1002517738 (1:965403 C>T), RS1002623986 (1:959931 G>A), RS1002698418 (1:960887 GC>G), RS1002981641 (1:959806 G>C), RS1004230810 (1:961108 G>A), RS1004261159 (1:960833 GCCTCGGGACCTGCGCGGCCCCCGC>G), RS1004359049 (1:964021 G>A,T), RS1004472023 (1:965427 A>G), RS1004577145 (1:960060 G>A), RS1004792714 (1:964198 C>T), RS1004817842 (1:959960 C>T), RS1004863150 (1:965638 T>C)

Disease associations

OMIM: gene MIM:619262 | disease phenotypes: MIM:189960

GenCC curated gene-disease

Mondo (2): autism spectrum disorder (MONDO:0005258), esophageal atresia/tracheoesophageal fistula (MONDO:0008586)

Orphanet (2): Esophageal atresia (Orphanet:1199), NON RARE IN EUROPE: Autism (Orphanet:106)

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

4 associations (top):

Study	Trait	p-value
GCST006979_846	Heel bone mineral density	4.000000e-13
GCST008926_5	Lysophosphatidylethanolamine levels	4.000000e-08
GCST010206_10	Anorectal malformation	1.000000e-12
GCST90013406_95	Liver enzyme levels (alkaline phosphatase)	5.000000e-11

EFO canonical traits (3, from GWAS)

EFO ID	Trait name
EFO:0009270	heel bone mineral density
EFO:0010225	lysophosphatidylethanolamine measurement
EFO:0004533	alkaline phosphatase measurement

MeSH disease descriptors (1)

Descriptor	Name	Tree numbers
C531835	Esophageal atresia with or without tracheoesophageal fistula (supp.)

Drugs & pharmacology

Drug and pharmacology data

Is drug target: yes

ChEMBL targets (1): CHEMBL6196104 (SINGLE PROTEIN)

PharmGKB: 1 entry (VIP=true, CPIC=false)

PharmGKB variants

1 variants.

Variant	Genes	Level	Score	#Clin annots	Drugs
rs7414551	KLHL17, PLEKHN1		0.00	0

CTD chemical–gene interactions

22 total (human), top 22 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
aristolochic acid I	increases expression	1
triphenyl phosphate	affects expression	1
pirinixic acid	affects binding, decreases expression, increases activity	1
sodium arsenite	increases expression	1
di-n-butylphosphoric acid	affects expression	1
CGP 52608	affects binding, increases reaction	1
Resveratrol	affects cotreatment, decreases expression	1
Air Pollutants	increases abundance, affects expression	1
Arsenic	affects methylation	1
Dexamethasone	decreases expression	1
Lipopolysaccharides	affects expression, affects response to substance	1
Methyl Methanesulfonate	increases expression	1
Ozone	affects expression, increases abundance	1
Plant Extracts	affects cotreatment, decreases expression	1
Smoke	decreases expression	1
Tobacco Smoke Pollution	affects expression	1
Valproic Acid	increases methylation	1
Vanadium	increases methylation, increases abundance	1
Antirheumatic Agents	decreases expression	1
Metals, Heavy	increases methylation, increases abundance	1
Cadmium Chloride	decreases expression	1
Acrylamide	decreases expression	1

ChEMBL screening assays

1 unique, capped per target: 1 binding

Representative assays (with source publication via chembl_document):

Assay ID	Type	Description	Source paper
CHEMBL6094269	Binding	Binding affinity to KLHL17 (unknown origin) at 10 uM by thermal shift assay	Structure-Guided Conformational Restriction Leading to High-Affinity, Selective, and Cell-Active Tetrahydroisoquinoline-Based Noncovalent Keap1-Nrf2 Inhibitors. — J Med Chem

Clinical trials (associated diseases)

300 trials via MONDO — disease-level, not drug-specific.

Trial	Phase	Status	Title
NCT00391261	PHASE4	COMPLETED	An Open-label Trial of Metformin for Weight Control of Pediatric Patients on Antipsychotic Medications.
NCT01028820	PHASE4	COMPLETED	FMRI Brain Activation of Aripiprazole Treatment in Autism Spectrum Disorders
NCT01333865	PHASE4	COMPLETED	A Study of Memantine Hydrochloride (Namenda®) for Cognitive and Behavioral Impairment in Adults With Autism Spectrum Disorders
NCT01337700	PHASE4	COMPLETED	Milnacipran in Autism and the Functional Locus Coeruleus and Noradrenergic Model of Autism
NCT01695200	PHASE4	COMPLETED	Omega-3 Fatty Acids in Autism Spectrum Disorders
NCT02096952	PHASE4	COMPLETED	Methylphenidate ER Liquid Formulation in Adults With ASD and ADHD
NCT02235467	PHASE4	COMPLETED	Multisite Study: Parental Training Using Video Modelling to Develop Social Skills in Children With Autism
NCT02940574	PHASE4	COMPLETED	Neural and Behavioral Effects of Oxytocin in Autism Spectrum Disorders
NCT03333629	PHASE4	COMPLETED	Promoting Positive Outcomes for Individuals With ASD: Linking Early Detection, Treatment, and Long-term Outcomes
NCT03337646	PHASE4	COMPLETED	Evaluation of the Effect and Safety of Lisdexamfetamine in Children Aged 6-12 With ADHD and Autism
NCT03538431	PHASE4	COMPLETED	Improving Driving in Young People With Autism Spectrum Disorders
NCT03757585	PHASE4	COMPLETED	Natural Treatments for the Management of Emotional Dysregulation in Youth With Non-verbal Learning Disability (NVLD) and/or Autism Spectrum Disorders (ASD)
NCT04903353	PHASE4	COMPLETED	Pragmatic Trial Comparing Weight Gain in Children With Autism Taking Risperidone Versus Aripiprazole
NCT05063656	PHASE4	COMPLETED	Biomarker-Driven Pharmacological Treatment of Adolescents With Autism Spectrum Disorder With Gabapentin
NCT05146245	PHASE4	UNKNOWN	Safety and Pharmacokinetics of Antipsychotics in Children 2: Studying TDM in an RCT
NCT05916339	PHASE4	RECRUITING	AWARE: Management of ADHD in Autism Spectrum Disorder
NCT05954052	PHASE4	TERMINATED	A Study of Glutathione in Children With Autism Spectrum Disorder
NCT06853665	PHASE4	RECRUITING	The TEAM Study - Treatment Efficacy for Autism/Attention Using Mixed Amphetamine
NCT07054697	PHASE4	COMPLETED	Pilot-RCT With Individualized Homeopathic Treatment in the Children With Autism Spectrum Disorder
NCT07161804	PHASE4	COMPLETED	Pilot RCT Using Homeopathic Medicines in ASD
NCT07439042	PHASE4	NOT_YET_RECRUITING	Buspirone for Anxiety in Autistic Youth
NCT01302964	PHASE3	COMPLETED	Mirtazapine Treatment of Anxiety in Children and Adolescents With Pervasive Developmental Disorders
NCT01706523	PHASE3	TERMINATED	Open Label Extension Study of STX209 (Arbaclofen) in Autism Spectrum Disorders
NCT01825798	PHASE3	COMPLETED	Treatment of Overweight Induced by Antipsychotic Medication in Young People With Autism Spectrum Disorders (ASD)
NCT01972074	PHASE3	COMPLETED	Behavioral and Neural Response to Memantine in Adolescents With Autism Spectrum Disorder
NCT02985749	PHASE3	COMPLETED	A Study of Oxytocin for the Treatment of Social Impairment in Individuals With High Functioning Autism Spectrum Disorder
NCT03197922	PHASE3	COMPLETED	Treatment of Encopresis in Children With Autism Spectrum Disorders
NCT03504917	PHASE3	TERMINATED	A Study of Balovaptan in Adults With Autism Spectrum Disorder With a 2-Year Open-Label Extension
NCT03553875	PHASE3	TERMINATED	Memantine for the Treatment of Social Deficits in Youth With Disorders of Impaired Social Interactions
NCT03640156	PHASE3	COMPLETED	Modulating Socially Adaptive Mirror System Functioning in Autism by Oxytocin
NCT03715153	PHASE3	TERMINATED	Efficacy and Safety of Bumetanide Oral Liquid Formulation in Children Aged From 2 to Less Than 7 Years Old With Autism Spectrum Disorder.
NCT03715166	PHASE3	TERMINATED	Efficacy and Safety of Bumetanide Oral Liquid Formulation in Children and Adolescents Aged From 7 to Less Than 18 Years Old With Autism Spectrum Disorder
NCT04233502	PHASE3	WITHDRAWN	Efficacy and Safety of Slenyto for Insomnia in Children With ASD
NCT04578756	PHASE3	COMPLETED	Open-Label, Flexible-dose Study to Evaluate the Long-Term Safety and Tolerability of Cariprazine in the Treatment of Pediatric Participants With Schizophrenia, Bipolar I Disorder, or Autism Spectrum Disorder
NCT04623398	PHASE3	COMPLETED	Effect of Lithium in Patients With Autism Spectrum Disorder and Phelan-McDermid Syndrome (SHANK3 Haploinsufficiency)
NCT04725383	PHASE3	TERMINATED	Amitriptyline for Repetitive Behaviors in Autism Spectrum Disorders
NCT05212493	PHASE3	COMPLETED	The Effects of Medical Cannabis in Children With Autistic Spectrum Disorder
NCT05361707	PHASE3	UNKNOWN	Evaluating the Effects of Tasimelteon in Individuals With Autism Spectrum Disorder (ASD) and Sleep Disturbances
NCT05439616	PHASE3	COMPLETED	Study of Cariprazine Oral Capsules or Solution to Assess Adverse Events and Change in Irritability Due to Autism Spectrum Disorder (ASD) in Participants Aged 5-17 Years With ASD
NCT06229210	PHASE3	RECRUITING	Safety and Tolerability Trial of Lumateperone in Pediatric Patients With Schizophrenia, Bipolar Disorder or Autism Spectrum Disorder