KLK2

Summary

KLK2 (kallikrein related peptidase 2, HGNC:6363) is a protein-coding gene on chromosome 19q13.33, encoding Kallikrein-2 (P20151). Glandular kallikreins cleave Met-Lys and Arg-Ser bonds in kininogen to release Lys-bradykinin.

This gene encodes a member of the grandular kallikrein protein family. Kallikreins are a subgroup of serine proteases that are clustered on chromosome 19. Members of this family are involved in a diverse array of biological functions. The protein encoded by this gene is a highly active trypsin-like serine protease that selectively cleaves at arginine residues. This protein is primarily expressed in prostatic tissue and is responsible for cleaving pro-prostate-specific antigen into its enzymatically active form. This gene is highly expressed in prostate tumor cells and may be a prognostic maker for prostate cancer risk. Alternate splicing results in both coding and non-coding transcript variants.

Source: NCBI Gene 3817 — RefSeq curated summary.

At a glance

• GWAS associations: 17
• Clinical variants (ClinVar): 49 total
• Druggable target: yes
• MANE Select transcript: NM_005551

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:6363
Approved symbol	KLK2
Name	kallikrein related peptidase 2
Location	19q13.33
Locus type	gene with protein product
Status	Approved
Ensembl gene	ENSG00000167751
Ensembl biotype	protein_coding
OMIM	147960
Entrez	3817

Gene structure

Transcript identifiers

Ensembl transcripts: 23 — 8 retained_intron, 6 protein_coding, 6 nonsense_mediated_decay, 2 protein_coding_CDS_not_defined, 1 non_stop_decay

ENST00000325321, ENST00000358049, ENST00000391810, ENST00000593493, ENST00000594174, ENST00000595050, ENST00000595173, ENST00000595316, ENST00000595375, ENST00000596950, ENST00000597439, ENST00000597461, ENST00000597509, ENST00000597727, ENST00000597911, ENST00000599121, ENST00000599280, ENST00000599568, ENST00000600690, ENST00000600755, ENST00000600866, ENST00000601114, ENST00000601743

RefSeq mRNA: 3 — MANE Select: NM_005551 NM_001002231, NM_001256080, NM_005551

CCDS: CCDS12808, CCDS42597, CCDS58675

Canonical transcript exons

ENST00000325321 — 5 exons

Exon	Start	End
ENSE00003479612	50878404	50880567
ENSE00003523138	50876472	50876758
ENSE00003532422	50874721	50874880
ENSE00003677863	50876872	50877008
ENSE00003688057	50873439	50873519

Expression profiles

Bgee: expression breadth ubiquitous, 159 present calls, max score 97.58.

FANTOM5 (CAGE): breadth tissue_specific, TPM avg 0.5084 / max 672.2974, expressed in 18 samples.

FANTOM5 promoters (3 alternative TSS)

Promoter ID	TPM avg	Samples expressed
177182	0.4820	12
177184	0.0238	10
177183	0.0027	2

Top tissues by expression

283 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
prostate gland	UBERON:0002367	97.58	gold quality
right testis	UBERON:0004534	90.53	gold quality
left testis	UBERON:0004533	90.40	gold quality
type B pancreatic cell	CL:0000169	88.07	gold quality
olfactory bulb	UBERON:0002264	87.77	gold quality
male germ cell	CL:0000015	87.66	silver quality
sperm	CL:0000019	87.55	silver quality
testis	UBERON:0000473	86.35	gold quality
left lobe of thyroid gland	UBERON:0001120	82.37	gold quality
diaphragm	UBERON:0001103	81.91	gold quality
right lobe of thyroid gland	UBERON:0001119	81.77	gold quality
tongue squamous epithelium	UBERON:0006919	81.37	gold quality
thyroid gland	UBERON:0002046	81.18	gold quality
male germ line stem cell (sensu Vertebrata) in testis	CL:0000089 ∩ UBERON:0000473	80.44	gold quality
parotid gland	UBERON:0001831	78.51	gold quality
thymus	UBERON:0002370	76.18	silver quality
vena cava	UBERON:0004087	75.43	gold quality
urethra	UBERON:0000057	74.51	gold quality
vastus lateralis	UBERON:0001379	74.48	gold quality
skeletal muscle tissue of rectus abdominis	UBERON:0004511	74.04	gold quality
quadriceps femoris	UBERON:0001377	73.92	gold quality
CA1 field of hippocampus	UBERON:0003881	73.90	gold quality
buccal mucosa cell	CL:0002336	73.35	silver quality
mucosa of urinary bladder	UBERON:0001259	73.22	gold quality
triceps brachii	UBERON:0001509	72.54	gold quality
cerebellar vermis	UBERON:0004720	72.53	gold quality
Brodmann (1909) area 10	UBERON:0013541	72.45	gold quality
epithelial cell of pancreas	CL:0000083	71.45	gold quality
skeletal muscle tissue of biceps brachii	UBERON:0004502	71.39	gold quality
paraflocculus	UBERON:0005351	71.32	gold quality

Single-cell (SCXA)

Detected in 3 experiment(s), a significant marker in 2.

Experiment	Marker?	Max mean expression
E-ANND-2	yes	6885.75
E-ANND-3	yes	3.09
E-GEOD-99795	no	425.07

Regulation

Is transcription factor: no

Upstream regulators (CollecTRI, top): AR, CTNNB1, JUN

Literature-anchored findings (GeneRIF, showing 34)

• The identification of unusual mRNA splice variants of the KLK2 and KLK3 genes that result from inclusion of intronic sequences adjacent to the first exon. (PMID:11834722)
• Characterization of androgen receptor and nuclear receptor co-regulator expression in human breast cancer cell lines exhibiting differential regulation of kallikreins 2 and 3. (PMID:12124798)
• kallikrein expression in nipple aspirate fluid- ethnic variation (PMID:12209605)
• Measurements of free prostate specific antigen and hK2 improve on our ability to counsel patients prior to treatment as to their risk of biochemical recurrence (PMID:16152616)
• An additional serum marker for the detection of prostatic cancer. (PMID:16388506)
• a role for the KLK2 gene in prostate cancer susceptibility (PMID:17085659)
• results imply that prostate cancer risk is associated with androgen receptor(AR)-CAG repeat and kallikrein-2 polymorphisms in Indian population but no unambiguous association was observed with PSA and AR-GGN repeat polymorphism (PMID:17257635)
• role of kallikrein gene 2 and 3 variant SNPs in the etiology of prostate cancer among men of European ancestry (PMID:17593395)
• %fPSA and hK2 add important predictive value in older men and much closer to diagnosis (PMID:17657743)
• The two novel ETV4 fusion partners possess as predominant common characteristics androgen-induction and prostate-specific expression. (PMID:18451133)
• Recombinant hK2 activates ERK1/2 signaling of prostate cancer cell lines, which express both PAR1 and PAR2. (PMID:18567807)
• These data demonstrate enhanced level of neurotrophin release in inflamed human skin in vivo which might well contribute to peripheral sensitization. A (PMID:18571954)
• adding free PSA and human kallikrein 2 to standard pretreatment risk-assessment models to predict biochemical recurrence after radical prostatectomy for prostate cancer enhanced the AUC (PMID:19003994)
• PSA and kallikrein 2 transcripts in the peripheral blood of prostate cancer patients during barchytherapy could serve as a predictor of biochemiacl outcome. (PMID:19434652)
• Combination of KLK2, 3, 13, and 14 and KLK1, 2, 5, 6, 7, 8, 10, 13, and 14 showed very strong discriminatory potential for semen liquefaction and viscosity, respectively. (PMID:19558318)
• Data show six non-synonymous amino acid or frame shift changes in the KLK3 gene and three changes in each of the neighboring genes, KLK15 and KLK2. (PMID:19823874)
• we identifiedand genotyped novel single-nucleotide polymorphisms in cancer cases and controls which verified prior associations in KLK2 and in MSMB (but not in KLK3) with prostate cancer (PMID:20424135)
• An exploratory study of a KLK2 polymorphism as a prognostic marker in prostate cancer was found to be less likely associated with low Gleason score morphology. (PMID:21178268)
• TK promotes vessel growth by increasing the number of EPCs and enhancing their functional properties through the kinin B(2) receptor-Akt signaling pathway. (PMID:22435954)
• Genetic variants at ATF7IP and KLK2 contribute to the variance of %fPSA. (PMID:23359319)
• Two SNPs, in beta-microseminoprotein at and in kallikrein-related peptidase 2 at, are associated with PCA3 score at genome-wide significance level (PMID:23555189)
• Predictions based on levels of four kallikrein markers, including KLK2, in blood distinguish between pathologically insignificant and aggressive disease after radical prostatectomy with good accuracy. (PMID:23683475)
• we present the first evidence that KLK2 can also function as an androgen receptor modulator that may modulate cell growth after the development of castration-resistant prostate cancer (PMID:24122203)
• Associations observed in young, healthy men between the seminal plasma and serum concentrations of hK2 and PSA and several genetic variants in KLK2 and KLK3 could be useful to refine models of PSA cutoff values in prostate cancer testing. (PMID:24270797)
• Alteration of cellular junctions in benign prostatic hyperplasia could contribute to the presence of luminal epithelial secreted proteins prostate specific antigen (PSA)2 and and KLK2 in the stromal compartment. (PMID:24711254)
• miR-378 was predicted to target both KLK2 and KLK4 and downregulated levels detected in prostate cancer patients. (PMID:25153390)
• The differential regulation of alternative transcripts (using KLK2, KLK3 and KLK4 as models) by androgens and anti-androgens as an indicator of prostate cancers, was investigated. (PMID:25153393)
• Structure-function analyses of KLK2 establish the 99-loop as master regulator of its activity. (PMID:25326387)
• The results indicated that W-hK2 had a defect in cellular trafficking due to its misfolding and that it activated the unfolded protein response, suggesting a mechanism to explain the association of the T allele with higher prostate cancer risk. (PMID:25847286)
• glycosylation changes the enzymatic activity of KLK2 in a drastically substrate-dependent manner. (PMID:26582203)
• Study report KLK2-FGFR2 fusion protein in 2 unrelated cases of metastatic prostate cancer. Expression of the KLK2-FGFR2 fusion protein in NIH3T3 cells induced a profound morphological change promoting enhanced migration and activation of downstream proteins in FGFR signaling pathways. (PMID:31043681)
• Reduced KLK2 expression is a strong and independent predictor of poor prognosis in ERG-negative prostate cancer. (PMID:32628300)
• Early prediction of prostate cancer biochemical recurrence and identification of disease persistence using PSA isoforms and human kallikrein-2. (PMID:34486998)
• Genomic and Immunologic Correlates in Prostate Cancer with High Expression of KLK2. (PMID:38396898)

Cross-species orthologs

28 orthologs

Organism	Symbol	Gene ID
mus_musculus	Klk1b16	ENSMUSG00000038968
mus_musculus	Klk1b11	ENSMUSG00000044485
mus_musculus	Klk1b26	ENSMUSG00000053719
mus_musculus	Klk1b9	ENSMUSG00000059042
mus_musculus	Klk1b22	ENSMUSG00000060177
mus_musculus	Klk1b8	ENSMUSG00000063089
mus_musculus	Klk1b1	ENSMUSG00000063133
mus_musculus	Klk1b27	ENSMUSG00000063177
mus_musculus	Klk1b24	ENSMUSG00000063713
mus_musculus	Klk1	ENSMUSG00000063903
mus_musculus	Klk1b5	ENSMUSG00000066512
mus_musculus	Klk1b4	ENSMUSG00000066513
mus_musculus	Klk1b3	ENSMUSG00000066515
mus_musculus	Klk1b21	ENSMUSG00000066516
rattus_norvegicus		ENSRNOG00000066972
rattus_norvegicus		ENSRNOG00000067174
rattus_norvegicus		ENSRNOG00000069479
drosophila_melanogaster	CG9673	FBGN0030775
drosophila_melanogaster	CG4477	FBGN0035971
drosophila_melanogaster	CG17404	FBGN0038001
drosophila_melanogaster	CG12256	FBGN0038002
drosophila_melanogaster	CG3916	FBGN0038003
drosophila_melanogaster	CG17477	FBGN0038479
drosophila_melanogaster	CG4053	FBGN0038482
drosophila_melanogaster	CG31269	FBGN0051269
drosophila_melanogaster	CG32808	FBGN0052808
drosophila_melanogaster	Phae2	FBGN0263235
drosophila_melanogaster	Send2	FBGN0264253

Paralogs (12): PRSS54 (ENSG00000103023), KLK14 (ENSG00000129437), KLK8 (ENSG00000129455), TMPRSS4 (ENSG00000137648), KLK3 (ENSG00000142515), KLK1 (ENSG00000167748), KLK4 (ENSG00000167749), KLK5 (ENSG00000167754), KLK11 (ENSG00000167757), KLK7 (ENSG00000169035), KLK12 (ENSG00000186474), PRSS58 (ENSG00000258223)

Protein

Protein identifiers

Kallikrein-2 — P20151 (reviewed: P20151)

Alternative names: Glandular kallikrein-1, Tissue kallikrein-2

All UniProt accessions (9): P20151, A0A024R4J4, A0A075B7A6, M0QXQ7, M0R0M2, M0R0M4, M0R1T3, M0R2W5, Q6T774

UniProt curated annotations — full annotation on UniProt →

Function. Glandular kallikreins cleave Met-Lys and Arg-Ser bonds in kininogen to release Lys-bradykinin.

Miscellaneous. May be produced at very low levels due to a premature stop codon in the mRNA, leading to nonsense-mediated mRNA decay.

Similarity. Belongs to the peptidase S1 family. Kallikrein subfamily.

Isoforms (4)

UniProt ID	Names	Canonical?
P20151-1	1	yes
P20151-2	2, PGK-10A
P20151-3	3
P20151-4	4

RefSeq proteins (3): NP_001002231, NP_001243009, NP_005542* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR001254	Trypsin_dom	Domain
IPR001314	Peptidase_S1A	Family
IPR009003	Peptidase_S1_PA	Homologous_superfamily
IPR018114	TRYPSIN_HIS	Active_site
IPR033116	TRYPSIN_SER	Active_site
IPR043504

Pfam: PF00089

UniProt features (40 total): strand 14, disulfide bond 5, helix 5, splice variant 3, sequence variant 3, active site 3, sequence conflict 2, signal peptide 1, propeptide 1, chain 1, domain 1, glycosylation site 1

Structure

Experimental structures (PDB)

2 structures.

PDB	Method	Resolution (Å)
4NFE	X-RAY DIFFRACTION	1.9
4NFF	X-RAY DIFFRACTION	1.9

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-P20151-F1	92.62	0.88

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Catalytic / active sites (3): 65 (charge relay system); 120 (charge relay system); 213 (charge relay system)

Disulfide bonds (5): 152–219, 184–198, 209–234, 31–173, 50–66

Glycosylation sites (1): 102

Function

Pathways and Gene Ontology

Reactome pathways

11 pathways

ID	Pathway
R-HSA-1592389	Activation of Matrix Metalloproteinases
R-HSA-381426	Regulation of Insulin-like Growth Factor (IGF) transport and uptake by Insulin-like Growth Factor Binding Proteins (IGFBPs)
R-HSA-5625886	Activated PKN1 stimulates transcription of AR (androgen receptor) regulated genes KLK2 and KLK3
R-HSA-1474228	Degradation of the extracellular matrix
R-HSA-1474244	Extracellular matrix organization
R-HSA-162582	Signal Transduction
R-HSA-194315	Signaling by Rho GTPases
R-HSA-195258	RHO GTPase Effectors
R-HSA-392499	Metabolism of proteins
R-HSA-5625740	RHO GTPases activate PKNs
R-HSA-9716542	Signaling by Rho GTPases, Miro GTPases and RHOBTB3

MSigDB gene sets: 66 (showing top): GOBP_REGULATION_OF_BLOOD_PRESSURE, GOBP_CIRCULATORY_SYSTEM_PROCESS, GOCC_SECRETORY_GRANULE, HASLINGER_B_CLL_WITH_MUTATED_VH_GENES, GOBP_REGULATION_OF_SYSTEMIC_ARTERIAL_BLOOD_PRESSURE, CAGCTG_AP4_Q5, GOBP_PROTEIN_MATURATION, MODULE_109, NELSON_RESPONSE_TO_ANDROGEN_UP, FONTAINE_PAPILLARY_THYROID_CARCINOMA_DN, WANG_RESPONSE_TO_FORSKOLIN_UP, PID_AR_TF_PATHWAY, WANG_RESPONSE_TO_ANDROGEN_UP, GOBP_ZYMOGEN_ACTIVATION, GOCC_SECRETORY_VESICLE

GO Biological Process (3): regulation of systemic arterial blood pressure (GO:0003073), zymogen activation (GO:0031638), proteolysis (GO:0006508)

GO Molecular Function (4): serine-type endopeptidase activity (GO:0004252), peptidase activity (GO:0008233), serine-type peptidase activity (GO:0008236), hydrolase activity (GO:0016787)

GO Cellular Component (4): extracellular region (GO:0005576), obsolete extracellular space (GO:0005615), secretory granule (GO:0030141), extracellular exosome (GO:0070062)

Reactome top-level categories

Rollup of top-8 pathways:

Category	Pathways
Degradation of the extracellular matrix	1
Metabolism of proteins	1
RHO GTPases activate PKNs	1
Extracellular matrix organization	1
Signaling by Rho GTPases, Miro GTPases and RHOBTB3	1
Signaling by Rho GTPases	1
RHO GTPase Effectors	1
Signal Transduction	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
regulation of blood pressure	1
protein processing	1
protein metabolic process	1
endopeptidase activity	1
serine-type peptidase activity	1
hydrolase activity	1
catalytic activity, acting on a protein	1
peptidase activity	1
serine hydrolase activity	1
catalytic activity	1
cellular anatomical structure	1
endomembrane system	1
secretory vesicle	1
extracellular vesicle	1

Protein interactions and networks

STRING

1174 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
KLK2	SERPINA4	P29622	997
KLK2	ACP3	P15309	948
KLK2	KNG1	P01042	909
KLK2	MSMB	P08118	873
KLK2	SLC45A3	Q96JT2	847
KLK2	TGM4	P49221	842
KLK2	AR	P10275	823
KLK2	SERPINA5	P05154	818
KLK2	SERPINA3	P01011	796
KLK2	ANO7	Q6IWH7	743
KLK2	STEAP2	Q8NFT2	739
KLK2	GBA1	P04062	722
KLK2	NKX3-1	Q99801	695
KLK2	SPINT1	O43278	626
KLK2	BDKRB2	P30411	625

IntAct

4 interactions, top by confidence:

A	B	Type	Score
KLK2	SERPINE2	psi-mi:“MI:0914”(association)	0.350
KLK2	MANBA	psi-mi:“MI:0914”(association)	0.350
KLK2	VWA8	psi-mi:“MI:0914”(association)	0.350

BioGRID (38): KLK2 (Affinity Capture-MS), KLK2 (Affinity Capture-MS), ADAMTS1 (Affinity Capture-MS), SERPINB6 (Affinity Capture-MS), SERPINE2 (Affinity Capture-MS), APLP2 (Affinity Capture-MS), GLG1 (Affinity Capture-MS), SERPINE2 (Affinity Capture-MS), APLP2 (Affinity Capture-MS), GLG1 (Affinity Capture-MS), SERPINF2 (Reconstituted Complex), SERPINA3 (Reconstituted Complex), SERPINA5 (Affinity Capture-Western), SERPINE2 (Affinity Capture-MS), APLP2 (Affinity Capture-MS)

ESM2 similar proteins: A7WPL7, O35164, O35205, O46683, O88780, P00770, P04187, P07288, P08883, P08884, P09582, P09650, P10144, P11032, P11034, P13366, P15119, P17977, P20151, P20718, P21812, P21842, P21844, P23946, P28293, P33619, P36368, P36369, P43430, P49862, P50339, P50340, P50341, P52195, P56435, P79204, P80219, P80931, P85202, P97592

Diamond homologs: A7WPL7, O35164, O35205, O46683, O60259, O88780, P00746, P00752, P00760, P00761, P00762, P00763, P00764, P00770, P00772, P00773, P04187, P06870, P06871, P07146, P07288, P08311, P08426, P08882, P08883, P08884, P09582, P09650, P10144, P11032, P11033, P11034, P12323, P12544, P12788, P13366, P15119, P16049, P17977, P18291

SIGNOR signaling

1 interactions.

A	Effect	B	Mechanism
KLK2	up-regulates	NCOA4

Disease & clinical

Clinical variants and AI predictions

ClinVar

49 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	44
Likely benign	4
Benign	1

Top pathogenic / likely-pathogenic (0)

SpliceAI

950 predictions. Top by Δscore:

Variant	Effect	Δscore
19:50876754:GGAGT:G	donor_gain	0.9900
19:50876755:GAGTG:G	donor_gain	0.9900
19:50876757:GT:G	donor_gain	0.9900
19:50876756:A:T	donor_gain	0.9800
19:50876811:G:T	donor_gain	0.9800
19:50878402:AG:A	acceptor_gain	0.9800
19:50878403:GG:G	acceptor_gain	0.9800
19:50876754:G:GT	donor_gain	0.9700
19:50876755:GAGT:G	donor_gain	0.9700
19:50876811:G:GT	donor_gain	0.9700
19:50874711:C:CA	donor_gain	0.9500
19:50876448:T:G	acceptor_gain	0.9500
19:50873516:ACTGG:A	donor_loss	0.9400
19:50873517:CTGG:C	donor_loss	0.9400
19:50873518:TGGTG:T	donor_loss	0.9400
19:50873519:GGT:G	donor_loss	0.9400
19:50873520:GTG:G	donor_loss	0.9400
19:50873521:T:C	donor_loss	0.9400
19:50873522:GAGA:G	donor_loss	0.9400
19:50876779:GT:G	donor_gain	0.9400
19:50876786:G:GT	donor_gain	0.9400
19:50873270:C:T	donor_gain	0.9300
19:50874795:GCTGT:G	donor_gain	0.9300
19:50873515:CACTG:C	donor_gain	0.9200
19:50874735:AT:A	donor_gain	0.9200
19:50874736:T:C	donor_gain	0.9200
19:50878398:CCTTA:C	acceptor_loss	0.9200
19:50878399:CTTA:C	acceptor_loss	0.9200
19:50878400:TTAG:T	acceptor_loss	0.9200
19:50878401:T:G	acceptor_loss	0.9200

AlphaMissense

1699 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
19:50876736:G:C	W157C	0.996
19:50876736:G:T	W157C	0.996
19:50878529:G:C	W252C	0.996
19:50878529:G:T	W252C	0.996
19:50876970:T:A	C198S	0.993
19:50876971:G:C	C198S	0.993
19:50874849:T:A	W59R	0.991
19:50874849:T:C	W59R	0.991
19:50878527:T:A	W252R	0.991
19:50878527:T:C	W252R	0.991
19:50874851:G:C	W59C	0.990
19:50874851:G:T	W59C	0.990
19:50876624:A:T	D120V	0.990
19:50876624:A:C	D120A	0.989
19:50876928:T:A	C184S	0.989
19:50876929:G:C	C184S	0.989
19:50878408:A:T	D212V	0.989
19:50876734:T:A	W157R	0.988
19:50876734:T:C	W157R	0.988
19:50874870:T:A	C66S	0.987
19:50874871:G:C	C66S	0.987
19:50874788:G:C	W38C	0.986
19:50874788:G:T	W38C	0.986
19:50878408:A:C	D212A	0.986
19:50878414:G:T	G214V	0.986
19:50877003:T:A	C209S	0.985
19:50877004:G:C	C209S	0.985
19:50878409:T:A	D212E	0.985
19:50878409:T:G	D212E	0.985
19:50876624:A:G	D120G	0.984

dbSNP variants (sampled 300 via entrez): RS1000127141 (19:50879451 G>A,C), RS1000255023 (19:50877531 C>T), RS1000465860 (19:50875739 C>G,T), RS1000734104 (19:50880853 T>A), RS1000905369 (19:50874101 C>T), RS1001776811 (19:50878094 GCATCCTGCAGATGGTCCCGGCCCT>G), RS1001790626 (19:50875370 G>A,T), RS1001939329 (19:50876074 G>C), RS1002795779 (19:50875944 G>A), RS1002858402 (19:50881015 T>A,G), RS1002906837 (19:50875795 T>C,G), RS1003381853 (19:50880755 C>G), RS1003737133 (19:50872348 T>C), RS1004281581 (19:50873108 A>C,T), RS1004353501 (19:50872740 G>A,T)

Disease associations

OMIM: gene MIM:147960 | disease phenotypes: MIM:601626

GenCC curated gene-disease

Mondo (1): acute myeloid leukemia (MONDO:0018874)

Orphanet (1): Acute myeloid leukemia (Orphanet:519)

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

17 associations (top):

Study	Trait	p-value
GCST001799_2	Prostate-specific antigen levels	6.000000e-20
GCST001946_4	PCA3 expression level	1.000000e-08
GCST002112_14	Celiac disease	6.000000e-06
GCST003055_5	Tandem gait	4.000000e-07
GCST004093_17	Prostate-specific antigen levels	9.000000e-186
GCST004093_18	Prostate-specific antigen levels	2.000000e-111
GCST004093_19	Prostate-specific antigen levels	8.000000e-17
GCST004093_20	Prostate-specific antigen levels	1.000000e-85
GCST004093_21	Prostate-specific antigen levels	4.000000e-09
GCST004093_22	Prostate-specific antigen levels	1.000000e-07
GCST004093_23	Prostate-specific antigen levels	8.000000e-10
GCST004093_24	Prostate-specific antigen levels	3.000000e-11
GCST004093_25	Prostate-specific antigen levels	2.000000e-45
GCST004094_11	Prostate-specific antigen levels (conditioned on lead SNPs)	8.000000e-10
GCST004094_17	Prostate-specific antigen levels (conditioned on lead SNPs)	4.000000e-16
GCST008860_10	Prostate cancer	3.000000e-09
GCST011829_15	Prostate cancer	2.000000e-08

EFO canonical traits (1, from GWAS)

EFO ID	Trait name
EFO:0005127	cancer biomarker measurement

MeSH disease descriptors (1)

Descriptor	Name	Tree numbers
D015470	Leukemia, Myeloid, Acute	C04.557.337.539.275; C15.378.508.539.275

Drugs & pharmacology

Drug and pharmacology data

Is drug target: yes

ChEMBL targets (1): CHEMBL2442 (SINGLE PROTEIN)

PharmGKB: 1 entry (VIP=true, CPIC=false)

GtoPdb / IUPHAR curated pharmacology

(IUPHAR/BPS Guide to Pharmacology — expert-curated)

Target class: enzyme — S1: Chymotrypsin

Most potent curated ligand interactions (1 total), top 1:

Ligand	Action	Affinity	Parameter
hK2p01 derivative KLK2 inhibitor	Inhibition	5.85	pKi

ChEMBL bioactivities

11 potent at pChembl≥5 of 11 total, top 11 by pChembl (potency: 10 = 0.1 nM, 6 = 1 µM).

pChembl	Type	Value	Unit	Molecule
6.66	IC50	220	nM	CHEMBL1184949
6.28	IC50	530	nM	CHEMBL239535
6.14	IC50	720	nM	CHEMBL238913
5.85	Ki	1410	nM	CHEMBL2171880
5.80	Ki	1600	nM	FUKUGETIN
5.61	IC50	2440	nM	CHEMBL3771081
5.52	IC50	3020	nM	CHEMBL3770794
5.50	IC50	3200	nM	FUKUGETIN
5.47	IC50	3400	nM	CHEMBL1240617
5.00	Ki	1e+04	nM	CHEMBL4070056
5.00	Ki	1e+04	nM	CHEMBL4094403

PubChem BioAssay actives

6 with measured affinity, of 19 total; 5 most potent distinct compounds. Largely complementary to BindingDB; screening values are coarse (µM, 4 dp), so sub-nM hits tie at the floor.

Compound	Assay	Type	Value	Unit
2-[[(2S)-2-[[(2S)-2-[[(2S)-2-[[(2S)-2-[[(2S)-2-[[(2S)-6-amino-2-[[(2S)-2-[[(2S)-2-[[(2S)-2-aminopropanoyl]amino]-5-(diaminomethylideneamino)pentanoyl]amino]-3-phenylpropanoyl]amino]hexanoyl]amino]-3-methylbutanoyl]amino]-3-(1H-indol-3-yl)propanoyl]amino]-3-(1H-indol-3-yl)propanoyl]amino]propanoyl]amino]propanoyl]amino]acetic acid	702053: Inhibition of human KLK2 after 1 hr by phage-display based Immunofluorometric Assay	ki	1.4100	uM
8-[(2R,3S)-5,7-dihydroxy-2-(4-hydroxyphenyl)-4-oxo-2,3-dihydrochromen-3-yl]-2-(3,4-dihydroxyphenyl)-5,7-dihydroxy-2,3-dihydrochromen-4-one	1281380: Mixed-type inhibition of human tissue kallikrein-2 expressed in baculovirus infected insect cells using Abz-KLRSSQ-EDDnp as substrate preincubated for 10 mins followed by substrate addition by Lineweaver-Burk plot analysis	ki	1.6000	uM
(2S)-2-[[(2S)-2-[[(2S)-2-[[(2S)-2-[[(2S)-2-[[(2S)-2-[[(2S)-6-amino-2-[[(2S)-2-[[(2S)-2-[[(2S)-2-amino-3-hydroxypropanoyl]amino]-5-(diaminomethylideneamino)pentanoyl]amino]-3-phenylpropanoyl]amino]hexanoyl]amino]-3-methylbutanoyl]amino]-3-(1H-indol-3-yl)propanoyl]amino]-3-(1H-indol-3-yl)propanoyl]amino]propanoyl]amino]propanoyl]amino]-3-phenylpropanoic acid	507749: Binding affinity to human kallikrein 2	ic50	3.4000	uM
(2R)-2-[[(2R)-2-[[2-[[2-[[2-[[(2S)-2-[[(7R,10S,13S,16S,22S,25S,28S,31R,34S,37S,45S,48S,51R)-51-acetamido-45-benzyl-10-[(2S)-butan-2-yl]-34-(4-carbamimidamidobutyl)-13-(carboxymethyl)-48-(hydroxymethyl)-22,25,37-tris[(4-hydroxyphenyl)methyl]-9,12,15,21,24,27,30,33,36,39,44,47,50-tridecaoxo-28-propan-2-yl-5,53,58-trithia-8,11,14,20,23,26,29,32,35,38,43,46,49-tridecazapentacyclo[29.25.3.13,55.016,20.040,43]hexaconta-1(56),2,55(60)-triene-7-carbonyl]amino]propanoyl]-methylamino]acetyl]-methylamino]acetyl]-methylamino]acetyl]amino]-5-carbamimidamidopentanoyl]amino]-5-carbamimidamidopentanoic acid	1455801: Inhibition of recombinant human C-terminal 10His-tagged KLK2 (1 to 261 residues) expressed in mouse NS0 cells using fluorogenic PFR-AMC peptide as substrate after 5 mins by fluorescence based assay	ki	10.0000	uM
(7R,10S,13S,21S,24S,27S,30S,33S,36S,39S,42S,45R)-7-acetamido-36-(3-amino-3-oxopropyl)-13-benzyl-24-(4-carbamimidamidobutyl)-39-(carboxymethyl)-10-(hydroxymethyl)-21-[(4-hydroxyphenyl)methyl]-33-(1H-imidazol-5-ylmethyl)-30-methyl-42-(2-methylpropyl)-8,11,14,19,22,25,28,34,37,40,43-undecaoxo-5,47,52-trithia-9,12,15,20,23,26,29,32,35,38,41,44-dodecazatetracyclo[25.23.3.13,49.015,18]tetrapentaconta-1,3(54),49-triene-45-carboxylic acid	1455801: Inhibition of recombinant human C-terminal 10His-tagged KLK2 (1 to 261 residues) expressed in mouse NS0 cells using fluorogenic PFR-AMC peptide as substrate after 5 mins by fluorescence based assay	ki	10.0000	uM

CTD chemical–gene interactions

42 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Testosterone	increases expression, increases reaction, affects binding, affects cotreatment, decreases reaction	4
methylselenic acid	decreases expression, decreases reaction, affects expression	3
Dihydrotestosterone	increases expression, increases reaction, decreases reaction	3
bicalutamide	increases expression, decreases expression, decreases reaction	2
Resveratrol	decreases expression, decreases reaction, increases expression	2
Curcumin	affects cotreatment, decreases expression	2
Metribolone	increases expression	2
fluorene-9-bisphenol	increases expression	1
testosterone-3-carboxymethyloxime-bovine serum albumin conjugate	affects expression	1
merbarone	decreases reaction, increases expression	1
benzyloxycarbonylleucyl-leucyl-leucine aldehyde	decreases reaction, increases expression	1
mibolerone	decreases reaction, increases expression	1
6-formylindolo(3,2-b)carbazole	decreases reaction, increases expression	1
isobavachin	decreases expression	1
palbociclib	increases expression, increases reaction	1
Grape Seed Proanthocyanidins	affects cotreatment, increases expression	1
enzalutamide	decreases expression	1
EPZ004777	decreases expression	1
Dutasteride	decreases expression	1
Arsenic Trioxide	affects cotreatment, decreases expression	1
Vorinostat	decreases expression	1
Acetaminophen	increases expression	1
Amphotericin B	increases expression	1
Benzo(a)pyrene	decreases methylation	1
Calcitriol	increases expression, affects cotreatment	1
Catechin	increases expression, affects cotreatment	1
Cisplatin	affects response to substance	1
Endosulfan	increases expression	1
Estradiol	affects cotreatment, decreases expression	1
Ethinyl Estradiol	affects cotreatment, decreases expression	1

ChEMBL screening assays

18 unique, capped per target: 18 binding

Representative assays (with source publication via chembl_document):

Assay ID	Type	Description	Source paper
CHEMBL1244642	Binding	Binding affinity to human kallikrein 2	Phage-encoded combinatorial chemical libraries based on bicyclic peptides. — Nat Chem Biol

Clinical trials (associated diseases)

300 trials via MONDO — disease-level, not drug-specific.

Trial	Phase	Status	Title
NCT00199147	PHASE4	UNKNOWN	Efficacy of G-CSF-Priming in Elderly AML Patients
NCT00304447	PHASE4	COMPLETED	Study Evaluating the Effect of Corticosteroids on Mylotarg® Infusion-Related Adverse Events in Patients With Leukemia
NCT00464217	PHASE4	COMPLETED	Treatment of the Acute Myeloblastic Leukaemia in Patients Over 65 Years
NCT00487448	PHASE4	COMPLETED	SMD_FLAG-IDA_98: FLAG-IDA in Induction Treatment of High Risk Myelodysplastic Syndromes or Secondary Acute Myeloblastic Leukemia
NCT00488709	PHASE4	COMPLETED	Fludarabine, Cytarabine, Topotecan in Treating Patients With Relapsed or Refractory Acute Myeloid Leukemia
NCT00686543	PHASE4	COMPLETED	Oral Posaconazole in High Risk Patients With Gastrointestinal Dysfunction (Study P05115)
NCT01041040	PHASE4	COMPLETED	LAM07: Study to Analyze the Efficacy of a Risk Adapted Treatment Strategy, Including Gemtuzumab Ozogamicin (GO) During Consolidation, for Patients With Acute Myeloid Leukemia (AML)
NCT01198054	PHASE4	TERMINATED	LENA-LMA-5:Lenalidomide in Acute Myeloid Leukemia (AML)
NCT01200355	PHASE4	COMPLETED	Posaconazole Versus Micafungin for Prophylaxis Against Invasive Fungal Infections During Neutropenia in Patients Undergoing Chemotherapy for Acute Myelogenous Leukemia, Acute Lymphocytic Leukemia or Myelodysplastic Syndrome
NCT01347996	PHASE4	COMPLETED	Maintenance Therapy With Ceplene® (Histamine) and IL-2 on Immune Response and MRD in Acute Myeloid Leukemia
NCT01587430	PHASE4	UNKNOWN	3 Anthracyclines, 2 Types of Consolidation With Different ARA-C Doses and Maintenance in Adult Acute Myeloid Leukemia
NCT01819792	PHASE4	COMPLETED	Respiratory Viral Infections During Acute Myeloid Leukemia (AML)Chemotherapy Related Aplasia
NCT02024308	PHASE4	UNKNOWN	AML1-ETO Acute Myeloid Leukemia With Fludarabine and Cytarabine Chemotherapy
NCT02027064	PHASE4	UNKNOWN	Interferon for the Intervention of Molecular Relapse in t (8; 21) AML After Allo-HSCT
NCT02277847	PHASE4	UNKNOWN	Idarubicin at Different Dosages as Induction Therapy for Newly Diagnosed Acute Myeloid Leukaemia
NCT02386800	PHASE4	ACTIVE_NOT_RECRUITING	CINC424A2X01B Rollover Protocol
NCT02926586	PHASE4	COMPLETED	Fludarabine and Cytarabine Versus High-dose Cytarabine for CBF-AML
NCT02933333	PHASE4	UNKNOWN	G-CSF Alone or Combination With GM-CSF on Prevention and Treatment of Infection in Children With Malignant Tumor
NCT03026842	PHASE4	UNKNOWN	Decitabine Versus Conventional Chemotherapy for Maintenance Therapy of Acute Myeloid Leukemia With t(8;21)
NCT03150134	PHASE4	UNKNOWN	Early Tapering of Immunosuppressive Agents to Immunomodulation to Improve Survival of AML Patients
NCT05144243	PHASE4	ACTIVE_NOT_RECRUITING	Study to Assess Adverse Events and Change in Disease State of Oral Venetoclax in Combination With Subcutaneous (SC) Azacitidine in Newly Diagnosed Adult Participants With Acute Myeloid Leukemia (AML) Who Are Ineligible for Intensive Chemotherapy in China
NCT06370000	PHASE4	RECRUITING	Oral Azacitidine in Transplant-Eligible Patients With Acute Myeloid Leukemia (AML) Suffering From Health-Inequality
NCT06571825	PHASE4	RECRUITING	RIC Allo-HSCT vs. Venetoclax-Based Consolidation in Elderly AML Patients After First CR
NCT07016165	PHASE4	RECRUITING	Ciprofloxacin vs Ceftazidime for Empirical Treatment of High-Risk Neutropenic Fever in Children With Hematologic Malignancies
NCT07044687	PHASE4	RECRUITING	Study to Assess Adverse Events and Change in Disease Activity of Oral Venetoclax in Combination With Subcutaneous (SC) or Intravenous (IV) Azacitidine in Newly Diagnosed Adult Participants With Acute Myeloid Leukemia (AML) Who Are Ineligible for Standard Induction Therapy in India
NCT07486713	PHASE4	RECRUITING	Olutasidenib DDI Study in Patients With IDH1 Mutation Positive Malignancies
NCT07561892	PHASE4	RECRUITING	Study of the Effectiveness and Safety of Daunorubicin /Idarubicin ± Silibinin in Treating Newly Diagnosed AML (Non-M3).
NCT00000589	PHASE3	COMPLETED	Trial to Reduce Alloimmunization to Platelets (TRAP)
NCT00044486	PHASE3	COMPLETED	Prophylaxis Trial of Posaconazole Versus Standard Azole Therapy for Neutropenic Patients (Study P01899)
NCT00093990	PHASE3	COMPLETED	Tipifarnib Versus Best Supportive Care in the Treatment of Newly Diagnosed Acute Myeloid Leukemia (AML)
NCT00125606	PHASE3	TERMINATED	Phase 3 Trial for AML Patients in CR2 Comparing 8Gy TBI /Fludarabine to Conditioning With TBI 12Gy/Cyclophosphamide
NCT00136084	PHASE3	COMPLETED	Treatment of Patients With Newly Diagnosed Acute Myeloid Leukemia or Myelodysplasia
NCT00146120	PHASE3	COMPLETED	Risk-Adapted Therapy of Acute Myeloid Leukemia of Adults (18-60 Years) According to the Cytogenetic Result
NCT00150878	PHASE3	TERMINATED	Standard vs. Reduced-Intensity Conditioning in Patients With Acute Myeloid Leukemia in First Remission
NCT00151255	PHASE3	COMPLETED	All-Trans Retinoic Acid in Combination With Standard Induction and Consolidation Therapy in Older Patients With Newly Diagnosed Acute Myeloid Leukemia
NCT00152139	PHASE3	COMPLETED	Stem Cell Transplantation for Patients With Hematologic Malignancies
NCT00152594	PHASE3	TERMINATED	Voriconazole or Placebo in the Prophylaxis of Lung Infiltrates in Patients Undergoing Induction Chemotherapy for Acute Myelogenous Leukemia
NCT00186966	PHASE3	COMPLETED	Treatment of Children and Adolescents With Refractory or Relapsed Acute Myeloid Leukemia
NCT00226512	PHASE3	WITHDRAWN	To Determine the Role of Adding Campath-1H or ATG Given In-vivo in Addition to Fludarabine and Low Dose Busulfex on Outcome in Patients Treated With Reduced Intensity Conditioning
NCT00260832	PHASE3	COMPLETED	Trial of Decitabine in Patients With Acute Myeloid Leukemia