KREMEN2

Summary

KREMEN2 (kringle containing transmembrane protein 2, HGNC:18797) is a protein-coding gene on chromosome 16p13.3, encoding Kremen protein 2 (Q8NCW0). Receptor for Dickkopf proteins.

This gene encodes a high-affinity dickkopf homolog 1 (DKK1) transmembrane receptor. A similar protein in mouse functions interacts with with DKK1 to block wingless (WNT)/beta-catenin signaling. The encoded protein forms a ternary membrane complex with DKK1 and the WNT receptor lipoprotein receptor-related protein 6 (LRP6), and induces rapid endocytosis and removal of LRP6 from the plasma membrane. It contains extracellular kringle, WSC, and CUB domains. Alternatively spliced transcript variants encoding distinct isoforms have been observed for this gene.

Source: NCBI Gene 79412 — RefSeq curated summary.

At a glance

• Clinical variants (ClinVar): 75 total
• MANE Select transcript: NM_172229

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:18797
Approved symbol	KREMEN2
Name	kringle containing transmembrane protein 2
Location	16p13.3
Locus type	gene with protein product
Status	Approved
Aliases	MGC10791, KRM2
Ensembl gene	ENSG00000131650
Ensembl biotype	protein_coding
OMIM	609899
Entrez	79412

Gene structure

Transcript identifiers

Ensembl transcripts: 7 — 7 protein_coding

ENST00000303746, ENST00000319500, ENST00000571007, ENST00000572045, ENST00000575769, ENST00000575885, ENST00000924037

RefSeq mRNA: 4 — MANE Select: NM_172229 NM_001253725, NM_001253726, NM_024507, NM_172229

CCDS: CCDS10483, CCDS10484, CCDS58412, CCDS58413

Canonical transcript exons

ENST00000303746 — 9 exons

Exon	Start	End
ENSE00000901601	2964859	2965033
ENSE00000901602	2966140	2966231
ENSE00000901603	2966325	2966449
ENSE00000901604	2966642	2966795
ENSE00000901605	2966910	2967242
ENSE00000901606	2967320	2967445
ENSE00001279431	2967526	2967604
ENSE00001906320	2967810	2968380
ENSE00002647285	2964275	2964614

Expression profiles

Bgee: expression breadth ubiquitous, 128 present calls, max score 76.97.

FANTOM5 (CAGE): breadth broad, TPM avg 0.8223 / max 31.9352, expressed in 382 samples.

FANTOM5 promoters (2 alternative TSS)

Promoter ID	TPM avg	Samples expressed
152341	0.7774	370
152340	0.0450	17

Top tissues by expression

262 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
pancreatic ductal cell	CL:0002079	76.97	silver quality
skin of abdomen	UBERON:0001416	71.49	gold quality
skin of leg	UBERON:0001511	69.66	gold quality
buccal mucosa cell	CL:0002336	69.13	gold quality
zone of skin	UBERON:0000014	68.96	gold quality
right frontal lobe	UBERON:0002810	68.16	gold quality
lower esophagus mucosa	UBERON:0035834	67.89	gold quality
anterior cingulate cortex	UBERON:0009835	67.62	gold quality
cingulate cortex	UBERON:0003027	67.57	gold quality
Brodmann (1909) area 9	UBERON:0013540	66.06	gold quality
C1 segment of cervical spinal cord	UBERON:0006469	65.86	gold quality
dorsolateral prefrontal cortex	UBERON:0009834	65.24	gold quality
esophagus squamous epithelium	UBERON:0006920	65.01	gold quality
amygdala	UBERON:0001876	63.83	gold quality
type B pancreatic cell	CL:0000169	63.65	gold quality
spinal cord	UBERON:0002240	63.51	gold quality
epithelium of esophagus	UBERON:0001976	63.42	gold quality
esophagus mucosa	UBERON:0002469	63.17	gold quality
biceps brachii	UBERON:0001507	63.04	gold quality
neocortex	UBERON:0001950	63.00	gold quality
skeletal muscle tissue of biceps brachii	UBERON:0004502	62.76	gold quality
skin of hip	UBERON:0001554	62.74	silver quality
prefrontal cortex	UBERON:0000451	62.68	gold quality
squamous epithelium	UBERON:0006914	62.66	gold quality
frontal cortex	UBERON:0001870	62.60	gold quality
cerebral cortex	UBERON:0000956	62.55	gold quality
cartilage tissue	UBERON:0002418	62.55	gold quality
gingival epithelium	UBERON:0001949	62.46	gold quality
Ammon’s horn	UBERON:0001954	61.84	gold quality
gingiva	UBERON:0001828	61.67	gold quality

Single-cell (SCXA)

Detected in 1 experiment(s), a significant marker in 0.

Experiment	Marker?	Max mean expression
E-ANND-3	no	0.98

Regulation

Is transcription factor: no

Literature-anchored findings (GeneRIF, showing 3)

• The mRNA expression levels of DKK-1 binding receptor LRP5/6 and Krm1/2 in SCs from patients with MM were significantly higher than those in myeloma cells and in SCs from healthy donors. (PMID:20846389)
• KREMEN2 is upregulated in cancers, consistent with its role in inhibiting Kremen1-induced cell death (PMID:31069116)
• N[6]-Methyladenosine-Modified KREMEN2 Promotes Tumorigenesis and Malignant Progression of High-Grade Serous Ovarian Cancer. (PMID:38615731)

Cross-species orthologs

2 orthologs

Organism	Symbol	Gene ID
mus_musculus	Kremen2	ENSMUSG00000040680
rattus_norvegicus	Kremen2	ENSRNOG00000004122

Paralogs (1): KREMEN1 (ENSG00000183762)

Protein

Protein identifiers

Kremen protein 2 — Q8NCW0 (reviewed: Q8NCW0)

Alternative names: Dickkopf receptor 2, Kringle domain-containing transmembrane protein 2, Kringle-containing protein marking the eye and the nose

All UniProt accessions (1): Q8NCW0

UniProt curated annotations — full annotation on UniProt →

Function. Receptor for Dickkopf proteins. Cooperates with DKK1/2 to inhibit Wnt/beta-catenin signaling by promoting the endocytosis of Wnt receptors LRP5 and LRP6. Plays a role in limb development; attenuates Wnt signaling in the developing limb to allow normal limb patterning and can also negatively regulate bone formation.

Subunit / interactions. Interacts with ERLEC1. Forms a ternary complex with DKK1 and LRP6.

Subcellular location. Membrane.

Domain organisation. Binding to ERLEC1 is mediated by the oligosaccharides linked to the kringle domain.

Isoforms (6)

UniProt ID	Names	Canonical?
Q8NCW0-1	1	yes
Q8NCW0-2	2, Kremen2a
Q8NCW0-3	3, Kremen2b
Q8NCW0-4	4, Kremen2c
Q8NCW0-5	5
Q8NCW0-6	6

RefSeq proteins (4): NP_001240654, NP_001240655, NP_078783, NP_757384* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR000001	Kringle	Domain
IPR000859	CUB_dom	Domain
IPR002889	WSC_carb-bd	Domain
IPR013806	Kringle-like	Homologous_superfamily
IPR017076	Kremen	Family
IPR018056	Kringle_CS	Conserved_site
IPR035914	Sperma_CUB_dom_sf	Homologous_superfamily
IPR038178	Kringle_sf	Homologous_superfamily
IPR051836	Kremen_rcpt	Family

Pfam: PF00051, PF00431, PF01822

UniProt features (28 total): splice variant 8, glycosylation site 4, disulfide bond 4, domain 3, topological domain 2, sequence conflict 2, signal peptide 1, chain 1, sequence variant 1, transmembrane region 1, region of interest 1

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q8NCW0-F1	77.77	0.61

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Disulfide bonds (4): 36–119, 60–100, 89–114, 219–245

Glycosylation sites (4): 222, 244, 351, 49

Function

Pathways and Gene Ontology

Reactome pathways

8 pathways

ID	Pathway
R-HSA-201681	TCF dependent signaling in response to WNT
R-HSA-3772470	Negative regulation of TCF-dependent signaling by WNT ligand antagonists
R-HSA-5339717	Signaling by LRP5 mutants
R-HSA-162582	Signal Transduction
R-HSA-1643685	Disease
R-HSA-195721	Signaling by WNT
R-HSA-4791275	Signaling by WNT in cancer
R-HSA-5663202	Diseases of signal transduction by growth factor receptors and second messengers

MSigDB gene sets: 70 (showing top): GSE45365_CD8A_DC_VS_CD11B_DC_IFNAR_KO_MCMV_INFECTION_UP, TGCTGCT_MIR15A_MIR16_MIR15B_MIR195_MIR424_MIR497, AREB6_03, AREB6_01, GOBP_NEGATIVE_REGULATION_OF_MULTICELLULAR_ORGANISMAL_PROCESS, DOANE_RESPONSE_TO_ANDROGEN_DN, GOBP_APPENDAGE_DEVELOPMENT, GOBP_OSSIFICATION, DODD_NASOPHARYNGEAL_CARCINOMA_UP, TGGNNNNNNKCCAR_UNKNOWN, EGR1_01, GOBP_NEGATIVE_REGULATION_OF_OSSIFICATION, GOBP_REGULATION_OF_OSSIFICATION, GOCC_EARLY_ENDOSOME_MEMBRANE, NIKOLSKY_BREAST_CANCER_16P13_AMPLICON

GO Biological Process (4): signal transduction (GO:0007165), Wnt signaling pathway (GO:0016055), negative regulation of ossification (GO:0030279), limb development (GO:0060173)

GO Molecular Function (1): transmembrane signaling receptor activity (GO:0004888)

GO Cellular Component (3): plasma membrane (GO:0005886), early endosome membrane (GO:0031901), membrane (GO:0016020)

Reactome top-level categories

Rollup of top-6 pathways:

Category	Pathways
Signaling by WNT	1
TCF dependent signaling in response to WNT	1
Signaling by WNT in cancer	1
Signal Transduction	1
Diseases of signal transduction by growth factor receptors and second messengers	1
Disease	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
cell communication	1
cellular process	1
signaling	1
regulation of cellular process	1
cellular response to stimulus	1
cell surface receptor signaling pathway	1
ossification	1
regulation of ossification	1
negative regulation of multicellular organismal process	1
appendage development	1
signaling receptor activity	1
membrane	1
cell periphery	1
early endosome	1
endosome membrane	1
cellular anatomical structure	1

Protein interactions and networks

STRING

872 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
KREMEN2	DKK1	O94907	998
KREMEN2	ERLEC1	Q96DZ1	916
KREMEN2	LRP6	O75581	757
KREMEN2	LRP5	O75197	736
KREMEN2	DKK2	Q9UBU2	735
KREMEN2	RSPO1	Q2MKA7	713
KREMEN2	DKK4	Q9UBT3	701
KREMEN2	WNT1	P04628	673
KREMEN2	DKK3	Q9UBP4	667
KREMEN2	CTNNB1	P35222	660
KREMEN2	WNT5A	P41221	543
KREMEN2	SFRP2	Q96HF1	543
KREMEN2	KREMEN1	Q96MU8	534
KREMEN2	CANX	P27824	468
KREMEN2	SOST	Q9BQB4	441

IntAct

27 interactions, top by confidence:

A	B	Type	Score
FBXO6	MAN2B1	psi-mi:“MI:0914”(association)	0.640
KLK5	DENND11	psi-mi:“MI:0914”(association)	0.640
EDN3	MGRN1	psi-mi:“MI:0914”(association)	0.530
CLEC2D	ESYT2	psi-mi:“MI:0914”(association)	0.350
BTNL2	TMEM131L	psi-mi:“MI:0914”(association)	0.350
BRICD5	TMEM131L	psi-mi:“MI:0914”(association)	0.350
LY86	TMEM131L	psi-mi:“MI:0914”(association)	0.350
IL5RA	POTEF	psi-mi:“MI:0914”(association)	0.350
NCR3	POTEF	psi-mi:“MI:0914”(association)	0.350
CFC1	POTEF	psi-mi:“MI:0914”(association)	0.350
EDN3	POTEF	psi-mi:“MI:0914”(association)	0.350
DKK1	TK2	psi-mi:“MI:0914”(association)	0.350
ELSPBP1	QSOX1	psi-mi:“MI:0914”(association)	0.350
PRG2	QSOX1	psi-mi:“MI:0914”(association)	0.350
OIT3	WNT10B	psi-mi:“MI:0914”(association)	0.350
ALPP	MAN2B1	psi-mi:“MI:0914”(association)	0.350
KLK15	APAF1	psi-mi:“MI:0914”(association)	0.350
GXYLT1	CLGN	psi-mi:“MI:0914”(association)	0.350
ST8SIA5	CLGN	psi-mi:“MI:0914”(association)	0.350
VEGFB	NPC1	psi-mi:“MI:0914”(association)	0.350
TM2D3	SPINT1	psi-mi:“MI:0914”(association)	0.350
WNT7A	MGRN1	psi-mi:“MI:0914”(association)	0.350
CELA3A	IGF1R	psi-mi:“MI:0914”(association)	0.350
CLGN	TMEM131L	psi-mi:“MI:0914”(association)	0.350
HAPLN3	VWA8	psi-mi:“MI:0914”(association)	0.350
PRG3	IGLL5	psi-mi:“MI:0914”(association)	0.350

BioGRID (27): KREMEN2 (Synthetic Lethality), KREMEN2 (Affinity Capture-RNA), KREMEN2 (Proximity Label-MS), S (Reconstituted Complex), KREMEN2 (Affinity Capture-MS), KREMEN2 (Affinity Capture-MS), KREMEN2 (Affinity Capture-MS), KREMEN2 (Affinity Capture-MS), KREMEN2 (Affinity Capture-MS), KREMEN2 (Affinity Capture-MS), KREMEN2 (Affinity Capture-MS), KREMEN2 (Affinity Capture-MS), KREMEN2 (Affinity Capture-MS), KREMEN2 (Affinity Capture-MS), KREMEN2 (Affinity Capture-MS)

ESM2 similar proteins: A0A140LHF2, A0EQL2, D3YZF7, D7PDD4, O15533, O55237, O70394, O70540, O95866, P04278, P05111, P07994, P08689, P0C6B3, P0DP72, P15196, P17490, P18627, P40238, P55101, P60882, P97497, Q00657, Q08351, Q14393, Q14773, Q16671, Q3SWY4, Q5BK54, Q5NKT8, Q5TJE4, Q61790, Q61826, Q62588, Q6PZD2, Q6UVK1, Q6UWB1, Q7Z7M0, Q7Z7M1, Q86VR7

Diamond homologs: A2YPX3, D4AUF4, P84675, Q0D3N0, Q505J3, Q5QQ53, Q658N2, Q7KVA1, Q80XH4, Q8GY91, Q8K1S7, Q8NCW0, Q924S4, Q96MU8, Q99N43, Q9FLC0, A2BGL3, D4PHA7, P54867, Q0IIY2, Q16WU7, Q29G54, Q2TBF2, Q7Q297, Q965Q8, Q9VXV9, A8Q2D1, B3EX01, B8JI71, B8VIV4, C6KFA3, D3ZTE0, D5FM38, F1RWC3, O08628, O08859, O14786, O35276, O35375, O57382

SIGNOR signaling

2 interactions.

A	Effect	B	Mechanism
DKK1	up-regulates	KREMEN2	binding
KREMEN2	down-regulates	LRP6	binding

Disease & clinical

Clinical variants and AI predictions

ClinVar

75 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	65
Likely benign	4
Benign	1

Top pathogenic / likely-pathogenic (0)

SpliceAI

1523 predictions. Top by Δscore:

Variant	Effect	Δscore
16:2966135:CGCA:C	acceptor_loss	1.0000
16:2966136:GCA:G	acceptor_loss	1.0000
16:2966137:CA:C	acceptor_loss	1.0000
16:2966138:A:AG	acceptor_gain	1.0000
16:2966139:G:A	acceptor_loss	1.0000
16:2966139:G:GC	acceptor_gain	1.0000
16:2966139:GT:G	acceptor_gain	1.0000
16:2966139:GTA:G	acceptor_gain	1.0000
16:2966139:GTAA:G	acceptor_gain	1.0000
16:2966230:CA:C	donor_gain	1.0000
16:2966232:G:GG	donor_gain	1.0000
16:2966232:GTGA:G	donor_loss	1.0000
16:2966233:TGA:T	donor_loss	1.0000
16:2966234:GAG:G	donor_loss	1.0000
16:2966235:AGTAG:A	donor_loss	1.0000
16:2966794:AGGTG:A	donor_loss	1.0000
16:2966908:A:AG	acceptor_gain	1.0000
16:2966909:G:GG	acceptor_gain	1.0000
16:2966909:GT:G	acceptor_gain	1.0000
16:2966967:C:CA	acceptor_gain	1.0000
16:2967240:GCG:G	donor_gain	1.0000
16:2964611:CCAGG:C	donor_loss	0.9900
16:2964614:GGT:G	donor_loss	0.9900
16:2965030:GCCG:G	donor_gain	0.9900
16:2965031:CCGGT:C	donor_loss	0.9900
16:2965032:CGGT:C	donor_loss	0.9900
16:2965033:GGTG:G	donor_loss	0.9900
16:2965034:G:C	donor_loss	0.9900
16:2965035:T:A	donor_loss	0.9900
16:2966135:C:A	acceptor_gain	0.9900

AlphaMissense

2933 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
16:2964953:G:C	W63C	1.000
16:2964953:G:T	W63C	1.000
16:2966167:G:C	W99C	1.000
16:2966167:G:T	W99C	1.000
16:2965029:T:A	C89S	0.999
16:2965030:G:C	C89S	0.999
16:2966168:T:A	C100S	0.999
16:2966169:G:C	C100S	0.999
16:2966170:C:G	C100W	0.999
16:2966203:G:C	W111C	0.999
16:2966203:G:T	W111C	0.999
16:2966210:T:A	C114S	0.999
16:2966211:G:A	C114Y	0.999
16:2966211:G:C	C114S	0.999
16:2966212:C:G	C114W	0.999
16:2966417:T:C	C152R	0.999
16:2966419:C:G	C152W	0.999
16:2966429:T:C	C156R	0.999
16:2966430:G:A	C156Y	0.999
16:2966431:C:G	C156W	0.999
16:2966673:T:G	F173C	0.999
16:2967010:G:C	W247C	0.999
16:2967010:G:T	W247C	0.999
16:2965029:T:C	C89R	0.998
16:2965030:G:A	C89Y	0.998
16:2965031:C:G	C89W	0.998
16:2966143:C:A	N91K	0.998
16:2966143:C:G	N91K	0.998
16:2966165:T:A	W99R	0.998
16:2966165:T:C	W99R	0.998

dbSNP variants (sampled 300 via entrez): RS1000264883 (16:2964731 C>A), RS1000291600 (16:2964296 G>A), RS1000556724 (16:2968820 ACGCCTTCAGAGGCCTGGGTACCGTGGAG>A), RS1000870267 (16:2965983 C>T), RS1001247656 (16:2964818 C>A,T), RS1001679274 (16:2965025 C>T), RS1002032829 (16:2965644 G>T), RS1002315913 (16:2965336 G>A), RS1002869610 (16:2968425 C>T), RS1002931613 (16:2963207 G>C,T), RS1003322962 (16:2965931 C>T), RS1003559589 (16:2968119 G>A,C,T), RS1003687218 (16:2967592 C>T), RS1004056627 (16:2962951 G>A), RS1004236179 (16:2967612 G>A)

Disease associations

OMIM: gene MIM:609899 | disease phenotypes:

GenCC curated gene-disease

Mondo (1): ependymoma (MONDO:0016698)

Orphanet (1): Ependymoma (Orphanet:251636)

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

0 associations (top):

MeSH disease descriptors (1)

Descriptor	Name	Tree numbers
D004806	Ependymoma	C04.557.465.625.600.380.290; C04.557.470.670.380.290; C04.557.580.625.600.380.290

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

29 total (human), top 29 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Valproic Acid	affects expression, increases expression, increases methylation	3
Estradiol	increases expression, affects cotreatment, decreases expression	2
Aflatoxin B1	increases expression	2
propionaldehyde	increases expression	1
trichostatin A	increases expression	1
butyraldehyde	increases expression	1
S-(1,2-dichlorovinyl)cysteine	affects response to substance, increases expression	1
pentanal	increases expression	1
nutlin 3	increases expression, affects cotreatment	1
abrine	increases expression	1
jinfukang	affects cotreatment, increases expression	1
4-(4-((5-(4,5-dimethyl-2-nitrophenyl)-2-furanyl)methylene)-4,5-dihydro-3-methyl-5-oxo-1H-pyrazol-1-yl)benzoic acid	increases expression	1
Resveratrol	affects cotreatment, decreases expression	1
Air Pollutants	decreases expression, increases abundance	1
Aldehydes	increases expression	1
Atrazine	increases expression	1
Cisplatin	affects cotreatment, increases expression	1
Dactinomycin	affects cotreatment, increases expression	1
Hydrogen Peroxide	affects expression	1
Lipopolysaccharides	increases expression, affects response to substance	1
Plant Extracts	affects cotreatment, decreases expression	1
Silicon Dioxide	increases expression	1
Tobacco Smoke Pollution	decreases expression	1
Tretinoin	decreases expression	1
Triclosan	increases expression	1
Urethane	decreases expression	1
Okadaic Acid	increases expression	1
Copper Sulfate	increases expression	1
Particulate Matter	decreases expression, increases abundance	1

Clinical trials (associated diseases)

95 trials via MONDO — disease-level, not drug-specific.

Trial	Phase	Status	Title
NCT00517959	PHASE3	UNKNOWN	SCRT Versus Conventional RT in Children and Young Adults With Low Grade and Benign Brain Tumors
NCT01096368	PHASE3	COMPLETED	Maintenance Chemotherapy or Observation Following Induction Chemotherapy and Radiation Therapy in Treating Patients With Newly Diagnosed Ependymoma
NCT00003479	PHASE2	TERMINATED	Antineoplaston Therapy in Treating Patients With Ependymoma
NCT00520936	PHASE2	COMPLETED	A Study of Pemetrexed in Children With Recurrent Cancer
NCT00840047	PHASE2	ACTIVE_NOT_RECRUITING	Methionine PET/CT Studies In Patients With Cancer
NCT01088035	PHASE2	TERMINATED	Carboplatin as a Radiosensitizer in Treating Childhood Ependymoma
NCT01247922	PHASE2	TERMINATED	Single-agent Erlotinib in Patients Previously Treated With Oral Etoposide in Protocol OSI-774-205
NCT01288235	PHASE2	COMPLETED	Proton Radiotherapy for Pediatric Brain Tumors Requiring Partial Brain Irradiation
NCT01295944	PHASE2	COMPLETED	Carboplatin and Bevacizumab for Recurrent Ependymoma
NCT01356290	PHASE2	RECRUITING	Antiangiogenic Therapy for Children With Recurrent Medulloblastoma, Ependymoma, ATRT and Rare CNS Tumors
NCT01836549	PHASE2	TERMINATED	Imetelstat Sodium in Treating Younger Patients With Recurrent or Refractory Brain Tumors
NCT02125786	PHASE2	ACTIVE_NOT_RECRUITING	A Trial of Surgery and Fractionated Re-Irradiation for Recurrent Ependymoma
NCT02689336	PHASE2	WITHDRAWN	Erlotinib in Combination With Temozolomide in Treating Relapsed/Recurrent/Refractory Pediatric Solid Tumors
NCT03095248	PHASE2	TERMINATED	Trial of Selumetinib in Patients With Neurofibromatosis Type II Related Tumors
NCT03155620	PHASE2	ACTIVE_NOT_RECRUITING	Targeted Therapy Directed by Genetic Testing in Treating Pediatric Patients With Relapsed or Refractory Advanced Solid Tumors, Non-Hodgkin Lymphomas, or Histiocytic Disorders (The Pediatric MATCH Screening Trial)
NCT03173950	PHASE2	COMPLETED	Immune Checkpoint Inhibitor Nivolumab in People With Recurrent Select Rare CNS Cancers
NCT03194906	PHASE2	COMPLETED	Memantine for Prevention of Cognitive Late Effects in Pediatric Patients Receiving Cranial Radiation Therapy for Localized Brain Tumors
NCT03210714	PHASE2	ACTIVE_NOT_RECRUITING	Erdafitinib in Treating Patients With Relapsed or Refractory Advanced Solid Tumors, Non-Hodgkin Lymphoma, or Histiocytic Disorders With FGFR Mutations (A Pediatric MATCH Treatment Trial)
NCT03213652	PHASE2	ACTIVE_NOT_RECRUITING	Ensartinib in Treating Patients With Relapsed or Refractory Advanced Solid Tumors, Non-Hodgkin Lymphoma, or Histiocytic Disorders With ALK or ROS1 Genomic Alterations (A Pediatric MATCH Treatment Trial)
NCT03213665	PHASE2	COMPLETED	Tazemetostat in Treating Patients With Relapsed or Refractory Advanced Solid Tumors, Non-Hodgkin Lymphoma, or Histiocytic Disorders With EZH2, SMARCB1, or SMARCA4 Gene Mutations (A Pediatric MATCH Treatment Trial)
NCT03213678	PHASE2	COMPLETED	Samotolisib in Treating Patients With Relapsed or Refractory Advanced Solid Tumors, Non-Hodgkin Lymphoma, or Histiocytic Disorders With TSC or PI3K/MTOR Mutations (A Pediatric MATCH Treatment Trial)
NCT03213704	PHASE2	ACTIVE_NOT_RECRUITING	Larotrectinib in Treating Patients With Relapsed or Refractory Advanced Solid Tumors, Non-Hodgkin Lymphoma, or Histiocytic Disorders With NTRK Fusions (A Pediatric MATCH Treatment Trial)
NCT03220035	PHASE2	COMPLETED	Vemurafenib in Treating Patients With Relapsed or Refractory Advanced Solid Tumors, Non-Hodgkin Lymphoma, or Histiocytic Disorders With BRAF V600 Mutations (A Pediatric MATCH Treatment Trial)
NCT03233204	PHASE2	COMPLETED	Olaparib in Treating Patients With Relapsed or Refractory Advanced Solid Tumors, Non-Hodgkin Lymphoma, or Histiocytic Disorders With Defects in DNA Damage Repair Genes (A Pediatric MATCH Treatment Trial)
NCT03526250	PHASE2	COMPLETED	Palbociclib in Treating Patients With Relapsed or Refractory Rb Positive Advanced Solid Tumors, Non-Hodgkin Lymphoma, or Histiocytic Disorders With Activating Alterations in Cell Cycle Genes (A Pediatric MATCH Treatment Trial)
NCT03698994	PHASE2	ACTIVE_NOT_RECRUITING	Ulixertinib in Treating Patients With Advanced Solid Tumors, Non-Hodgkin Lymphoma, or Histiocytic Disorders With MAPK Pathway Mutations (A Pediatric MATCH Treatment Trial)
NCT03727841	PHASE2	TERMINATED	Marizomib for Recurrent Low-Grade and Anaplastic Supratentorial, Infratentorial, and Spinal Cord Ependymoma
NCT04049669	PHASE2	ACTIVE_NOT_RECRUITING	Pediatric Trial of Indoximod With Chemotherapy and Radiation for Relapsed Brain Tumors or Newly Diagnosed DIPG
NCT04195555	PHASE2	ACTIVE_NOT_RECRUITING	Ivosidenib in Treating Patients With Advanced Solid Tumors, Lymphoma, or Histiocytic Disorders With IDH1 Mutations (A Pediatric MATCH Treatment Trial)
NCT04284774	PHASE2	ACTIVE_NOT_RECRUITING	Tipifarnib for the Treatment of Advanced Solid Tumors, Lymphoma, or Histiocytic Disorders With HRAS Gene Alterations, a Pediatric MATCH Treatment Trial
NCT04320888	PHASE2	ACTIVE_NOT_RECRUITING	Selpercatinib for the Treatment of Advanced Solid Tumors, Lymphomas, or Histiocytic Disorders With Activating RET Gene Alterations, a Pediatric MATCH Treatment Trial
NCT04374305	PHASE2	RECRUITING	Innovative Trial for Understanding the Impact of Targeted Therapies in NF2-Related Schwannomatosis (INTUITT-NF2)
NCT04743661	PHASE2	ACTIVE_NOT_RECRUITING	131I-Omburtamab, in Recurrent Medulloblastoma and Ependymoma
NCT06804655	PHASE2	NOT_YET_RECRUITING	Pharmacoscopy for Patients With Refractory Primary Brain Tumors
NCT07424092	PHASE2	RECRUITING	Intratumoral DNX-2401 for High Grade Pediatric Brain Tumors
NCT00634231	PHASE1	COMPLETED	A Phase I Study of AdV-tk + Prodrug Therapy in Combination With Radiation Therapy for Pediatric Brain Tumors
NCT00994071	PHASE1	COMPLETED	A Phase I Study of ABT-888, an Oral Inhibitor of Poly(ADP-ribose) Polymerase and Temozolomide in Children With Recurrent/Refractory CNS Tumors
NCT01171469	PHASE1	COMPLETED	Vaccination With Dendritic Cells Loaded With Brain Tumor Stem Cells for Progressive Malignant Brain Tumor
NCT01331135	PHASE1	COMPLETED	Aflac ST0901 CHOANOME - Sirolimus in Solid Tumors
NCT01498783	PHASE1	COMPLETED	Phase I Study of 5-Fluorouracil in Children and Young Adults With Recurrent Ependymoma