KRTAP4-7

Summary

KRTAP4-7 (keratin associated protein 4-7, HGNC:18898) is a protein-coding gene on chromosome 17q21.2, encoding Keratin-associated protein 4-7 (Q9BYR0). In the hair cortex, hair keratin intermediate filaments are embedded in an interfilamentous matrix, consisting of hair keratin-associated proteins (KRTAP), which are essential for the formation of a rigid and resistant hair shaft through their extensive disulfide bond cross-link…. It is a selective cancer dependency (DepMap: 80.0% of cell lines).

This protein is a member of the keratin-associated protein (KAP) family. The KAP proteins form a matrix of keratin intermediate filaments which contribute to the structure of hair fibers. KAP family members appear to have unique, family-specific amino- and carboxyl-terminal regions and are subdivided into three multi-gene families according to amino acid composition: the high sulfur, the ultrahigh sulfur, and the high tyrosine/glycine KAPs. This protein is a member of the ultrahigh sulfur KAP family and the gene is localized to a cluster of KAPs at 17q12-q21.

Source: NCBI Gene 100132476 — RefSeq curated summary.

At a glance

• Clinical variants (ClinVar): 55 total
• Cancer dependency (DepMap): dependent in 80.0% of screened cell lines
• MANE Select transcript: NM_033061

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:18898
Approved symbol	KRTAP4-7
Name	keratin associated protein 4-7
Location	17q21.2
Locus type	gene with protein product
Status	Approved
Aliases	KAP4.7
Ensembl gene	ENSG00000240871
Ensembl biotype	protein_coding
Entrez	100132476

Gene structure

Transcript identifiers

Ensembl transcripts: 1 — 1 protein_coding

ENST00000391417

RefSeq mRNA: 1 — MANE Select: NM_033061 NM_033061

CCDS: CCDS45673

Canonical transcript exons

ENST00000391417 — 1 exons

Exon	Start	End
ENSE00003978238	41084150	41085144

Expression profiles

Bgee: expression breadth broad, 29 present calls, max score 43.33.

Top tissues by expression

106 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
skin of abdomen	UBERON:0001416	43.33	gold quality
zone of skin	UBERON:0000014	41.18	gold quality
skin of leg	UBERON:0001511	39.96	gold quality
granulocyte	CL:0000094	37.57	gold quality
colonic epithelium	UBERON:0000397	37.20	gold quality
ventricular zone	UBERON:0003053	36.48	gold quality
cortical plate	UBERON:0005343	36.47	gold quality
bone marrow cell	CL:0002092	36.16	gold quality
sural nerve	UBERON:0015488	36.16	gold quality
ganglionic eminence	UBERON:0004023	35.49	gold quality
right lung	UBERON:0002167	34.70	gold quality
skeletal muscle tissue	UBERON:0001134	33.38	gold quality
hindlimb stylopod muscle	UBERON:0004252	32.15	gold quality
bone marrow	UBERON:0002371	31.74	gold quality
muscle tissue	UBERON:0002385	31.06	gold quality
liver	UBERON:0002107	30.42	gold quality
stromal cell of endometrium	CL:0002255	29.87	gold quality
blood	UBERON:0000178	29.35	gold quality
prefrontal cortex	UBERON:0000451	29.04	gold quality
muscle of leg	UBERON:0001383	29.00	gold quality
tonsil	UBERON:0002372	28.87	gold quality
gastrocnemius	UBERON:0001388	28.61	gold quality
right lobe of liver	UBERON:0001114	28.50	gold quality
duodenum	UBERON:0002114	28.14	gold quality
leukocyte	CL:0000738	27.97	gold quality
cortex of kidney	UBERON:0001225	27.71	silver quality
lymph node	UBERON:0000029	27.57	gold quality
olfactory segment of nasal mucosa	UBERON:0005386	27.57	gold quality
monocyte	CL:0000576	27.36	gold quality
islet of Langerhans	UBERON:0000006	26.55	gold quality

Single-cell (SCXA)

Detected in 1 experiment(s), a significant marker in 0.

Experiment	Marker?	Max mean expression
E-ANND-3	no	0.16

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

31 targeting KRTAP4-7, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-12118	100.00	65.88	1270
HSA-MIR-3662	99.99	73.82	5684
HSA-MIR-3173-3P	99.98	66.49	1217
HSA-MIR-6891-5P	99.98	66.53	1372
HSA-MIR-651-3P	99.94	73.48	5177
HSA-MIR-4697-3P	99.89	67.09	1123
HSA-MIR-4779	99.86	66.50	1583
HSA-MIR-6079	99.84	68.54	1170
HSA-MIR-6505-5P	99.73	69.25	1595
HSA-MIR-519A-3P	99.67	71.67	1868
HSA-MIR-519B-3P	99.67	71.67	1868
HSA-MIR-519C-3P	99.67	71.67	1870
HSA-MIR-561-3P	99.64	70.90	3647
HSA-MIR-7156-5P	99.64	68.81	1369
HSA-MIR-4756-3P	99.62	66.30	1319
HSA-MIR-4276	99.56	67.66	2514
HSA-MIR-3609	99.52	69.89	2587
HSA-MIR-548AH-5P	99.52	69.73	2626
HSA-MIR-4273	99.45	67.93	1206
HSA-MIR-330-3P	99.41	69.95	2521
HSA-MIR-6828-5P	99.31	69.21	1433
HSA-MIR-5190	99.15	67.76	1234
HSA-MIR-6770-5P	98.97	66.76	1853
HSA-MIR-936	98.87	70.51	1124
HSA-MIR-3179	98.22	65.90	1445
HSA-MIR-3652	97.71	65.43	1890
HSA-MIR-4430	97.47	65.61	1813
HSA-MIR-4640-5P	97.42	66.33	1543
HSA-MIR-4286	97.20	64.37	1587
HSA-MIR-541-3P	96.07	66.11	1271

Functional genomics

DepMap (CRISPR cell-line fitness): dependent in 80.0% of screened cell lines.

Cross-species orthologs

5 orthologs

Organism	Symbol	Gene ID
mus_musculus	Krtap4-7	ENSMUSG00000045109
mus_musculus	Krtap4-24	ENSMUSG00000078130
rattus_norvegicus	Krtap9-7	ENSRNOG00000026803
rattus_norvegicus		ENSRNOG00000077385
rattus_norvegicus		ENSRNOG00000080465

Paralogs (47): KRTAP4-4 (ENSG00000171396), KRTAP9-7 (ENSG00000180386), KRTAP5-5 (ENSG00000185940), KRTAP12-1 (ENSG00000187175), KRTAP9-8 (ENSG00000187272), KRTAP10-8 (ENSG00000187766), KRTAP10-6 (ENSG00000188155), KRTAP1-1 (ENSG00000188581), KRTAP10-12 (ENSG00000189169), KRTAP4-3 (ENSG00000196156), KRTAP9-9 (ENSG00000198083), KRTAP4-6 (ENSG00000198090), KRTAP4-5 (ENSG00000198271), KRTAP4-1 (ENSG00000198443), KRTAP9-3 (ENSG00000204873), KRTAP4-8 (ENSG00000204880), KRTAP1-4 (ENSG00000204887), KRTAP12-3 (ENSG00000205439), KRTAP10-2 (ENSG00000205445), KRTAP5-6 (ENSG00000205864), KRTAP5-2 (ENSG00000205867), KRTAP16-1 (ENSG00000212657), KRTAP9-6 (ENSG00000212659), KRTAP4-11 (ENSG00000212721), KRTAP4-9 (ENSG00000212722), KRTAP2-3 (ENSG00000212724), KRTAP2-1 (ENSG00000212725), KRTAP10-3 (ENSG00000212935), KRTAP4-12 (ENSG00000213416), KRTAP2-4 (ENSG00000213417), KRTAP2-2 (ENSG00000214518), KRTAP10-4 (ENSG00000215454), KRTAP10-1 (ENSG00000215455), KRTAP10-9 (ENSG00000221837), KRTAP1-5 (ENSG00000221852), KRTAP10-10 (ENSG00000221859), KRTAP12-2 (ENSG00000221864), KRTAP1-3 (ENSG00000221880), KRTAP9-2 (ENSG00000239886), KRTAP9-1 (ENSG00000240542)

Protein

Protein identifiers

Keratin-associated protein 4-7 — Q9BYR0 (reviewed: Q9BYR0)

Alternative names: Keratin-associated protein 4.7, Ultrahigh sulfur keratin-associated protein 4.7

All UniProt accessions (1): Q9BYR0

UniProt curated annotations — full annotation on UniProt →

Function. In the hair cortex, hair keratin intermediate filaments are embedded in an interfilamentous matrix, consisting of hair keratin-associated proteins (KRTAP), which are essential for the formation of a rigid and resistant hair shaft through their extensive disulfide bond cross-linking with abundant cysteine residues of hair keratins. The matrix proteins include the high-sulfur and high-glycine-tyrosine keratins.

Subunit / interactions. Interacts with hair keratins.

Tissue specificity. Expressed in the hair follicles.

Polymorphism. Numerous size variants are present in KRTAP4 gene family, mainly within cysteine-rich repeat segments. The sequence shown in this entry corresponds to variant KAP4.7-v1.

Similarity. Belongs to the KRTAP type 4 family.

RefSeq proteins (1): NP_149050* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR002494	KAP	Family

Pfam: PF13885

UniProt features (28 total): repeat 20, sequence variant 6, chain 1, region of interest 1

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q9BYR0-F1	36.91	0.00

Function

Pathways and Gene Ontology

Reactome pathways

2 pathways

ID	Pathway
R-HSA-6805567	Keratinization
R-HSA-1266738	Developmental Biology

MSigDB gene sets: 36 (showing top): GSE13762_CTRL_VS_125_VITAMIND_DAY5_DC_DN, HUTTMANN_B_CLL_POOR_SURVIVAL_UP, BCAT.100_UP.V1_DN, CAMP_UP.V1_UP, REACTOME_KERATINIZATION, GSE13522_WT_VS_IFNG_KO_SKIN_UP, GSE13547_WT_VS_ZFX_KO_BCELL_ANTI_IGM_STIM_12H_UP, MIR651_3P, MIR561_3P, MIR3609, MIR548AH_5P, MIR4276, MIR6505_5P, MIR6828_5P, MIR6079

GO Biological Process (1): hair cycle (GO:0042633)

GO Molecular Function (1): protein binding (GO:0005515)

GO Cellular Component (3): cytosol (GO:0005829), keratin filament (GO:0045095), intermediate filament (GO:0005882)

Reactome top-level categories

Rollup of top-1 pathways:

Category	Pathways
Developmental Biology	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
molting cycle	1
binding	1
cytoplasm	1
cellular anatomical structure	1
intermediate filament	1
intermediate filament cytoskeleton	1
polymeric cytoskeletal fiber	1

Protein interactions and networks

STRING

0 interactions, top by confidence (×1000):

IntAct

43 interactions, top by confidence:

A	B	Type	Score
KRTAP4-7	MEOX2	psi-mi:“MI:0915”(physical association)	0.560
	KRTAP4-7	psi-mi:“MI:0915”(physical association)	0.560
KRTAP4-7		psi-mi:“MI:0915”(physical association)	0.560
KRTAP4-7	SPRY2	psi-mi:“MI:0915”(physical association)	0.560
GLRX3	KRTAP4-7	psi-mi:“MI:0915”(physical association)	0.560
KRTAP4-7	OTX1	psi-mi:“MI:0915”(physical association)	0.560
HOXA1	KRTAP4-7	psi-mi:“MI:0915”(physical association)	0.560
SMCP	KRTAP4-7	psi-mi:“MI:0915”(physical association)	0.560
KRTAP4-7	KRTAP10-8	psi-mi:“MI:0915”(physical association)	0.560
FAM76B	KRTAP4-7	psi-mi:“MI:0915”(physical association)	0.560
KRTAP4-7	KRTAP26-1	psi-mi:“MI:0915”(physical association)	0.560
NOTCH2NLA	KRTAP4-7	psi-mi:“MI:0915”(physical association)	0.560
CATSPER1	KRTAP4-7	psi-mi:“MI:0915”(physical association)	0.560
KRTAP4-7	KRTAP9-2	psi-mi:“MI:0915”(physical association)	0.560
MEOX2	KRTAP4-7	psi-mi:“MI:0915”(physical association)	0.560
KRTAP4-7	FAM76B	psi-mi:“MI:0915”(physical association)	0.560
KRTAP26-1	KRTAP4-7	psi-mi:“MI:0915”(physical association)	0.560
KRTAP9-2	KRTAP4-7	psi-mi:“MI:0915”(physical association)	0.560
KRTAP10-8	KRTAP4-7	psi-mi:“MI:0915”(physical association)	0.560
KRTAP4-7	NOTCH2NLA	psi-mi:“MI:0915”(physical association)	0.560

ESM2 similar proteins: A0A286YEV6, A0A286YEX9, A0A286YEY9, A0A286YF01, A0A286YF46, A0A286YF60, A0A286YF77, A0A286YFB4, A0A286YFG1, O14633, P02438, P04459, P05687, P05688, P08131, P08175, P0DSO2, P20730, Q01642, Q01643, Q01644, Q01645, Q07627, Q3LI58, Q3LI59, Q3V2C1, Q5T750, Q5T752, Q5T754, Q5TA78, Q5TA79, Q5TA81, Q5TA82, Q5TCM9, Q8IUC1, Q8IUG1, Q9BQ66, Q9BYP8, Q9BYQ5, Q9BYQ6

SIGNOR signaling

0 interactions.

Disease & clinical

Clinical variants and AI predictions

ClinVar

55 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	51
Likely benign	4
Benign	0

Top pathogenic / likely-pathogenic (0)

SpliceAI

318 predictions. Top by Δscore:

Variant	Effect	Δscore
17:41084314:G:GT	donor_gain	0.9100
17:41084419:G:GT	donor_gain	0.8100
17:41084374:G:GG	donor_gain	0.8000
17:41084373:A:AG	donor_gain	0.7900
17:41084212:C:A	donor_gain	0.7100
17:41084343:T:A	donor_gain	0.6800
17:41084338:T:G	donor_gain	0.6700
17:41084472:GCT:G	donor_gain	0.6700
17:41084830:G:GG	donor_gain	0.6700
17:41084436:C:G	donor_gain	0.6400
17:41084509:G:GG	donor_gain	0.6400
17:41084415:G:GG	donor_gain	0.6200
17:41084508:A:AG	donor_gain	0.6200
17:41084886:G:GA	donor_gain	0.6200
17:41084436:C:CG	donor_gain	0.6100
17:41084848:A:G	donor_gain	0.6100
17:41084914:A:AG	donor_gain	0.6100
17:41084412:GCT:G	donor_gain	0.6000
17:41084470:C:G	donor_gain	0.6000
17:41084846:T:A	donor_gain	0.6000
17:41084923:C:G	donor_gain	0.6000
17:41084270:G:GT	donor_gain	0.5900
17:41084882:T:TA	acceptor_gain	0.5900
17:41084455:C:G	donor_gain	0.5800
17:41084827:TCT:T	donor_gain	0.5700
17:41084842:T:A	donor_gain	0.5700
17:41084334:GCT:G	donor_gain	0.5600
17:41084414:T:TG	donor_gain	0.5600
17:41084485:C:G	donor_gain	0.5600
17:41084826:CTCT:C	donor_gain	0.5600

AlphaMissense

1022 scored. Top likely-pathogenic:

dbSNP variants (sampled 300 via entrez): RS1001642836 (17:41082422 C>T), RS1003678505 (17:41084760 G>A,C,T), RS1004061086 (17:41082839 G>T), RS1005768202 (17:41084610 A>G), RS1007222440 (17:41084450 TCCAGCTGCTGCCGCC>T,TCCAGCTGCTGCCGCCCCAGCTGCTGCCGCC), RS1008243379 (17:41082658 G>A,C,T), RS1008691050 (17:41082770 T>C), RS1008990403 (17:41083858 T>C), RS1010579231 (17:41083300 G>A), RS1010652787 (17:41083826 C>G), RS1018297093 (17:41082771 A>G), RS1020274470 (17:41083396 A>C), RS1020654126 (17:41083315 A>G), RS1020711261 (17:41082467 C>T), RS1022754344 (17:41084793 A>G)

Disease associations

OMIM: gene `` | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

0 associations (top):

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

8 total (human), top 8 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
potassium chromate(VI)	increases expression	1
Acetaminophen	increases expression	1
Formaldehyde	increases expression	1
Hydralazine	affects cotreatment, increases expression	1
Polystyrenes	increases expression	1
Smoke	increases expression	1
Valproic Acid	affects cotreatment, increases expression	1
Aflatoxin B1	decreases methylation	1

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.