LHPP

Summary

LHPP (phospholysine phosphohistidine inorganic pyrophosphate phosphatase, HGNC:30042) is a protein-coding gene on chromosome 10q26.13, encoding Phospholysine phosphohistidine inorganic pyrophosphate phosphatase (Q9H008). Phosphatase that hydrolyzes imidodiphosphate, 3-phosphohistidine and 6-phospholysine.

Enables inorganic diphosphate phosphatase activity and protein homodimerization activity. Involved in phosphate-containing compound metabolic process. Located in cytosol and nuclear speck.

Source: NCBI Gene 64077 — RefSeq curated summary.

At a glance

• GWAS associations: 20
• Clinical variants (ClinVar): 67 total
• Druggable target: yes
• MANE Select transcript: NM_022126

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:30042
Approved symbol	LHPP
Name	phospholysine phosphohistidine inorganic pyrophosphate phosphatase
Location	10q26.13
Locus type	gene with protein product
Status	Approved
Aliases	HDHD2B
Ensembl gene	ENSG00000107902
Ensembl biotype	protein_coding
OMIM	617231
Entrez	64077

Gene structure

Transcript identifiers

Ensembl transcripts: 16 — 10 protein_coding, 6 protein_coding_CDS_not_defined

ENST00000368839, ENST00000368842, ENST00000392757, ENST00000481452, ENST00000482963, ENST00000486535, ENST00000487190, ENST00000492187, ENST00000493240, ENST00000890877, ENST00000890878, ENST00000890879, ENST00000890881, ENST00000890883, ENST00000890885, ENST00000934459

RefSeq mRNA: 4 — MANE Select: NM_022126 NM_001167880, NM_001318331, NM_001318332, NM_022126

CCDS: CCDS53587, CCDS7640, CCDS81519

Canonical transcript exons

ENST00000368842 — 7 exons

Exon	Start	End
ENSE00000903909	124484139	124484326
ENSE00000903910	124488422	124488575
ENSE00000903913	124517180	124517271
ENSE00001448090	124461823	124461987
ENSE00003491478	124498036	124498128
ENSE00003648455	124496961	124497024
ENSE00003667847	124613264	124614141

Expression profiles

Bgee: expression breadth ubiquitous, 214 present calls, max score 99.60.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 23.3640 / max 955.3689, expressed in 1798 samples.

FANTOM5 promoters (11 alternative TSS)

Promoter ID	TPM avg	Samples expressed
107524	16.5259	1797
107530	3.1553	96
107529	1.6798	100
107532	0.8828	99
107531	0.6274	78
107527	0.2001	34
107533	0.1134	54
107526	0.0505	23
107525	0.0499	20
107534	0.0439	20

Top tissues by expression

274 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
C1 segment of cervical spinal cord	UBERON:0006469	99.60	gold quality
olfactory bulb	UBERON:0002264	99.40	gold quality
spinal cord	UBERON:0002240	99.05	gold quality
tibial nerve	UBERON:0001323	98.04	gold quality
inferior olivary complex	UBERON:0002127	97.56	gold quality
dorsal motor nucleus of vagus nerve	UBERON:0002870	97.14	gold quality
hypothalamus	UBERON:0001898	96.90	gold quality
amygdala	UBERON:0001876	96.79	gold quality
anterior cingulate cortex	UBERON:0009835	96.49	gold quality
cingulate cortex	UBERON:0003027	96.48	gold quality
substantia nigra	UBERON:0002038	96.45	gold quality
putamen	UBERON:0001874	96.38	gold quality
right frontal lobe	UBERON:0002810	96.21	gold quality
caudate nucleus	UBERON:0001873	96.20	gold quality
midbrain	UBERON:0001891	95.87	gold quality
nucleus accumbens	UBERON:0001882	95.83	gold quality
inferior vagus X ganglion	UBERON:0005363	95.51	gold quality
prefrontal cortex	UBERON:0000451	95.45	gold quality
Brodmann (1909) area 9	UBERON:0013540	95.44	gold quality
Ammon’s horn	UBERON:0001954	94.81	gold quality
cranial nerve II	UBERON:0000941	94.56	gold quality
subthalamic nucleus	UBERON:0001906	93.78	gold quality
frontal cortex	UBERON:0001870	93.36	gold quality
dorsolateral prefrontal cortex	UBERON:0009834	93.36	gold quality
telencephalon	UBERON:0001893	93.29	gold quality
right lobe of liver	UBERON:0001114	93.27	gold quality
neocortex	UBERON:0001950	93.06	gold quality
forebrain	UBERON:0001890	92.66	gold quality
sural nerve	UBERON:0015488	92.64	gold quality
right hemisphere of cerebellum	UBERON:0014890	92.59	gold quality

Single-cell (SCXA)

Detected in 3 experiment(s), a significant marker in 3.

Experiment	Marker?	Max mean expression
E-GEOD-84465	yes	9.60
E-ANND-3	yes	7.43
E-CURD-122	yes	5.66

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

81 targeting LHPP, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-4283	100.00	66.42	2097
HSA-MIR-6825-5P	99.96	69.81	3431
HSA-MIR-6721-5P	99.93	68.92	2981
HSA-MIR-6780A-5P	99.88	66.69	2776
HSA-MIR-4728-5P	99.85	69.39	4718
HSA-MIR-765	99.84	68.24	2442
HSA-MIR-4420	99.82	70.08	1624
HSA-MIR-6785-5P	99.82	68.68	4428
HSA-MIR-6756-5P	99.82	67.97	2466
HSA-MIR-181B-2-3P	99.81	70.06	1646
HSA-MIR-181B-3P	99.81	70.06	1646
HSA-MIR-1273H-5P	99.77	66.32	2471
HSA-MIR-11181-3P	99.75	66.38	2205
HSA-MIR-92A-2-5P	99.75	67.01	2164
HSA-MIR-6745	99.74	65.33	1321
HSA-MIR-30B-3P	99.70	65.76	2325
HSA-MIR-3689A-3P	99.70	65.73	2306
HSA-MIR-3689B-3P	99.70	65.71	2311
HSA-MIR-3689C	99.70	65.71	2311
HSA-MIR-6779-5P	99.70	65.76	2363
HSA-MIR-518A-5P	99.70	69.01	2209
HSA-MIR-527	99.70	69.01	2209
HSA-MIR-4530	99.69	66.47	1509
HSA-MIR-6766-5P	99.68	67.70	2325
HSA-MIR-1827	99.63	68.57	3265
HSA-MIR-6132	99.60	65.83	1554
HSA-MIR-6836-5P	99.60	65.62	1538
HSA-MIR-7106-5P	99.53	67.47	3574
HSA-MIR-486-3P	99.51	66.82	1901
HSA-MIR-1207-5P	99.49	69.11	2983

Literature-anchored findings (GeneRIF, showing 24)

• Lhpp or a product of a collinear brain-specific transcript, therefore, may interact with Htr1a in the pathogenesis of major depression (PMID:18268499)
• LHPP is associated with the interplay of risky sexual behaviors and alcohol dependence. (PMID:27531626)
• LHPP gene variation is associated with oral cavity and pharyngeal cancer. (PMID:27749845)
• Patients with major depressive disorder with LHPP rs35936514 CT/TT genotype have increased activity in certain brain regions. (PMID:27843651)
• in patients with hepatocellular carcinoma, low expression of LHPP correlated with increased tumour severity and reduced overall survival; thus LHPP is a protein histidine phosphatase and tumour suppressor, suggesting that deregulated histidine phosphorylation is oncogenic (PMID:29562234)
• LHPP suppresses cell proliferation and metastasis in cervical cancer, and promotes apoptosis by suppressing AKT activation. (PMID:29944886)
• Association of LHPP genetic variation (rs35936514) with structural and functional connectivity of hippocampal-corticolimbic neural circuitry. (PMID:31250265)
• LHPP suppresses bladder cancer cell proliferation and growth via inactivating AKT/p65 signaling pathway. (PMID:31262971)
• Clinical value of LHPP-associated microRNAs combined with protein induced by vitamin K deficiency or antagonist-II in the diagnosis of alpha-fetoprotein-negative hepatocellular carcinoma. (PMID:31693242)
• Tumor suppressor LHPP regulates the proliferation of colorectal cancer cells via the PI3K/AKT pathway. (PMID:31894339)
• LHPP suppresses proliferation, migration, and invasion and promotes apoptosis in pancreatic cancer. (PMID:32186702)
• LHPP inhibits cell growth and migration and triggers autophagy in papillary thyroid cancer by regulating the AKT/AMPK/mTOR signaling pathway. (PMID:32227107)
• LHPP inhibits hepatocellular carcinoma cell growth and metastasis. (PMID:32578511)
• Purpurin binding interacts with LHPP protein that inhibits PI3K/AKT phosphorylation and induces apoptosis in colon cancer cells HCT-116. (PMID:33368780)
• LHPP exerts a tumor-inhibiting role in glioblastoma via the downregulation of Akt and Wnt/beta-catenin signaling. (PMID:33394310)
• LHPP suppresses tumorigenesis of intrahepatic cholangiocarcinoma by inhibiting the TGFbeta/smad signaling pathway. (PMID:33401010)
• LHPP Inhibits the Proliferation and Metastasis of Renal Cell Carcinoma. (PMID:33426063)
• Prognostic Correlation of Glycolysis-Related Gene Signature in Patients with Laryngeal Cancer. (PMID:34099278)
• Three LHPP gene-targeting co-expressed microRNAs (microRNA-765, microRNA-21, and microRNA-144) promote proliferation, epithelial-mesenchymal transition, invasion, and are independent prognostic biomarkers in renal cell carcinomas patients. (PMID:34699621)
• As a Novel Tumor Suppressor, LHPP Promotes Apoptosis by Inhibiting the PI3K/AKT Signaling Pathway in Oral Squamous Cell Carcinoma. (PMID:35002505)
• Tumor suppressor LHPP suppresses cell proliferation and epithelial-mesenchymal transition in hepatocellular carcinoma cell lines. (PMID:35796893)
• Identification of Tumor Suppressor Gene LHPP-Based 5-microRNA Signature That Predicts the Early- and Midstage Esophageal Squamous Cell Carcinoma: A Two-Stage Case-Control Study in the Chinese Han Population. (PMID:36355716)
• LHPP promotes the intracellular reactive oxygen species accumulation and sensitivity of gastric cancer to cisplatin via JNK and p38 MAPK pathways. (PMID:36546683)
• LHPP Inhibits the Viability, Migration, and Proliferation of PDAC Cells and Significantly Affects the Expression of SDC1 and S100p. (PMID:37321804)

Cross-species orthologs

7 orthologs

Organism	Symbol	Gene ID
danio_rerio	lhpp	ENSDARG00000060196
mus_musculus	Lhpp	ENSMUSG00000030946
rattus_norvegicus	Lhpp	ENSRNOG00000017097
drosophila_melanogaster	CG2680	FBGN0024995
drosophila_melanogaster	CG15739	FBGN0030347
drosophila_melanogaster	CG10352	FBGN0030348
caenorhabditis_elegans		WBGENE00007548

Paralogs (3): HDHD2 (ENSG00000167220), PGP (ENSG00000184207), PDXP (ENSG00000241360)

Protein

Protein identifiers

Phospholysine phosphohistidine inorganic pyrophosphate phosphatase — Q9H008 (reviewed: Q9H008)

All UniProt accessions (2): Q9H008, Q5T1Z0

UniProt curated annotations — full annotation on UniProt →

Function. Phosphatase that hydrolyzes imidodiphosphate, 3-phosphohistidine and 6-phospholysine. Has broad substrate specificity and can also hydrolyze inorganic diphosphate, but with lower efficiency.

Subunit / interactions. Homodimer.

Subcellular location. Cytoplasm. Nucleus.

Tissue specificity. Expressed in brain, and at lower levels in liver and kidney. Detected in thyroid (at protein level). Expressed in liver, kidney and moderately in brain.

Cofactor. Binds 1 Mg(2+) ion per subunit.

Similarity. Belongs to the HAD-like hydrolase superfamily.

Isoforms (2)

UniProt ID	Names	Canonical?
Q9H008-1	1	yes
Q9H008-2	2

RefSeq proteins (4): NP_001161352, NP_001305260, NP_001305261, NP_071409* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR006355	LHPP/HDHD2	Family
IPR006357	HAD-SF_hydro_IIA	Family
IPR023214	HAD_sf	Homologous_superfamily
IPR036412	HAD-like_sf	Homologous_superfamily

Pfam: PF13242, PF13344

Enzyme classification (BRENDA):

• EC 3.9.1.3 — phosphohistidine phosphatase (BRENDA: 10 organisms, 42 substrates, 23 inhibitors, 2 Km, 2 kcat entries)

Substrate kinetics (BRENDA)

2 substrates with measured Km, best-characterized 2. Km ranges are aggregated across organisms/conditions.

Substrate	Km (mM)	Measurements
4-NITROPHENYLPHOSPHATE	7.4	1
6,8-DIFLUOROMETHYLUMBELLIFERYL PHOSPHATE	0.22	1

Catalyzed reactions (Rhea), 1 shown:

• diphosphate + H2O = 2 phosphate + H(+) (RHEA:24576)

UniProt features (42 total): helix 14, strand 12, binding site 6, turn 4, sequence conflict 2, splice variant 2, chain 1, sequence variant 1

Structure

Experimental structures (PDB)

1 structures.

PDB	Method	Resolution (Å)
2X4D	X-RAY DIFFRACTION	1.92

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q9H008-F1	97.21	0.97

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Ligand- & substrate-binding residues (6): 17–19; 17; 19; 54–55; 189; 214

Function

Pathways and Gene Ontology

Reactome pathways

2 pathways

ID	Pathway
R-HSA-71737	Pyrophosphate hydrolysis
R-HSA-1430728	Metabolism

MSigDB gene sets: 139 (showing top): GRAESSMANN_APOPTOSIS_BY_SERUM_DEPRIVATION_DN, GRAESSMANN_RESPONSE_TO_MC_AND_SERUM_DEPRIVATION_DN, CHANDRAN_METASTASIS_DN, ROZANOV_MMP14_TARGETS_UP, HNF4_DR1_Q3, SCHAEFFER_PROSTATE_DEVELOPMENT_48HR_DN, BENPORATH_NOS_TARGETS, HAMAI_APOPTOSIS_VIA_TRAIL_DN, PARENT_MTOR_SIGNALING_UP, GOCC_NUCLEAR_SPECK, BENPORATH_OCT4_TARGETS, GOCC_NUCLEAR_BODY, GOCC_RIBONUCLEOPROTEIN_GRANULE, MODULE_69, SANSOM_APC_MYC_TARGETS

GO Biological Process (2): phosphate-containing compound metabolic process (GO:0006796), dephosphorylation (GO:0016311)

GO Molecular Function (6): inorganic diphosphate phosphatase activity (GO:0004427), phosphatase activity (GO:0016791), protein homodimerization activity (GO:0042803), metal ion binding (GO:0046872), protein binding (GO:0005515), hydrolase activity (GO:0016787)

GO Cellular Component (4): nucleus (GO:0005634), cytoplasm (GO:0005737), cytosol (GO:0005829), nuclear speck (GO:0016607)

Reactome top-level categories

Rollup of top-1 pathways:

Category	Pathways
Metabolism	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
cellular anatomical structure	2
metabolic process	1
phosphate-containing compound metabolic process	1
pyrophosphatase activity	1
phosphoric ester hydrolase activity	1
identical protein binding	1
protein dimerization activity	1
cation binding	1
binding	1
catalytic activity	1
intracellular membrane-bounded organelle	1
intracellular anatomical structure	1
cytoplasm	1
nuclear ribonucleoprotein granule	1

Protein interactions and networks

STRING

1212 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
LHPP	PHPT1	Q9NRX4	693
LHPP	TMEM161B	Q8NDZ6	651
LHPP	NME2	P22392	633
LHPP	PIP4K2A	P48426	576
LHPP	NDUFB3	O43676	516
LHPP	TEX51	A0A1B0GUA7	507
LHPP	PGAM5	Q96HS1	506
LHPP	NDUFB10	O96000	505
LHPP	NDUFV1	P49821	503
LHPP	NDUFS8	O00217	490
LHPP	NDUFA11	Q86Y39	490
LHPP	NDUFB7	P17568	484
LHPP	NDUFA7	O95182	483
LHPP	OR52N2	Q8NGI0	479
LHPP	NDUFS7	O75251	478

IntAct

21 interactions, top by confidence:

A	B	Type	Score
OTUB1	UBE2E1	psi-mi:“MI:0914”(association)	0.660
ZSCAN23	LHPP	psi-mi:“MI:0915”(physical association)	0.560
SLBP	ACAD11	psi-mi:“MI:0914”(association)	0.530
LHPP	LHPP	psi-mi:“MI:0407”(direct interaction)	0.440
HDHD2	LHPP	psi-mi:“MI:0915”(physical association)	0.400
LHPP	HSP90AA4P	psi-mi:“MI:0915”(physical association)	0.400
NOTCH2NLA	IGKC	psi-mi:“MI:0914”(association)	0.350
RPIA	IGKC	psi-mi:“MI:0914”(association)	0.350
SERTAD1	IGKC	psi-mi:“MI:0914”(association)	0.350
MYG1	GALT	psi-mi:“MI:0914”(association)	0.350
LHPP	MYH1	psi-mi:“MI:0914”(association)	0.350
CREG1	HNRNPA1L2	psi-mi:“MI:0914”(association)	0.350
CLIC2	TPRN	psi-mi:“MI:0914”(association)	0.350
OVOL2	TNPO2	psi-mi:“MI:0914”(association)	0.350
SPSB4	BTAF1	psi-mi:“MI:0914”(association)	0.350
HMX2	CALB2	psi-mi:“MI:0914”(association)	0.350
TNFRSF14	LHPP	psi-mi:“MI:0915”(physical association)	0.000

BioGRID (39): LHPP (Affinity Capture-MS), LHPP (Co-fractionation), LHPP (Affinity Capture-RNA), ZSCAN23 (Two-hybrid), LHPP (Affinity Capture-MS), LHPP (Affinity Capture-MS), LHPP (Affinity Capture-MS), LHPP (Affinity Capture-MS), LHPP (Affinity Capture-MS), MYH1 (Affinity Capture-MS), LHPP (Affinity Capture-MS), LHPP (Affinity Capture-MS), MYH7 (Affinity Capture-MS), MYH8 (Affinity Capture-MS), LHPP (Affinity Capture-MS)

ESM2 similar proteins: A4FV98, A4IFH5, A5PK51, A6NDG6, D3YWP0, D3ZDK7, P10950, P24298, P25325, P50336, P60487, Q0VD18, Q12788, Q1JPJ0, Q2KJJ5, Q2T9S4, Q32NY4, Q3UGR5, Q3ZBF9, Q501J2, Q5BJJ5, Q5F4B1, Q5I0D5, Q5R4B4, Q5U2W5, Q5ZIW1, Q60HD5, Q6AYR6, Q6SKR2, Q6XQN6, Q86VU5, Q8BIG7, Q8C4J7, Q8CG76, Q8CHP8, Q8IZ69, Q8NE01, Q8R2H9, Q8TCD5, Q8TCT1

Diamond homologs: A5PLK2, Q0VD18, Q3B8E3, Q3UGR5, Q3ZCH9, Q5BJJ5, Q5I0D5, Q5R4B4, Q6AYR6, Q6ZT62, Q9D7I5, Q9H008, Q9H0R4, Q9V1B3, A0RKU8, A9VQ75, B7HWY7, B7JFI8, B9J4R5, C1EZE2, C3LED0, C3P0C8, O26311, O59346, P0A8Y1, P0A8Y2, P60527, Q58832, Q631J2, Q6HBC8, Q6HQY9, Q72H00, Q8TWR2, Q8U040, Q94915, F8D9F4, Q7VL21, P60487, Q8VD52, P94512

SIGNOR signaling

0 interactions.

Disease & clinical

Clinical variants and AI predictions

ClinVar

67 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	53
Likely benign	2
Benign	2

Top pathogenic / likely-pathogenic (0)

SpliceAI

3061 predictions. Top by Δscore:

Variant	Effect	Δscore
10:124461985:CAGGT:C	donor_loss	1.0000
10:124461988:G:A	donor_loss	1.0000
10:124461988:G:GG	donor_gain	1.0000
10:124461989:T:G	donor_loss	1.0000
10:124485352:G:T	donor_gain	1.0000
10:124488421:GGA:G	acceptor_gain	1.0000
10:124488574:GG:G	donor_gain	1.0000
10:124488575:GG:G	donor_gain	1.0000
10:124497016:GCGCT:G	donor_gain	1.0000
10:124498032:CCAGT:C	acceptor_loss	1.0000
10:124498034:A:AG	acceptor_gain	1.0000
10:124498034:AGTAT:A	acceptor_gain	1.0000
10:124498035:G:GA	acceptor_gain	1.0000
10:124498035:GT:G	acceptor_gain	1.0000
10:124498035:GTA:G	acceptor_gain	1.0000
10:124498035:GTAT:G	acceptor_gain	1.0000
10:124498035:GTATG:G	acceptor_gain	1.0000
10:124498037:AT:A	acceptor_gain	1.0000
10:124498127:AGG:A	donor_loss	1.0000
10:124498129:G:GG	donor_gain	1.0000
10:124498129:GTAG:G	donor_loss	1.0000
10:124613262:A:AG	acceptor_gain	1.0000
10:124613262:A:AT	acceptor_loss	1.0000
10:124613262:AG:A	acceptor_gain	1.0000
10:124613263:G:GT	acceptor_gain	1.0000
10:124613263:GG:G	acceptor_gain	1.0000
10:124613263:GGC:G	acceptor_gain	1.0000
10:124613263:GGCC:G	acceptor_gain	1.0000
10:124613263:GGCCC:G	acceptor_gain	1.0000
10:124461983:GCCAG:G	donor_gain	0.9900

AlphaMissense

1740 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
10:124517196:A:T	D214V	0.999
10:124517196:A:C	D214A	0.998
10:124517197:C:A	D214E	0.998
10:124517197:C:G	D214E	0.998
10:124517195:G:C	D214H	0.997
10:124517196:A:G	D214G	0.996
10:124517211:A:C	D219A	0.996
10:124517267:T:C	F238L	0.996
10:124517269:C:A	F238L	0.996
10:124517269:C:G	F238L	0.996
10:124461912:A:T	D17V	0.995
10:124517193:G:A	G213E	0.995
10:124517211:A:G	D219G	0.995
10:124484178:C:A	N55K	0.994
10:124484178:C:G	N55K	0.994
10:124517210:G:C	D219H	0.994
10:124517211:A:T	D219V	0.994
10:124517212:C:A	D219E	0.994
10:124517212:C:G	D219E	0.994
10:124461912:A:C	D17A	0.993
10:124461913:C:A	D17E	0.993
10:124461913:C:G	D17E	0.993
10:124498067:G:A	G188E	0.992
10:124498069:A:C	K189Q	0.992
10:124498070:A:C	K189T	0.992
10:124517193:G:T	G213V	0.992
10:124517199:A:T	D215V	0.992
10:124498071:G:C	K189N	0.991
10:124498071:G:T	K189N	0.991
10:124517192:G:T	G213W	0.991

dbSNP variants (sampled 300 via entrez): RS1000003941 (10:124485763 C>A), RS1000048841 (10:124600086 G>A,C), RS1000091739 (10:124467453 G>A), RS1000099000 (10:124501017 A>G), RS1000106931 (10:124552958 A>G), RS1000108611 (10:124536986 AT>A), RS1000119865 (10:124537224 C>T), RS1000119957 (10:124511117 AATTTTTACCATATCTGGGT>A), RS1000130639 (10:124589765 A>G), RS1000166788 (10:124499675 C>G), RS1000168474 (10:124526597 C>T), RS1000174662 (10:124522730 C>A,G,T), RS1000216095 (10:124593498 C>T), RS1000226682 (10:124480769 G>A), RS1000230281 (10:124582556 A>G)

Disease associations

OMIM: gene MIM:617231 | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

20 associations (top):

Study	Trait	p-value
GCST001378_4	Hemostatic factors and hematological phenotypes	9.000000e-06
GCST001521_34	Subcutaneous adipose tissue	7.000000e-06
GCST001762_912	Obesity-related traits	5.000000e-06
GCST001996_4	Adverse response to chemotherapy (neutropenia/leucopenia) (epirubicin)	7.000000e-06
GCST003798_2	Acute lymphoblastic leukemia in childhood (B cell precursor)	1.000000e-11
GCST003831_39	Asthma	8.000000e-06
GCST003860_1	Risky sexual behaviors (alcohol dependence interaction)	3.000000e-08
GCST004068_33	Venous thromboembolism adjusted for sickle cell variant rs77121243-T	5.000000e-06
GCST004573_10	Iron status biomarkers (ferritin levels)	9.000000e-07
GCST004713_6	Testicular germ cell tumor	2.000000e-08
GCST005315_9	Acute lymphoblastic leukemia (childhood)	6.000000e-06
GCST005832_9	Acute lymphoblastic leukemia in childhood (B cell precursor)	9.000000e-11
GCST006661_312	Male-pattern baldness	6.000000e-21
GCST006870_6	Hippocampal tail volume	3.000000e-14
GCST007647_5	Estimated glomerular filtration rate change in renal transplantation (recipient effect)	4.000000e-06
GCST008839_588	Height	7.000000e-12
GCST009638_7	B-cell acute lymphoblastic leukaemia	6.000000e-13
GCST010703_92	Brain morphology (MOSTest)	4.000000e-63
GCST012020_201	Serum metabolite levels	9.000000e-11
GCST90011768_7	Glaucoma (primary open-angle)	2.000000e-10

EFO canonical traits (6, from GWAS)

EFO ID	Trait name
EFO:0004503	hematological measurement
EFO:0004637	protein S measurement
EFO:0006946	behavioural disinhibition measurement
EFO:0004459	ferritin measurement
EFO:0005199	renal transplant outcome measurement
EFO:0004346	neuroimaging measurement

Drugs & pharmacology

Drug and pharmacology data

Is drug target: yes

ChEMBL targets (1): CHEMBL5169196 (SINGLE PROTEIN)

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

43 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Benzo(a)pyrene	affects methylation, decreases expression, increases methylation	6
Aflatoxin B1	affects expression, affects methylation, decreases expression	5
bisphenol A	affects cotreatment, increases methylation, increases expression	2
sodium arsenite	affects acetylation, affects methylation, affects cotreatment, decreases expression, increases expression	2
Cadmium	decreases expression, increases abundance, increases expression	2
Cadmium Chloride	decreases expression, increases abundance, increases expression	2
aristolochic acid I	decreases expression	1
methyleugenol	decreases expression	1
triphenyl phosphate	affects expression	1
mono-(2-ethylhexyl)phthalate	decreases expression	1
butyraldehyde	decreases expression	1
benzo(e)pyrene	increases methylation	1
aflatoxin B2	affects methylation	1
perfluorooctane sulfonic acid	increases expression	1
monomethylarsonous acid	affects methylation, affects acetylation	1
ICG 001	increases expression	1
purpurin anthraquinone	increases expression	1
bisphenol S	decreases methylation	1
jinfukang	increases expression	1
4-(4-((5-(4,5-dimethyl-2-nitrophenyl)-2-furanyl)methylene)-4,5-dihydro-3-methyl-5-oxo-1H-pyrazol-1-yl)benzoic acid	increases expression	1
Sunitinib	increases expression	1
Fulvestrant	affects cotreatment, increases methylation	1
Cisplatin	decreases expression	1
Dexamethasone	increases expression, affects cotreatment	1
Diethylstilbestrol	decreases expression	1
Doxorubicin	decreases expression	1
Hydrogen Peroxide	affects expression	1
Indomethacin	affects cotreatment, increases expression	1
Ivermectin	decreases expression	1
Lead	affects splicing	1

ChEMBL screening assays

1 unique, capped per target: 1 binding

Representative assays (with source publication via chembl_document):

Assay ID	Type	Description	Source paper
CHEMBL5125527	Binding	Inhibition of LHPP (unknown origin) using pyrophosphate as substrate incubated for 30 mins followed by substrate addition and measured after 30 mins by fluorogenic assay	Inhibitor Screen Identifies Covalent Inhibitors of the Protein Histidine Phosphatase PHPT1. — ACS Med Chem Lett

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.