LILRB1

Summary

LILRB1 (leukocyte immunoglobulin like receptor B1, HGNC:6605) is a protein-coding gene on chromosome 19q13.42, encoding Leukocyte immunoglobulin-like receptor subfamily B member 1 (Q8NHL6). Receptor for class I MHC antigens.

This gene is a member of the leukocyte immunoglobulin-like receptor (LIR) family, which is found in a gene cluster at chromosomal region 19q13.4. The encoded protein belongs to the subfamily B class of LIR receptors which contain two or four extracellular immunoglobulin domains, a transmembrane domain, and two to four cytoplasmic immunoreceptor tyrosine-based inhibitory motifs (ITIMs). The receptor is expressed on immune cells where it binds to MHC class I molecules on antigen-presenting cells and transduces a negative signal that inhibits stimulation of an immune response. It is thought to control inflammatory responses and cytotoxicity to help focus the immune response and limit autoreactivity. Multiple transcript variants encoding different isoforms have been found for this gene.

Source: NCBI Gene 10859 — RefSeq curated summary.

At a glance

• GWAS associations: 2
• Clinical variants (ClinVar): 194 total
• MANE Select transcript: NM_001081637

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:6605
Approved symbol	LILRB1
Name	leukocyte immunoglobulin like receptor B1
Location	19q13.42
Locus type	gene with protein product
Status	Approved
Aliases	LIR-1, ILT2, MIR-7, CD85, LIR1, CD85j, PIRB, PIR-B
Ensembl gene	ENSG00000104972
Ensembl biotype	protein_coding
OMIM	604811
Entrez	10859

Gene structure

Transcript identifiers

Ensembl transcripts: 34 — 28 protein_coding, 3 protein_coding_CDS_not_defined, 2 retained_intron, 1 nonsense_mediated_decay

ENST00000324602, ENST00000396315, ENST00000396317, ENST00000396327, ENST00000396331, ENST00000396332, ENST00000421584, ENST00000427581, ENST00000462628, ENST00000473412, ENST00000480257, ENST00000480375, ENST00000487425, ENST00000890794, ENST00000890795, ENST00000890796, ENST00000890797, ENST00000890798, ENST00000890799, ENST00000890800, ENST00000890801, ENST00000890802, ENST00000890803, ENST00000955134, ENST00000955135, ENST00000955136, ENST00000955137, ENST00000955138, ENST00000955139, ENST00000955140, ENST00000955141, ENST00000955142, ENST00000955143, ENST00000955144

RefSeq mRNA: 10 — MANE Select: NM_001081637 NM_001081637, NM_001081638, NM_001081639, NM_001278398, NM_001278399, NM_001388355, NM_001388356, NM_001388357, NM_001388358, NM_006669

CCDS: CCDS42614, CCDS42615, CCDS42616, CCDS42617, CCDS62803

Canonical transcript exons

ENST00000324602 — 15 exons

Exon	Start	End
ENSE00002470335	54631935	54632237
ENSE00002482998	54633016	54633318
ENSE00002494110	54632464	54632760
ENSE00002495851	54634641	54634763
ENSE00002495910	54636494	54636652
ENSE00002496690	54631271	54631306
ENSE00002515980	54631026	54631107
ENSE00003531272	54633638	54633688
ENSE00003582342	54635557	54635609
ENSE00003618447	54633971	54634021
ENSE00003621576	54635104	54635179
ENSE00003671569	54631500	54631787
ENSE00003682923	54635259	54635296
ENSE00003918243	54636732	54638022
ENSE00003920974	54630484	54630633

Expression profiles

Bgee: expression breadth ubiquitous, 217 present calls, max score 96.72.

FANTOM5 (CAGE): breadth broad, TPM avg 6.6410 / max 256.7006, expressed in 405 samples.

FANTOM5 promoters (4 alternative TSS)

Promoter ID	TPM avg	Samples expressed
177537	3.7478	343
177538	1.6751	235
177536	0.9236	211
177535	0.2945	89

Top tissues by expression

251 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
spleen	UBERON:0002106	96.72	gold quality
monocyte	CL:0000576	96.59	gold quality
vermiform appendix	UBERON:0001154	96.54	gold quality
leukocyte	CL:0000738	96.43	gold quality
granulocyte	CL:0000094	96.36	gold quality
blood	UBERON:0000178	93.76	gold quality
lymph node	UBERON:0000029	89.83	gold quality
caecum	UBERON:0001153	88.25	gold quality
bone marrow cell	CL:0002092	86.05	gold quality
upper lobe of left lung	UBERON:0008952	83.84	gold quality
upper lobe of lung	UBERON:0008948	83.00	gold quality
right lung	UBERON:0002167	81.19	gold quality
C1 segment of cervical spinal cord	UBERON:0006469	80.35	gold quality
superficial temporal artery	UBERON:0001614	79.92	gold quality
small intestine Peyer’s patch	UBERON:0003454	79.06	gold quality
bone marrow	UBERON:0002371	78.96	gold quality
spinal cord	UBERON:0002240	78.90	gold quality
right coronary artery	UBERON:0001625	78.65	gold quality
medial globus pallidus	UBERON:0002477	78.37	gold quality
lung	UBERON:0002048	78.28	gold quality
tonsil	UBERON:0002372	77.72	gold quality
apex of heart	UBERON:0002098	77.65	gold quality
gall bladder	UBERON:0002110	77.38	gold quality
small intestine	UBERON:0002108	77.36	gold quality
epithelial cell of pancreas	CL:0000083	77.18	gold quality
right adrenal gland	UBERON:0001233	76.48	gold quality
rectum	UBERON:0001052	76.25	gold quality
right lobe of liver	UBERON:0001114	76.17	gold quality
right adrenal gland cortex	UBERON:0035827	76.04	gold quality
visceral pleura	UBERON:0002401	76.01	gold quality

Single-cell (SCXA)

Detected in 4 experiment(s), a significant marker in 3.

Experiment	Marker?	Max mean expression
E-CURD-122	yes	34.51
E-MTAB-8498	yes	10.90
E-ANND-3	yes	4.77
E-MTAB-5061	no	3.75

Regulation

Is transcription factor: yes

Downstream targets (CollecTRI)

1 targets.

Target	Regulation
CD80	Activation

Upstream regulators (CollecTRI, top): HOXD10, JUND, MYC, TRERF1

miRNA regulators (miRDB)

34 targeting LILRB1, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-511-3P	99.99	68.85	1467
HSA-MIR-150-5P	99.99	66.69	1976
HSA-MIR-4775	99.98	75.00	6394
HSA-MIR-6778-3P	99.96	67.29	2693
HSA-MIR-205-3P	99.92	69.92	3165
HSA-MIR-4306	99.72	70.50	3630
HSA-MIR-3158-5P	99.65	67.51	1763
HSA-MIR-3685	99.62	68.83	1621
HSA-MIR-6832-5P	99.58	64.82	1132
HSA-MIR-513A-3P	99.39	70.63	3620
HSA-MIR-513C-3P	99.39	70.63	3620
HSA-MIR-185-5P	99.35	68.60	2497
HSA-MIR-4644	99.35	69.12	2514
HSA-MIR-5690	99.25	67.58	1012
HSA-MIR-6852-5P	99.17	66.69	2073
HSA-MIR-3606-3P	99.11	69.84	3254
HSA-MIR-8070	99.07	69.30	1303
HSA-MIR-7151-3P	99.04	69.72	2370
HSA-MIR-3124-3P	98.87	68.95	2123
HSA-MIR-367-5P	98.84	67.18	902
HSA-MIR-4289	98.26	66.90	810
HSA-MIR-138-1-3P	98.25	67.89	867
HSA-MIR-615-5P	98.10	63.76	591
HSA-MIR-18B-3P	98.05	65.55	595
HSA-MIR-6787-3P	97.75	66.17	1233
HSA-MIR-122-5P	97.23	64.92	1024
HSA-MIR-509-3-5P	97.21	67.74	1517
HSA-MIR-509-5P	97.21	67.90	1512
HSA-MIR-4418	97.04	67.16	1372
HSA-MIR-1236-5P	96.62	66.38	856

Literature-anchored findings (GeneRIF, showing 40)

• effect on cytokine production by antigen-stimulated T cells (PMID:11751964)
• Engagement of ILT2/CD85j found in Sezary syndrome cells inhibits their CD3/TCR signaling. (PMID:12130517)
• Increased binding to influenza virus-infected cells is observed in leukocyte Ig-like receptor-1 (LIR1) that is functional and possibly results from the generation of complexes of class I MHC proteins after influenza virus infection. (PMID:12847262)
• inhibitory receptors Ig-like transcript 2 (ILT2) and ILT4 compete with CD8 for MHC class I binding and bind preferentially to HLA-G (PMID:12853576)
• Invariant receptor CD85j expressed on CD8+ T cells mediates the specific recognition of an infectious antigen component and provides a novel example that extends the characteristics of innate immunity to cells mainly involved in adaptive immunity. (PMID:15100307)
• C-terminal Src kinase is regulated by the leukocyte inhibitory receptor CD85j (PMID:15474475)
• Cell surface expression of immunoglobulin-like inhibitory MHC class I receptor CD85j is associated with T cell engagement into various stages of the cytolytic differentiation pathway. (PMID:15585844)
• report that ILT2 receptor, ILT3 receptor, ILT4 receptor, and KIR2DL4 receptor expression is up-regulated by HLA-G histocompatibility antigen in antigen-presenting cells, natural killer cells, and T cells (PMID:15670976)
• CD85j prevents the rescue from apoptosis and the cooperation between dendritic cells and antigen-specific T cells that is mediated by human osteoclast-associated receptor (hOSCAR). (PMID:15905516)
• Polymorphism in LILRB1 is associated with susceptibility to rheumatoid arthritis with HLA-DRB1 shared epitope negative subjects (PMID:16014635)
• Coexpression of ILT2 with killer cell immunoglobulin-like receptor (KIR) in human natural killer (NK) cells may compensate for weak interactions between particular KIR and major histocompatibility complex-I (MHC-I). (PMID:16210603)
• Kinetic studies demonstrated that LILRB1 binds to MHCIs with fast association and dissociation rates, typical of cell-cell recognition receptors. (PMID:16305801)
• Blocking HLA-G receptors ILT2 and ILT4 prevents HLA-G inhibitory effects, leading to the conclusion that that HLA-G acts mainly through these receptors. (PMID:17400057)
• results show that the peripheral blood mononuclear cells from some patients with systemic lupus erythematosus show a defective expression of ILT2, and that most of them exhibit a poor function of this inhibitory receptor (PMID:17601702)
• Progenitor mast cells expressed cell surface inhibitory LILRB1. Mature cord-blood-derived mast cells had detectable mRNA encoding multiple LILRs, none were expressed on the cell surface. (PMID:17998301)
• ligation of LILRB1 on dendritic cells by self-HLA molecules may play a key role in controlling the balance between the induction and suppression of adaptive immune responses (PMID:18094328)
• CD85j(+) NK cell inhibition of HIV-1 replication in MDDC is mainly mediated by CD85j interaction with an unknown ligand (PMID:18398485)
• The presence of LILRB1 in placental stromal cells and LILRB2 in vascular smooth muscle strongly suggest that HLA-G has novel functions in regulation of placental immunity, development and function of the extraembryonic vasculature. (PMID:18538388)
• The 2.2-A structure of a LIR-1/UL18/peptide complex reveals increased contacts and optimal surface complementarity in the LIR-1/UL18 interface compared with LIR/MHCI interfaces, resulting in a >1,000-fold higher affinity. (PMID:18632577)
• Natural killer (NK) cells are targets which express relatively high amounts of inhibitory ILT2/CD85j receptors on the cell surface, capable of shaping interferon-gamma release in response to viral products and during NK and dendritic cell cross-talk. (PMID:18684926)
• Expressed on cultured osteoclast precursor cells derived from peripheral blood monocytes; LILRB1 could be inhibitory for osteoclast development in presence of receptor activator of NF-kappaB ligand (RANKL) and macrophage colony stimulating factor (M-CSF). (PMID:18802077)
• CD85j(leukocyte Ig-like receptor 1) is expressed in Polymyositis and sporadic Inclusion body myositis at the sites of partial invasion and in Dermatomyositis in perivascular inflammation (PMID:18821690)
• Human inhibitory receptor immunoglobulin-like transcript 2 amplifies CD11b+Gr1+ myeloid-derived suppressor cells that promote long-term survival of allografts. (PMID:18946352)
• soluble HLA-G dimer up-regulates inhibitory receptor ILT2 on alloreactive CD8+ T cells (PMID:19136885)
• Cross-linking with anti-LILRB1 or anti-KIR2DL4 resulted in up-regulation of a small subset of mRNAs including those for IL-6, IL-8, and TNFalpha (PMID:19304799)
• ILT2/HLA-G interaction impairs NK-cell functions through the inhibition of the late but not the early events of the NK-cell-activating synapse. (PMID:19841038)
• alloreactivity of a significant fraction of KIR(-) NK cells leads to killing of acute myelogenous leukemia and acute lymphoblastic leukemia blasts that is mediated by NKG2A and LIR-1. (PMID:20139023)
• cell-specific mechanisms allow tailoring of CD85j levels to the distinct roles it plays in different hematopoietic lineages. (PMID:20194892)
• the proportions of CD8+ T cells displaying LILRB1, an inhibitory NKR expressed at late stages of T cell differentiation, were directly related with age and MS duration (PMID:20580616)
• level of expression on NK cells varies depending on genetic polymorphism (PMID:20600445)
• Blockade of LILRB1 and LILRB3 receptors by monoclonal antibodies or short interfering RNA (siRNA) abrogated the specific antigen-presenting properties of dendritic cells, implying an important regulatory role of these molecules. (PMID:20631139)
• The rate of HLA-G receptor ILT-2 on CD4(+)T cell, CD8(+)T cell and B cell in acute rejection group was statistically lower than that in stable kidney function group after renal transplantation. (PMID:21092455)
• High affinity soluble ILT2 receptor is a potent inhibitor of CD8(+) T cell activation. (PMID:21213105)
• show that mAb 256 does not target a TCR ligand but blocks key interactions between non-TCR molecules on effector gammadelta T cells and ILT2 molecule, expressed by tumor targets (PMID:21233315)
• T cells require ILT2-positive cells to upregulate cell-surface ILT2 upon activation, evidence that sensitivity to modulatory molecules can be acquired from other cells. (PMID:21242521)
• LILRB1 exhibits a lower binding affinity for a subset of HLA-A alleles expressed by myeloid cells. (PMID:21270408)
• The abnormal expression and function of ILT2 detected in autoimmune thyroid disease suggests that this receptor may participate in the pathogenesis of this condition. (PMID:21551166)
• LILRA3 binds both classical and non-classical HLA class I molecules but with reduced affinities compared to LILRB1/LILRB2 (PMID:21559424)
• Association of overt and subclinical atherosclerotic disease with LILRB1+ NK and T-cells reflects a relationship between the immune challenge by infections and cardiovascular disease risk, without attributing a dominant role for human cytomegalovirus. (PMID:21817101)
• [review] This review of LILR during HIV-1 infection focuses on the dynamic interplay between LILR and HLA class I molecules in determining HIV-1 disease progression, and the effects of HIV-1 mutational escape on LILR-mediated immune recognition. (PMID:22028331)

Cross-species orthologs

15 orthologs

Organism	Symbol	Gene ID
mus_musculus	Lilra6	ENSMUSG00000030427
mus_musculus	Pirb	ENSMUSG00000058818
mus_musculus	Lilra5	ENSMUSG00000070873
mus_musculus	Pira12	ENSMUSG00000074417
mus_musculus	Pira13	ENSMUSG00000074419
mus_musculus	Pira1	ENSMUSG00000081665
mus_musculus	Pira2	ENSMUSG00000089942
rattus_norvegicus	Lilra5	ENSRNOG00000027808
rattus_norvegicus	Lilrb3	ENSRNOG00000046683
rattus_norvegicus	Lilrb2	ENSRNOG00000054954
rattus_norvegicus	Lilrc2	ENSRNOG00000058087
rattus_norvegicus	Pirb	ENSRNOG00000058422
rattus_norvegicus	LOC134485274	ENSRNOG00000062907
rattus_norvegicus		ENSRNOG00000067708
rattus_norvegicus		ENSRNOG00000069029

Paralogs (25): GP6 (ENSG00000088053), LILRA1 (ENSG00000104974), LILRB5 (ENSG00000105609), A1BG (ENSG00000121410), KIR2DL1 (ENSG00000125498), LILRB2 (ENSG00000131042), IGSF1 (ENSG00000147255), LAIR2 (ENSG00000167618), KIR3DL1 (ENSG00000167633), OSCAR (ENSG00000170909), FCAR (ENSG00000186431), LILRB4 (ENSG00000186818), LILRA5 (ENSG00000187116), KIR2DL4 (ENSG00000189013), VSTM1 (ENSG00000189068), NCR1 (ENSG00000189430), LILRB3 (ENSG00000204577), KIR2DS4 (ENSG00000221957), LILRA4 (ENSG00000239961), LILRA2 (ENSG00000239998), KIR3DL2 (ENSG00000240403), KIR3DL3 (ENSG00000242019), KIR2DL3 (ENSG00000243772), LILRA6 (ENSG00000244482), TARM1 (ENSG00000248385)

Protein

Protein identifiers

Leukocyte immunoglobulin-like receptor subfamily B member 1 — Q8NHL6 (reviewed: Q8NHL6)

Alternative names: CD85 antigen-like family member J, Immunoglobulin-like transcript 2, Monocyte/macrophage immunoglobulin-like receptor 7

All UniProt accessions (7): A0A087WSV6, A0A087WSX8, A0A0B4J1W1, A8MVE2, D9IDM5, F6RVM3, F6TER3

UniProt curated annotations — full annotation on UniProt →

Function. Receptor for class I MHC antigens. Recognizes a broad spectrum of HLA-A, HLA-B, HLA-C, HLA-G and HLA-F alleles. Receptor for H301/UL18, a human cytomegalovirus class I MHC homolog. Ligand binding results in inhibitory signals and down-regulation of the immune response. Engagement of LILRB1 present on natural killer cells or T-cells by class I MHC molecules protects the target cells from lysis. Interaction with HLA-B or HLA-E leads to inhibition of FCER1A signaling and serotonin release. Inhibits FCGR1A-mediated phosphorylation of cellular proteins and mobilization of intracellular calcium ions. Recognizes HLA-G in complex with B2M/beta-2 microglobulin and a nonamer self-peptide. Upon interaction with peptide-bound HLA-G-B2M complex, triggers secretion of growth-promoting factors by decidual NK cells. Reprograms B cells toward an immune suppressive phenotype.

Subunit / interactions. Binds PTPN6 when phosphorylated. Binds FCER1A and FCGR1A. Interacts with human cytomegalovirus/HHV-5 protein UL18. Interacts with peptide-bound HLA-G-B2M complex. Interacts with peptide-bound HLA-F-B2M complex but not with peptide-free HLA-F open conformer. It does not probe the peptide sequence directly.

Subcellular location. Cell membrane Secreted.

Tissue specificity. Expressed in B cells, monocytes and various dendritic cell (DC) subsets including myeloid, plasmacytoid and tolerogenic DCs (at protein level). Expressed in decidual macrophages (at protein level). Expressed in decidual NK cells (at protein level).

Post-translational modifications. Phosphorylated on tyrosine residues. Dephosphorylated by PTPN6.

Domain organisation. Contains 4 copies of a cytoplasmic motif that is referred to as the immunoreceptor tyrosine-based inhibitor motif (ITIM). This motif is involved in modulation of cellular responses. The phosphorylated ITIM motif can bind the SH2 domain of several SH2-containing phosphatases.

Miscellaneous. May act as dominant negative regulator and block the interaction between membrane-associated isoforms and HLA-class I.

Isoforms (5)

UniProt ID	Names	Canonical?
Q8NHL6-1	1	yes
Q8NHL6-2	2
Q8NHL6-3	3
Q8NHL6-4	4
Q8NHL6-5	5, 65 Kda, sLILRB1

RefSeq proteins (10): NP_001075106, NP_001075107, NP_001075108, NP_001265327, NP_001265328, NP_001375284, NP_001375285, NP_001375286, NP_001375287, NP_006660 (=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR003598	Ig_sub2	Domain
IPR003599	Ig_sub	Domain
IPR007110	Ig-like_dom	Domain
IPR013151	Immunoglobulin_dom	Domain
IPR013783	Ig-like_fold	Homologous_superfamily
IPR036179	Ig-like_dom_sf	Homologous_superfamily
IPR050412	Ig-like_Receptors_ImmuneReg	Family

Pfam: PF00047, PF13895

UniProt features (94 total): strand 38, sequence variant 8, helix 7, disulfide bond 5, short sequence motif 4, splice variant 4, mutagenesis site 4, domain 4, region of interest 3, compositionally biased region 3, modified residue 3, glycosylation site 3, topological domain 2, turn 2, signal peptide 1, chain 1, transmembrane region 1, sequence conflict 1

Structure

Experimental structures (PDB)

16 structures.

PDB	Method	Resolution (Å)
1UGN	X-RAY DIFFRACTION	1.8
1G0X	X-RAY DIFFRACTION	2.1
3D2U	X-RAY DIFFRACTION	2.21
6EWO	X-RAY DIFFRACTION	2.3
6EWA	X-RAY DIFFRACTION	2.39
7KFK	X-RAY DIFFRACTION	2.63
4LL9	X-RAY DIFFRACTION	2.69
4NO0	X-RAY DIFFRACTION	2.7
1VDG	X-RAY DIFFRACTION	2.8
1UFU	X-RAY DIFFRACTION	3
6ZDX	X-RAY DIFFRACTION	3
6K60	X-RAY DIFFRACTION	3.15
6EWC	X-RAY DIFFRACTION	3.2
5KNM	X-RAY DIFFRACTION	3.3
6AEE	X-RAY DIFFRACTION	3.3
1P7Q	X-RAY DIFFRACTION	3.4

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q8NHL6-F1	73.82	0.54

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Post-translational modifications (3): 533, 614, 644

Disulfide bonds (5): 49–98, 145–197, 157–167, 246–297, 346–397

Glycosylation sites (3): 281, 302, 341

Mutagenesis-validated functional residues (4):

Position	Phenotype
533	impairs receptor phosphorylation and abolishes inhibition of serotonin release. no effect on ptpn6 binding; when associa
562	no effect on ptpn6 binding; when associated with f-533.
614	no effect on ptpn6 binding. abolishes ptpn6 binding; when associated with f-644.
644	reduces ptpn6 binding. abolishes ptpn6 binding; when associated with f-614.

Function

Pathways and Gene Ontology

Reactome pathways

1 pathways

ID	Pathway
R-HSA-198933	Immunoregulatory interactions between a Lymphoid and a non-Lymphoid cell

MSigDB gene sets: 375 (showing top): GOBP_MYELOID_CELL_DIFFERENTIATION, GOBP_REGULATION_OF_CELL_ACTIVATION, GOBP_REGULATION_OF_LEUKOCYTE_PROLIFERATION, GOBP_NEGATIVE_REGULATION_OF_CELL_DEVELOPMENT, GOBP_DENDRITIC_CELL_DIFFERENTIATION, GOBP_REGULATION_OF_OSTEOCLAST_DIFFERENTIATION, GOBP_NEGATIVE_REGULATION_OF_ADAPTIVE_IMMUNE_RESPONSE, GOBP_REGULATION_OF_ALPHA_BETA_T_CELL_ACTIVATION, REACTOME_ADAPTIVE_IMMUNE_SYSTEM, GOBP_SKELETAL_SYSTEM_DEVELOPMENT, GOBP_MYELOID_CELL_DEVELOPMENT, GOBP_REGULATION_OF_DEFENSE_RESPONSE_TO_VIRUS, GOBP_RESPONSE_TO_PEPTIDE, GOBP_REGULATION_OF_LEUKOCYTE_APOPTOTIC_PROCESS, GOBP_CELLULAR_RESPONSE_TO_LIPID

GO Biological Process (41): negative regulation of T cell mediated cytotoxicity (GO:0001915), positive regulation of defense response to virus by host (GO:0002230), adaptive immune response (GO:0002250), T cell proliferation involved in immune response (GO:0002309), negative regulation of cytokine production involved in immune response (GO:0002719), immune response-regulating signaling pathway (GO:0002764), immune response-inhibiting cell surface receptor signaling pathway (GO:0002767), Fc receptor mediated inhibitory signaling pathway (GO:0002774), signal transduction (GO:0007165), response to virus (GO:0009615), positive regulation of gene expression (GO:0010628), negative regulation of serotonin secretion (GO:0014063), receptor internalization (GO:0031623), negative regulation of interferon-beta production (GO:0032688), negative regulation of type II interferon production (GO:0032689), negative regulation of interleukin-10 production (GO:0032693), negative regulation of interleukin-12 production (GO:0032695), negative regulation of tumor necrosis factor production (GO:0032720), positive regulation of type II interferon production (GO:0032729), negative regulation of mononuclear cell proliferation (GO:0032945), negative regulation of T cell proliferation (GO:0042130), positive regulation of apoptotic process (GO:0043065), negative regulation of cell cycle (GO:0045786), negative regulation of endocytosis (GO:0045806), positive regulation of transcription by RNA polymerase II (GO:0045944), negative regulation of natural killer cell mediated cytotoxicity (GO:0045953), negative regulation of alpha-beta T cell activation (GO:0046636), defense response to virus (GO:0051607), negative regulation of calcium ion transport (GO:0051926), positive regulation of macrophage cytokine production (GO:0060907), cellular response to lipopolysaccharide (GO:0071222), negative regulation of transforming growth factor beta production (GO:0071635), dendritic cell differentiation (GO:0097028), interleukin-10-mediated signaling pathway (GO:0140105), negative regulation of dendritic cell apoptotic process (GO:2000669), negative regulation of CD8-positive, alpha-beta T cell activation (GO:2001186), negative regulation of T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell (GO:2001189), obsolete positive regulation of gamma-delta T cell activation involved in immune response (GO:2001193), negative regulation of dendritic cell differentiation (GO:2001199), negative regulation of osteoclast development (GO:2001205)

GO Molecular Function (11): protein phosphatase 1 binding (GO:0008157), MHC class Ib protein complex binding (GO:0023025), MHC class Ib protein binding (GO:0023029), HLA-A specific inhibitory MHC class I receptor activity (GO:0030107), HLA-B specific inhibitory MHC class I receptor activity (GO:0030109), MHC class I receptor activity (GO:0032393), MHC class Ib receptor activity (GO:0032394), inhibitory MHC class I receptor activity (GO:0032396), SH2 domain binding (GO:0042169), MHC class I protein binding (GO:0042288), protein homodimerization activity (GO:0042803)

GO Cellular Component (5): extracellular region (GO:0005576), cytoplasm (GO:0005737), plasma membrane (GO:0005886), external side of plasma membrane (GO:0009897), membrane (GO:0016020)

Reactome top-level categories

Rollup of top-1 pathways:

Category	Pathways
Adaptive Immune System	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
negative regulation of cytokine production	4
cellular anatomical structure	3
immune response	2
type II interferon production	2
regulation of type II interferon production	2
MHC protein binding	2
inhibitory MHC class I receptor activity	2
transmembrane signaling receptor activity	2
immune receptor activity	2
negative regulation of leukocyte mediated cytotoxicity	1
T cell mediated cytotoxicity	1
regulation of T cell mediated cytotoxicity	1
negative regulation of T cell mediated immunity	1
regulation of defense response to virus by host	1
T cell activation involved in immune response	1
T cell proliferation	1
cytokine production involved in immune response	1
negative regulation of production of molecular mediator of immune response	1
regulation of cytokine production involved in immune response	1
signal transduction	1
regulation of immune response	1
immune response-inhibiting signal transduction	1
immune response-regulating cell surface receptor signaling pathway	1
immune response-inhibiting cell surface receptor signaling pathway	1
cell communication	1
cellular process	1
signaling	1
regulation of cellular process	1
cellular response to stimulus	1
response to other organism	1
gene expression	1
regulation of gene expression	1
positive regulation of macromolecule biosynthetic process	1
serotonin secretion	1
regulation of serotonin secretion	1
negative regulation of monoatomic ion transport	1
negative regulation of secretion by cell	1
receptor-mediated endocytosis	1
negative regulation of type I interferon production	1
interferon-beta production	1

Protein interactions and networks

STRING

1440 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
LILRB1	HLA-G	P17693	997
LILRB1	HLA-A	P01891	996
LILRB1	HLA-E	P13747	995
LILRB1	RPL5	P46777	995
LILRB1	HLA-C	P04222	991
LILRB1	HLA-F	P30511	982
LILRB1	HLA-B	P01889	966
LILRB1	CD300C	Q08708	922
LILRB1	B2M	P01884	913
LILRB1	KLRC1	P26715	901
LILRB1	KLRD1	Q13241	852
LILRB1	MICB	P79525	813
LILRB1	ULBP1	Q9BZM6	792
LILRB1	PTPN6	P29350	785
LILRB1	CSK	P41240	779
LILRB1	KLRK1	P26718	779

IntAct

47 interactions, top by confidence:

A	B	Type	Score
HLA-B	B2M	psi-mi:“MI:0915”(physical association)	0.930
HLA-G	LILRB1	psi-mi:“MI:0915”(physical association)	0.830
HLA-G	LILRB1	psi-mi:“MI:0407”(direct interaction)	0.830
HLA-G	B2M	psi-mi:“MI:0915”(physical association)	0.780
LILRA3	NARS1	psi-mi:“MI:0914”(association)	0.530
LILRA3	LILRA1	psi-mi:“MI:0914”(association)	0.530
PLTP	SEL1L3	psi-mi:“MI:0914”(association)	0.530
B2M	H2AX	psi-mi:“MI:0915”(physical association)	0.520
CSK	LILRB1	psi-mi:“MI:0914”(association)	0.480
CSK	LILRB1	psi-mi:“MI:0915”(physical association)	0.480
HLA-A	gag-pol	psi-mi:“MI:0915”(physical association)	0.400
LILRB1	PTPN6	psi-mi:“MI:0915”(physical association)	0.400
PTPN6	LILRB1	psi-mi:“MI:0915”(physical association)	0.400
HLA-A		psi-mi:“MI:0915”(physical association)	0.400
HLA-B		psi-mi:“MI:0915”(physical association)	0.400
HLA-A	EBNA4	psi-mi:“MI:0915”(physical association)	0.400
HLA-A	env	psi-mi:“MI:0915”(physical association)	0.400
HLA-A	INS	psi-mi:“MI:0915”(physical association)	0.400
HLA-C	KPNA2	psi-mi:“MI:0915”(physical association)	0.400
HLA-A	B2M	psi-mi:“MI:0915”(physical association)	0.400
HLA-G		psi-mi:“MI:0915”(physical association)	0.400
HLA-C		psi-mi:“MI:0915”(physical association)	0.400

BioGRID (12): LILRB1 (Affinity Capture-MS), LILRB1 (Affinity Capture-MS), HLA-A (Co-crystal Structure), HLA-B (Reconstituted Complex), HLA-C (Reconstituted Complex), HLA-G (Reconstituted Complex), HLA-F (Reconstituted Complex), LILRB1 (Affinity Capture-MS), PTPN6 (Affinity Capture-Western), AGO2 (Protein-RNA), LILRB1 (Affinity Capture-RNA), LILRB1 (Two-hybrid)

ESM2 similar proteins: A0A0K2S4Q6, A2A7V7, A6NI73, A8K4G0, O43699, O75019, O75022, O75023, O75871, O76036, P0C191, P20138, P24071, P40198, P59901, P80943, Q08708, Q13410, Q28110, Q3U497, Q496F6, Q64JA4, Q6GTX8, Q6ISS4, Q6PI73, Q6UXZ3, Q7TSN2, Q863H2, Q8C567, Q8K249, Q8MJZ2, Q8MJZ7, Q8N149, Q8N423, Q8N6C8, Q8NHJ6, Q8NHL6, Q8VBT3, Q8VCH2, Q95JB9

Diamond homologs: A0A0G2KBC9, A6NI73, C0HJX2, C0HJX3, D3ZQX2, O75019, O75022, O75023, O76036, P0C191, P24071, P43626, P43629, P43630, P59901, P83556, P97484, Q14943, Q14954, Q61450, Q64281, Q6GTX8, Q6ISS4, Q6PI73, Q7TQA1, Q863H2, Q8C567, Q8IYS5, Q8MJZ2, Q8MJZ7, Q8N109, Q8N149, Q8N423, Q8N6C8, Q8N743, Q8NHJ6, Q8NHK3, Q8NHL6, Q95JB9, Q9HCN6

SIGNOR signaling

3 interactions.

A	Effect	B	Mechanism
HLA-G	up-regulates	LILRB1	binding
sirolimus	“down-regulates quantity by repression”	LILRB1
MARCHF9	“down-regulates quantity by destabilization”	LILRB1	ubiquitination

Enriched among interaction partners

Reactome pathways and GO biological processes over-represented among this gene’s 26 IntAct physical interaction partners (hypergeometric vs the genome-wide background, BH-FDR, gene-set size 15–500, ranked by fold). A functional readout of the neighbourhood — distinct from this gene’s own memberships above, and biased toward well-studied / hub proteins, so read it as themes rather than proof.

Reactome pathways:

Pathway	Partners	Fold	FDR
Antigen Presentation: Folding, assembly and peptide loading of class I MHC	5	103.6×	4e-08
Interferon alpha/beta signaling	5	40.1×	4e-06
Interferon gamma signaling	6	39.6×	2e-07
Immunoregulatory interactions between a Lymphoid and a non-Lymphoid cell	8	36.7×	2e-09
ER-Phagosome pathway	5	34.1×	7e-06
SARS-CoV-2 activates/modulates innate and adaptive immune responses	7	32.9×	4e-08
Adaptive Immune System	5	7.8×	6e-03

GO biological processes:

GO term	Partners	Fold	FDR
positive regulation of T cell mediated cytotoxicity	5	121.6×	1e-07
adaptive immune response	7	28.1×	2e-07
immune response	5	11.2×	1e-03

Disease & clinical

Clinical variants and AI predictions

ClinVar

194 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	146
Likely benign	13
Benign	5

Top pathogenic / likely-pathogenic (0)

SpliceAI

2646 predictions. Top by Δscore:

Variant	Effect	Δscore
19:54632051:G:GT	donor_gain	1.0000
19:54632756:CGCAG:C	donor_loss	1.0000
19:54632759:AGG:A	donor_loss	1.0000
19:54632760:GG:G	donor_loss	1.0000
19:54632761:GT:G	donor_loss	1.0000
19:54632762:T:G	donor_loss	1.0000
19:54634764:G:GG	donor_gain	1.0000
19:54635297:G:GG	donor_gain	1.0000
19:54635308:G:GT	donor_gain	1.0000
19:54635326:G:GT	donor_gain	1.0000
19:54635329:G:GT	donor_gain	1.0000
19:54636492:A:AG	acceptor_gain	1.0000
19:54636493:G:GA	acceptor_gain	1.0000
19:54636493:GC:G	acceptor_gain	1.0000
19:54636493:GCA:G	acceptor_gain	1.0000
19:54636493:GCAGA:G	acceptor_gain	1.0000
19:54636648:CTGAG:C	donor_gain	1.0000
19:54636649:TGAGG:T	donor_loss	1.0000
19:54636650:GAG:G	donor_gain	1.0000
19:54636650:GAGGT:G	donor_loss	1.0000
19:54636651:AGGTG:A	donor_loss	1.0000
19:54636653:G:A	donor_loss	1.0000
19:54636653:G:GG	donor_gain	1.0000
19:54636654:T:A	donor_loss	1.0000
19:54630630:CATGG:C	donor_loss	0.9900
19:54630631:ATGG:A	donor_loss	0.9900
19:54630632:TGG:T	donor_loss	0.9900
19:54630633:GGT:G	donor_loss	0.9900
19:54630634:G:A	donor_loss	0.9900
19:54630635:T:A	donor_loss	0.9900

AlphaMissense

0 scored. Top likely-pathogenic:

dbSNP variants (sampled 300 via entrez): RS1000167574 (19:54637551 G>A), RS1000204124 (19:54636229 A>C), RS1000477238 (19:54616041 C>A), RS1000506271 (19:54626954 A>G), RS1000857255 (19:54638320 A>T), RS1000872533 (19:54627136 C>G), RS1001074976 (19:54634902 CCCATCTACAAATGTAAAGTGTCCTTCGGGCTCAGTG>C), RS1001113222 (19:54615727 A>G), RS1001459435 (19:54620267 A>G), RS1001511950 (19:54620611 C>A), RS1001850655 (19:54618711 T>G), RS1001870796 (19:54628367 G>A,C,T), RS1002055548 (19:54624025 A>G,T), RS1002117065 (19:54617091 A>G), RS1002185767 (19:54635060 G>A,T)

Disease associations

OMIM: gene MIM:604811 | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

2 associations (top):

Study	Trait	p-value
GCST002595_28	Clozapine-induced agranulocytosis	9.000000e-06
GCST006585_419	Blood protein levels	0.000000e+00

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

GtoPdb / IUPHAR curated pharmacology

(IUPHAR/BPS Guide to Pharmacology — expert-curated)

Target class: other protein — CD molecules

CTD chemical–gene interactions

31 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Nickel	decreases expression, increases expression	3
Aflatoxin B1	decreases expression, increases methylation, affects expression	3
Arsenic Trioxide	increases expression, decreases expression	2
Benzo(a)pyrene	decreases methylation, decreases expression	2
Tetrachlorodibenzodioxin	decreases expression	2
triphenyl phosphate	affects expression	1
testosterone undecanoate	affects cotreatment, increases expression	1
sodium bichromate	decreases expression	1
cobaltous chloride	increases expression	1
benzo(e)pyrene	increases methylation	1
S-(1,2-dichlorovinyl)cysteine	decreases expression, affects response to substance, increases expression, affects cotreatment	1
di-n-butylphosphoric acid	affects expression	1
erucylphospho-N,N,N-trimethylpropylammonium	increases expression	1
Grape Seed Proanthocyanidins	affects cotreatment, decreases expression	1
4-(4-((5-(4,5-dimethyl-2-nitrophenyl)-2-furanyl)methylene)-4,5-dihydro-3-methyl-5-oxo-1H-pyrazol-1-yl)benzoic acid	increases expression	1
Air Pollutants, Occupational	decreases expression	1
Arsenic	affects methylation	1
Catechin	affects cotreatment, decreases expression	1
Ethyl Methanesulfonate	decreases expression	1
Hydrogen Peroxide	affects expression	1
Lipopolysaccharides	affects response to substance, increases expression, affects cotreatment, decreases expression	1
Methapyrilene	increases methylation	1
Methotrexate	decreases expression	1
Methyl Methanesulfonate	decreases expression	1
Ozone	increases expression	1
Valproic Acid	increases methylation	1
Vincristine	decreases expression	1
Zinc	increases expression	1
Levonorgestrel	affects cotreatment, increases expression	1
Asbestos, Crocidolite	decreases expression	1

Cellosaurus cell lines

6 cell lines: 4 cancer cell line, 1 spontaneously immortalized cell line, 1 transformed cell line

First 10 cell lines (id-ordered, not curated):

Cellosaurus	Name	Category	Sex
CVCL_B8JR	Abcam HCT 116 LILRB1 KO	Cancer cell line	Male
CVCL_B9M0	Abcam A-549 LILRB1 KO	Cancer cell line	Male
CVCL_D2G7	Abcam MCF-7 LILRB1 KO	Cancer cell line	Female
CVCL_E6QZ	Genomeditech CHO-K1 H_LILRB1(ILT2)	Spontaneously immortalized cell line	Female
CVCL_E6UD	Genomeditech HEK-293 H_LILRB1(ILT2)	Transformed cell line	Female
CVCL_E6VU	Genomeditech Jurkat H_LILRB1(ILT2) Reporter	Cancer cell line	Male

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.