LOXL3

Summary

LOXL3 (lysyl oxidase like 3, HGNC:13869) is a protein-coding gene on chromosome 2p13.1, encoding Lysyl oxidase homolog 3 (P58215). Protein-lysine 6-oxidase that mediates the oxidation of peptidyl lysine residues to allysine in target proteins.

This gene encodes a lysyl oxidase, which likely functions as an amine oxidase and plays a role in the formation of crosslinks in collagens and elastin. Deletion of the related gene in mouse causes neonatal mortality with cleft palate, spine deformity, and defects in collagen organization. A mutation in this gene was found in a family with Stickler syndrome.

Source: NCBI Gene 84695 — RefSeq curated summary.

At a glance

• Gene–disease (curated): myopia 28, autosomal recessive (Strong, GenCC) — +2 more curated relationships
• Clinical variants (ClinVar): 395 total — 3 pathogenic, 1 likely-pathogenic
• Phenotypes (HPO): 25
• Druggable target: yes — 3 molecules with ChEMBL bioactivity
• MANE Select transcript: NM_032603

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:13869
Approved symbol	LOXL3
Name	lysyl oxidase like 3
Location	2p13.1
Locus type	gene with protein product
Status	Approved
Ensembl gene	ENSG00000115318
Ensembl biotype	protein_coding
OMIM	607163
Entrez	84695

Gene structure

Transcript identifiers

Ensembl transcripts: 22 — 19 protein_coding, 2 protein_coding_CDS_not_defined, 1 retained_intron

ENST00000264094, ENST00000393937, ENST00000409249, ENST00000409549, ENST00000409986, ENST00000413469, ENST00000420535, ENST00000470907, ENST00000481835, ENST00000484369, ENST00000853956, ENST00000853957, ENST00000853958, ENST00000853959, ENST00000934363, ENST00000946465, ENST00000946466, ENST00000946467, ENST00000946468, ENST00000946469, ENST00000946470, ENST00000946471

RefSeq mRNA: 3 — MANE Select: NM_032603 NM_001289164, NM_001289165, NM_032603

CCDS: CCDS1953, CCDS74527

Canonical transcript exons

ENST00000264094 — 14 exons

Exon	Start	End
ENSE00000764177	74536709	74536928
ENSE00000764234	74552322	74552646
ENSE00001044682	74532258	74533679
ENSE00001044685	74553876	74553942
ENSE00003530064	74535588	74535755
ENSE00003532273	74534100	74534236
ENSE00003533781	74535996	74536150
ENSE00003534609	74535292	74535454
ENSE00003541905	74533882	74533993
ENSE00003545737	74534316	74534431
ENSE00003557024	74549369	74549583
ENSE00003626385	74536291	74536471
ENSE00003639200	74534531	74534774
ENSE00003692526	74550185	74550348

Expression profiles

Bgee: expression breadth ubiquitous, 198 present calls, max score 93.41.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 6.3299 / max 307.8301, expressed in 1162 samples.

FANTOM5 promoters (6 alternative TSS)

Promoter ID	TPM avg	Samples expressed
29252	4.0608	840
29249	1.0784	331
29253	0.7886	263
29244	0.2198	88
29245	0.0959	52
29246	0.0865	31

Top tissues by expression

240 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
tibia	UBERON:0000979	93.41	gold quality
cartilage tissue	UBERON:0002418	90.44	gold quality
tendon of biceps brachii	UBERON:0008188	87.49	gold quality
ventricular zone	UBERON:0003053	85.95	gold quality
monocyte	CL:0000576	85.88	gold quality
leukocyte	CL:0000738	85.33	gold quality
decidua	UBERON:0002450	85.03	gold quality
descending thoracic aorta	UBERON:0002345	84.28	gold quality
ascending aorta	UBERON:0001496	84.05	gold quality
thoracic aorta	UBERON:0001515	84.01	gold quality
stromal cell of endometrium	CL:0002255	83.82	gold quality
primordial germ cell in gonad	CL:0000670 ∩ UBERON:0000991	82.86	gold quality
right coronary artery	UBERON:0001625	82.39	gold quality
kidney epithelium	UBERON:0004819	82.34	gold quality
ganglionic eminence	UBERON:0004023	81.71	gold quality
left coronary artery	UBERON:0001626	81.46	gold quality
coronary artery	UBERON:0001621	81.15	gold quality
trabecular bone tissue	UBERON:0002483	81.09	gold quality
aorta	UBERON:0000947	80.80	gold quality
spleen	UBERON:0002106	80.80	gold quality
granulocyte	CL:0000094	80.03	gold quality
cardiac muscle of right atrium	UBERON:0003379	80.03	gold quality
left ventricle myocardium	UBERON:0006566	79.79	gold quality
smooth muscle tissue	UBERON:0001135	79.56	gold quality
upper arm skin	UBERON:0004263	79.55	gold quality
apex of heart	UBERON:0002098	79.21	gold quality
placenta	UBERON:0001987	78.94	gold quality
body of uterus	UBERON:0009853	78.83	gold quality
mucosa of stomach	UBERON:0001199	78.76	gold quality
left adrenal gland cortex	UBERON:0035825	78.67	gold quality

Single-cell (SCXA)

Detected in 5 experiment(s), a significant marker in 3.

Experiment	Marker?	Max mean expression
E-MTAB-7051	yes	2173.05
E-GEOD-81383	yes	1778.69
E-ANND-3	yes	4.33
E-ENAD-17	no	876.69
E-MTAB-8060	no	340.94

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

68 targeting LOXL3, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-3163	100.00	77.23	8605
HSA-MIR-190A-3P	100.00	80.35	5520
HSA-MIR-34A-5P	99.99	71.21	1784
HSA-MIR-449A	99.99	71.05	1776
HSA-MIR-34C-5P	99.97	70.45	1577
HSA-MIR-449B-5P	99.97	70.26	1580
HSA-MIR-9718	99.94	68.91	918
HSA-MIR-141-3P	99.94	72.79	2421
HSA-MIR-200A-3P	99.94	72.68	2420
HSA-MIR-6753-3P	99.93	66.57	637
HSA-MIR-7107-3P	99.93	66.73	627
HSA-MIR-7162-3P	99.89	68.16	1682
HSA-MIR-4302	99.89	67.94	1187
HSA-MIR-4671-3P	99.88	72.46	1045
HSA-MIR-137-3P	99.87	74.74	2401
HSA-MIR-4492	99.87	68.25	3611
HSA-MIR-6763-5P	99.76	64.68	1767
HSA-MIR-6752-3P	99.72	66.71	1587
HSA-MIR-548AU-3P	99.70	68.22	1373
HSA-MIR-4527	99.66	67.43	714
HSA-MIR-3175	99.65	66.30	2031
HSA-MIR-3679-3P	99.64	69.88	1599
HSA-MIR-6134	99.63	65.68	1537
HSA-MIR-762	99.58	66.61	1994
HSA-MIR-12122	99.56	69.33	1672
HSA-MIR-4325	99.49	72.20	1342
HSA-MIR-6081	99.48	66.07	1446
HSA-MIR-6083	99.47	68.73	2393
HSA-MIR-4498	99.47	67.42	2360
HSA-MIR-4728-3P	99.47	68.94	981

Literature-anchored findings (GeneRIF, showing 19)

• Lysyl-oxidase-like 3 interacts and cooperates with Snail to downregulate E-cadherin expression, and control epithelial-mesenchymal transitions and carcinoma progression. (PMID:16096638)
• LOXL3 encodes two variants, LOXL3 and LOXL3-sv1, both of which function as amine oxidases with distinct tissue and substrate specificities from one another. (PMID:17018530)
• Breast carcinoma effusions showed significantly higher LOXL2 and lower LOXL3 expression compared to primary carcinomas. (PMID:19015874)
• Expression of LOXL, LOXL2, LOXL3 and LOXL4 was not statistically associated with tumor location, stage, growth type, or differentiation status in colorectal adenocarcinomas (PMID:19724858)
• The human lysyl oxidase-like 3 gene does not confer increased genotypic risk for adolescent idiopathic scoliosis. (PMID:21740577)
• TGF-beta1 induced injured MCL to express more LOXs than injured ACL (up to 1.85-fold in LOX, 2.21-fold in LOXL-1, 1.71-fold in LOXL-2, 2.52-fold in LOXL-3 and 3.32-fold in LOXL-4). (PMID:23357697)
• LOXL3 is a novel candidate gene for autosomal recessive Stickler syndrome. (PMID:25663169)
• Our results suggest that null mutations in LOXL3 are likely associated with autosomal recessive early-onset high myopia. LOXL3 is a potential candidate gene for high myopia, but this possibility should be confirmed in additional studies. (PMID:26957899)
• By deacetylating and deacetyliminating Stat3 on multiple acetyl-lysine sites in nuclei, Loxl3 regulates Stat3 dimerization and transcriptional activity. CD4+ T cell differentiation in inflammatory responses is regulated by the Loxl3-Stat3 signaling pathway (PMID:28065600)
• results reveal an unexpected role for LOXL3 in the control of genome stability and melanoma progression, exposing its potential as a novel therapeutic target in malignant melanoma, a very aggressive condition yet in need for more effective treatment options. (PMID:29229995)
• Missense variant in LOXL3 gene is associated with nonsyndromic cleft palate. (PMID:29802726)
• LOXL1, LOXL3, and LOXL4 expressions are associated with distant metastasis of gastric cancer. (PMID:30045039)
• we present here a child and his father with Stickler syndrome and homozygous novel mutation in LOXL3 c.1036C>T (p.Arg346Trp). This report adds more evidence that biallelic mutations in LOXL3 cause autosomal recessive Stickler syndrome. (PMID:30362103)
• LOXL3 function beyond amino oxidase and role in pathologies, including cancer, has been described. (Review) (PMID:31340433)
• LOXL3 Silencing Affected Cell Adhesion and Invasion in U87MG Glioma Cells. (PMID:34360836)
• Identification of LOXL3-associating immune infiltration landscape and prognostic value in hepatocellular carcinoma. (PMID:34448895)
• Apoptosis Activation and Autophagy Inhibition of Chondrocytes by Leptin by the Upregulation of LOXL3 in Osteoarthritis Pathogenesis. (PMID:35035830)
• LOXL3-promoted hepatocellular carcinoma progression via promotion of Snail1/USP4-mediated epithelial-mesenchymal transition. (PMID:35841383)
• The Genetic Confirmation and Clinical Characterization of LOXL3-Associated MYP28: A Common Type of Recessive Extreme High Myopia. (PMID:36917121)

Cross-species orthologs

4 orthologs

Organism	Symbol	Gene ID
danio_rerio	loxl3b	ENSDARG00000039563
danio_rerio	loxl3a	ENSDARG00000076306
mus_musculus	Loxl3	ENSMUSG00000000693
rattus_norvegicus	Loxl3	ENSRNOG00000061373

Paralogs (15): CD6 (ENSG00000013725), CD5L (ENSG00000073754), LGALS3BP (ENSG00000108679), CD5 (ENSG00000110448), LOX (ENSG00000113083), LOXL1 (ENSG00000129038), LOXL2 (ENSG00000134013), LOXL4 (ENSG00000138131), SSC4D (ENSG00000146700), PRSS12 (ENSG00000164099), CD163 (ENSG00000177575), CD163L1 (ENSG00000177675), SSC5D (ENSG00000179954), DMBT1 (ENSG00000187908), SCART1 (ENSG00000214279)

Protein

Protein identifiers

Lysyl oxidase homolog 3 — P58215 (reviewed: P58215)

Alternative names: Lysyl oxidase-like protein 3

All UniProt accessions (6): P58215, B8ZZT6, B9A025, C9J5M1, E7END4, H7C248

UniProt curated annotations — full annotation on UniProt →

Function. Protein-lysine 6-oxidase that mediates the oxidation of peptidyl lysine residues to allysine in target proteins. Catalyzes the post-translational oxidative deamination of peptidyl lysine residues in precursors of elastin and different types of collagens, a prerequisite in the formation of cross-links between collagens and elastin. Required for somite boundary formation by catalyzing oxidation of fibronectin (FN1), enhancing integrin signaling in myofibers and their adhesion to the myotendinous junction (MTJ). Acts as a regulator of inflammatory response by inhibiting differentiation of naive CD4(+) T-cells into T-helper Th17 or regulatory T-cells (Treg): acts by interacting with STAT3 in the nucleus and catalyzing both deacetylation and oxidation of lysine residues on STAT3, leading to disrupt STAT3 dimerization and inhibit STAT3 transcription activity. Oxidation of lysine residues to allysine on STAT3 preferentially takes place on lysine residues that are acetylated. Also able to catalyze deacetylation of lysine residues on STAT3. Shows protein-lysine 6-oxidase activity toward elastin and different types of collagens, with the highest activity toward collagen type VIII. Shows protein-lysine 6-oxidase activity toward elastin and different types of collagens, with the highest activity toward collagen type IV.

Subunit / interactions. Interacts with STAT3.

Subcellular location. Secreted. Extracellular space. Cytoplasm. Nucleus Secreted. Extracellular space Cytoplasm.

Tissue specificity. Isoform 1: Predominantly detected in the heart, placenta, lung, and small intestine. Isoform 2: Highly detected in the kidney, pancreas, spleen, and thymus, and is absent in lung. In eye, present in all layers of corneas as well as in the limbus and conjunctiva (at protein level).

Post-translational modifications. The lysine tyrosylquinone cross-link (LTQ) is generated by condensation of the epsilon-amino group of a lysine with a topaquinone produced by oxidation of tyrosine.

Disease relevance. Defects in LOXL3 are found in a family with an autosomal recessive form of Stickler syndrome, an inherited disorder that associates ocular signs with more or less complete forms of Pierre Robin sequence and sensorineural deafness. Pierre Robin sequence includes an opening in the roof of the mouth (a cleft palate). The degree of hearing loss varies among affected individuals and may become more severe over time. Syndrome expressivity is variable. Ocular disorders include non-progressive myopia with associated chorioretinal degeneration. Myopia 28, autosomal recessive (MYP28) [MIM:619781] A form of myopia, a refractive error of the eye, in which parallel rays from a distant object come to focus in front of the retina, vision being better for near objects than for far. MYP28 patients are affected by early-onset high myopia in the first decade of life. Retinal detachment may occur, and early-onset cataract has been reported. The disease is caused by variants affecting the gene represented in this entry.

Cofactor. Contains 1 lysine tyrosylquinone.

Miscellaneous. Misses three SRCR domains.

Similarity. Belongs to the lysyl oxidase family.

Isoforms (3)

UniProt ID	Names	Canonical?
P58215-1	1	yes
P58215-2	2, LOXL3-sv1
P58215-3	3

RefSeq proteins (3): NP_001276093, NP_001276094, NP_115992* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR001190	SRCR	Domain
IPR001695	Lysyl_oxidase	Family
IPR019828	Lysyl_oxidase_CS	Conserved_site
IPR036772	SRCR-like_dom_sf	Homologous_superfamily
IPR050912

Pfam: PF00530, PF01186

Enzyme classification (BRENDA):

• EC 1.4.3.13 — protein-lysine 6-oxidase (BRENDA: 17 organisms, 78 substrates, 106 inhibitors, 3 Km, 1 kcat entries)

Substrate kinetics (BRENDA)

1 substrates with measured Km, best-characterized 1. Km ranges are aggregated across organisms/conditions.

Substrate	Km (mM)	Measurements
1,5-DIAMINOPENTANE	0.373	1

Catalyzed reactions (Rhea), 2 shown:

• L-lysyl-[protein] + O2 + H2O = (S)-2-amino-6-oxohexanoyl-[protein] + H2O2 + NH4(+) (RHEA:24544)
• N(6)-acetyl-L-lysyl-[protein] + O2 + H2O = acetamide + (S)-2-amino-6-oxohexanoyl-[protein] + H2O2 (RHEA:51648)

UniProt features (49 total): disulfide bond 17, mutagenesis site 8, glycosylation site 5, domain 4, binding site 3, splice variant 2, sequence variant 2, region of interest 2, signal peptide 1, chain 1, modified residue 1, cross-link 1, sequence conflict 1, compositionally biased region 1

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-P58215-F1	84.11	0.56

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Ligand- & substrate-binding residues (3): 609; 611; 607

Post-translational modifications (2): 670, 634–670

Disulfide bonds (17): 70–134, 83–144, 114–124, 201–271, 214–281, 248–258, 332–396, 345–406, 376–386, 446–511, 459–524, 492–502, 554–560, 606–654, 638–644, 666–676, 713–727

Glycosylation sites (5): 111, 266, 390, 481, 625

Mutagenesis-validated functional residues (8):

Position	Phenotype
83	impaired ability to mediate deacetylation of stat3; when associated with a-214; a-345 and a-459.
214	impaired ability to mediate deacetylation of stat3; when associated with a-83; a-345 and a-459.
345	impaired ability to mediate deacetylation of stat3; when associated with a-83; a-214 and a-459.
376	impaired ability to mediate deacetylation of stat3; when associated with a-446 and a-492.
446	impaired ability to mediate deacetylation of stat3; when associated with a-376 and a-492.
459	impaired ability to mediate deacetylation of stat3; when associated with a-83; a-214 and a-345.
492	impaired ability to mediate deacetylation of stat3; when associated with a-376 and a-446.
607–609	impaired ability to mediate deacetylation of stat3.

Function

Pathways and Gene Ontology

Reactome pathways

5 pathways

ID	Pathway
R-HSA-1566948	Elastic fibre formation
R-HSA-2243919	Crosslinking of collagen fibrils
R-HSA-1474244	Extracellular matrix organization
R-HSA-1474290	Collagen formation
R-HSA-2022090	Assembly of collagen fibrils and other multimeric structures

MSigDB gene sets: 291 (showing top): GSE45365_CTRL_VS_MCMV_INFECTION_NK_CELL_UP, GOBP_SPINAL_CORD_DEVELOPMENT, GOBP_REGULATION_OF_CELL_ACTIVATION, GOBP_EPITHELIUM_DEVELOPMENT, GOBP_NEGATIVE_REGULATION_OF_CELL_DEVELOPMENT, GOBP_NEGATIVE_REGULATION_OF_ADAPTIVE_IMMUNE_RESPONSE, GOBP_REGULATION_OF_ALPHA_BETA_T_CELL_ACTIVATION, GOBP_COLLAGEN_FIBRIL_ORGANIZATION, GOBP_INFLAMMATORY_RESPONSE, GOBP_T_CELL_ACTIVATION_INVOLVED_IN_IMMUNE_RESPONSE, GOBP_REGULATION_OF_ADAPTIVE_IMMUNE_RESPONSE, GOBP_ALPHA_BETA_T_CELL_DIFFERENTIATION, GOBP_NEGATIVE_REGULATION_OF_CELL_CELL_ADHESION, GOBP_REGULATION_OF_T_HELPER_CELL_DIFFERENTIATION, GOBP_CELL_ACTIVATION_INVOLVED_IN_IMMUNE_RESPONSE

GO Biological Process (16): epithelial to mesenchymal transition (GO:0001837), inflammatory response (GO:0006954), peptidyl-lysine oxidation (GO:0018057), spinal cord development (GO:0021510), collagen fibril organization (GO:0030199), lung development (GO:0030324), negative regulation of DNA-templated transcription (GO:0045892), roof of mouth development (GO:0060021), somite development (GO:0061053), fibronectin fibril organization (GO:1905590), negative regulation of T-helper 17 cell lineage commitment (GO:2000329), positive regulation of integrin-mediated signaling pathway (GO:2001046), cell surface receptor signaling pathway via JAK-STAT (GO:0007259), tissue development (GO:0009888), animal organ development (GO:0048513), T-helper 17 cell lineage commitment (GO:0072540)

GO Molecular Function (7): fibronectin binding (GO:0001968), protein-lysine 6-oxidase activity (GO:0004720), copper ion binding (GO:0005507), protein binding (GO:0005515), oxidoreductase activity (GO:0016491), oxidoreductase activity, acting on the CH-NH2 group of donors, oxygen as acceptor (GO:0016641), metal ion binding (GO:0046872)

GO Cellular Component (5): extracellular region (GO:0005576), obsolete extracellular space (GO:0005615), nucleus (GO:0005634), cytoplasm (GO:0005737), membrane (GO:0016020)

Reactome top-level categories

Rollup of top-3 pathways:

Category	Pathways
Extracellular matrix organization	2
Assembly of collagen fibrils and other multimeric structures	1
Collagen formation	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
anatomical structure development	4
cellular anatomical structure	3
mesenchymal cell differentiation	1
defense response	1
protein oxidation	1
peptidyl-lysine modification	1
central nervous system development	1
extracellular matrix organization	1
respiratory tube development	1
animal organ development	1
respiratory system development	1
DNA-templated transcription	1
regulation of DNA-templated transcription	1
negative regulation of RNA biosynthetic process	1
embryo development	1
epithelium development	1
supramolecular fiber organization	1
negative regulation of cell fate commitment	1
T-helper 17 cell lineage commitment	1
negative regulation of T-helper 17 cell differentiation	1
regulation of T-helper 17 cell lineage commitment	1
integrin-mediated signaling pathway	1
positive regulation of signal transduction	1
regulation of integrin-mediated signaling pathway	1
cell surface receptor signaling pathway via STAT	1
T-helper cell lineage commitment	1
T-helper 17 cell differentiation	1
protein binding	1
oxidoreductase activity, acting on the CH-NH2 group of donors, oxygen as acceptor	1
catalytic activity, acting on a protein	1
transition metal ion binding	1
binding	1
catalytic activity	1
oxidoreductase activity, acting on the CH-NH2 group of donors	1
cation binding	1
intracellular membrane-bounded organelle	1
intracellular anatomical structure	1

Protein interactions and networks

STRING

1078 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
LOXL3	BMP1	P13497	747
LOXL3	HTRA2	O43464	677
LOXL3	ELN	P15502	677
LOXL3	FBLN5	Q9UBX5	629
LOXL3	SNAI1	O95863	528
LOXL3	GATA6	P78327	469
LOXL3	COL9A2	Q14055	445
LOXL3	COL9A1	P20849	419
LOXL3	ALDOA	P04075	414
LOXL3	J3KPS3	J3KPS3	411
LOXL3	ASS1	P00966	411
LOXL3	ANXA5	P08758	409
LOXL3	COL11A1	P12107	403
LOXL3	COL9A3	Q14050	399
LOXL3	COL11A2	P13942	381

IntAct

19 interactions, top by confidence:

A	B	Type	Score
FANCG	FANCA	psi-mi:“MI:0914”(association)	0.960
CLINT1	PIK3C2A	psi-mi:“MI:0914”(association)	0.530
FBXO2	TMEM131L	psi-mi:“MI:0914”(association)	0.530
LOXL3	FN1	psi-mi:“MI:0945”(oxidoreductase activity electron transfer reaction)	0.440
APP	LOXL3	psi-mi:“MI:0407”(direct interaction)	0.440
LOXL3	Adamtsl2	psi-mi:“MI:0915”(physical association)	0.400
LOXL3	GATAD2B	psi-mi:“MI:0915”(physical association)	0.400
IGFL3	CBX4	psi-mi:“MI:0914”(association)	0.350
DEFB136	MANBA	psi-mi:“MI:0914”(association)	0.350
LOXL3	MSI1	psi-mi:“MI:0914”(association)	0.350
C1orf54	QSOX1	psi-mi:“MI:0914”(association)	0.350
C1QA	VWA8	psi-mi:“MI:0914”(association)	0.350
CLGN	TMEM131L	psi-mi:“MI:0914”(association)	0.350
IL12RB1	PLAU	psi-mi:“MI:0914”(association)	0.350
PRG3	IGLL5	psi-mi:“MI:0914”(association)	0.350
APMAP	LOXL3	psi-mi:“MI:0915”(physical association)	0.000

BioGRID (33): EDEM1 (Affinity Capture-MS), LOXL3 (Affinity Capture-MS), MSI1 (Affinity Capture-MS), SUFU (Affinity Capture-MS), RPL23 (Affinity Capture-MS), HSPA5 (Affinity Capture-MS), VPS26B (Affinity Capture-MS), SENP5 (Affinity Capture-MS), MSI2 (Affinity Capture-MS), LTBP1 (Affinity Capture-MS), KDELC1 (Affinity Capture-MS), LTBP1 (Affinity Capture-MS), LOXL3 (Affinity Capture-MS), LOXL3 (Affinity Capture-MS), RPL23 (Affinity Capture-MS)

ESM2 similar proteins: A1L0T3, A1L4H1, D3ZTE0, G3V801, O08762, O43866, O75636, O95428, O97507, P00748, P22457, P56730, P58215, P69525, P69526, P85521, P98140, Q02853, Q04756, Q04962, Q24K22, Q2VL90, Q2VLG4, Q2VLG6, Q2VLH6, Q499S5, Q4G0T1, Q5G265, Q5G268, Q5G269, Q5G270, Q5G271, Q5IJ48, Q6QNF4, Q70UZ7, Q769J6, Q76LX8, Q7Z410, Q80YA8, Q80YC5

Diamond homologs: A1L0T3, A1L1V4, A1L4H1, A5PJQ2, A6H737, A7E3W2, B4F6N6, B5DF27, B8A4W9, E1C3U7, F1QQC3, F1RD85, F7J220, G3V801, M9NDE3, O08762, O43866, O70513, P21757, P21758, P30203, P30204, P30205, P56730, P58022, P58215, P70117, P85521, Q05585, Q07797, Q08380, Q08B63, Q14DK5, Q24JV9, Q2VL90, Q2VLG4, Q2VLG6, Q2VLH6, Q4A3R3, Q4G0T1

SIGNOR signaling

0 interactions.

Disease & clinical

Clinical variants and AI predictions

ClinVar

395 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	3
Likely pathogenic	1
Uncertain significance	194
Likely benign	173
Benign	11

Top pathogenic / likely-pathogenic (4)

Variant ID	HGVS	Classification
1810228	NM_032603.5(LOXL3):c.449delinsAA (p.Pro150fs)	Pathogenic
2191065	NM_032603.5(LOXL3):c.956G>A (p.Arg319Gln)	Pathogenic
372209	NM_013247.5(HTRA2):c.1211G>A (p.Arg404Gln)	Pathogenic
3897710	NM_032603.5(LOXL3):c.313+1G>T	Likely pathogenic

SpliceAI

3165 predictions. Top by Δscore:

Variant	Effect	Δscore
2:74532614:TTCA:T	acceptor_loss	1.0000
2:74532615:TCAG:T	acceptor_loss	1.0000
2:74532616:CA:C	acceptor_loss	1.0000
2:74532617:A:AC	acceptor_loss	1.0000
2:74532617:A:AG	acceptor_gain	1.0000
2:74532618:G:GC	acceptor_gain	1.0000
2:74532618:G:GT	acceptor_loss	1.0000
2:74532618:GC:G	acceptor_gain	1.0000
2:74532618:GCAT:G	acceptor_gain	1.0000
2:74532618:GCATC:G	acceptor_gain	1.0000
2:74532712:CCGG:C	donor_loss	1.0000
2:74532715:G:GC	donor_loss	1.0000
2:74532716:T:G	donor_loss	1.0000
2:74532720:G:GT	donor_gain	1.0000
2:74532814:CTATA:C	acceptor_loss	1.0000
2:74532815:TATA:T	acceptor_loss	1.0000
2:74532816:ATAG:A	acceptor_gain	1.0000
2:74532816:ATAGG:A	acceptor_gain	1.0000
2:74532817:T:G	acceptor_gain	1.0000
2:74532818:A:AG	acceptor_gain	1.0000
2:74532818:AG:A	acceptor_gain	1.0000
2:74532818:AGG:A	acceptor_gain	1.0000
2:74532819:G:A	acceptor_loss	1.0000
2:74532819:G:GA	acceptor_gain	1.0000
2:74532819:GG:G	acceptor_gain	1.0000
2:74532819:GGG:G	acceptor_gain	1.0000
2:74532819:GGGC:G	acceptor_gain	1.0000
2:74532819:GGGCT:G	acceptor_gain	1.0000
2:74533855:T:TA	donor_gain	1.0000
2:74533869:T:TA	donor_gain	1.0000

AlphaMissense

4935 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
2:74533889:G:C	C727W	1.000
2:74533891:A:G	C727R	1.000
2:74533933:A:G	C713R	1.000
2:74534142:C:A	W678C	1.000
2:74534142:C:G	W678C	1.000
2:74534144:A:G	W678R	1.000
2:74534144:A:T	W678R	1.000
2:74534148:A:C	C676W	1.000
2:74534149:C:A	C676F	1.000
2:74534149:C:G	C676S	1.000
2:74534149:C:T	C676Y	1.000
2:74534150:A:G	C676R	1.000
2:74534150:A:T	C676S	1.000
2:74534178:G:C	C666W	1.000
2:74534179:C:G	C666S	1.000
2:74534179:C:T	C666Y	1.000
2:74534180:A:G	C666R	1.000
2:74534180:A:T	C666S	1.000
2:74534215:C:G	C654S	1.000
2:74534216:A:G	C654R	1.000
2:74534216:A:T	C654S	1.000
2:74534341:A:C	C638W	1.000
2:74534342:C:G	C638S	1.000
2:74534342:C:T	C638Y	1.000
2:74534343:A:G	C638R	1.000
2:74534343:A:T	C638S	1.000
2:74534344:G:C	F637L	1.000
2:74534344:G:T	F637L	1.000
2:74534345:A:C	F637C	1.000
2:74534346:A:G	F637L	1.000

dbSNP variants (sampled 300 via entrez): RS1000345055 (2:74546922 G>A), RS1000411198 (2:74549094 G>A,T), RS1000548501 (2:74548678 T>C), RS1000769339 (2:74541859 T>C), RS1001007749 (2:74552979 G>A), RS1001111136 (2:74554942 G>A,T), RS1001196502 (2:74537005 C>G), RS1001213498 (2:74540896 C>G,T), RS1001248651 (2:74536666 C>A,T), RS1001411668 (2:74550549 T>C), RS1001517512 (2:74549934 C>G), RS1001805028 (2:74544026 G>A), RS1001809605 (2:74554421 T>TGGCTTTCACTCTGACGTCAC), RS1002131803 (2:74553321 G>A), RS1002194104 (2:74538378 G>A,C)

Disease associations

OMIM: gene MIM:607163 | disease phenotypes: MIM:619781, MIM:108300, MIM:256000, MIM:610297, MIM:617248

GenCC curated gene-disease

Disease	Classification	Inheritance
myopia 28, autosomal recessive	Strong	Autosomal recessive
Stickler syndrome	Moderate	Autosomal recessive
autosomal recessive Stickler syndrome	Supportive	Autosomal recessive

Mondo (7): myopia 28, autosomal recessive (MONDO:0030697), Stickler syndrome type 1 (MONDO:0007160), Leigh syndrome (MONDO:0009723), Parkinson disease 13, autosomal dominant, susceptibility to (MONDO:0012466), 3-methylglutaconic aciduria type 8 (MONDO:0044723), Stickler syndrome (MONDO:0019354), (MONDO:0016647)

Orphanet (5): Stickler syndrome (Orphanet:828), Stickler syndrome type 1 (Orphanet:90653), Leigh syndrome (Orphanet:506), Young-onset Parkinson disease (Orphanet:2828), 3-methylglutaconic aciduria type 8 (Orphanet:505208)

HPO phenotypes

25 total (25 of 25 shown, HPO-id order):

HPO	Term
HP:0000007	Autosomal recessive inheritance
HP:0000175	Cleft palate
HP:0000218	High palate
HP:0000272	Malar flattening
HP:0000347	Micrognathia
HP:0000407	Sensorineural hearing impairment
HP:0000518	Cataract
HP:0000541	Retinal detachment
HP:0000545	Myopia
HP:0000926	Platyspondyly
HP:0001382	Joint hypermobility
HP:0002650	Scoliosis
HP:0002655	Spondyloepiphyseal dysplasia
HP:0002656	Epiphyseal dysplasia
HP:0002829	Arthralgia
HP:0003301	Irregular vertebral endplates
HP:0004327	Abnormal vitreous humor morphology
HP:0005930	Abnormal epiphysis morphology
HP:0006429	Broad femoral neck
HP:0007773	Vitreoretinopathy
HP:0007992	Lattice retinal degeneration
HP:0011003	High myopia
HP:0011463	Childhood onset
HP:0011800	Midface retrusion
HP:0012368	Flat face

GWAS associations

0 associations (top):

MeSH disease descriptors (3)

Descriptor	Name	Tree numbers
D007888	Leigh Disease	C10.228.140.163.100.412; C16.320.565.189.412; C16.320.565.202.810.444; C18.452.132.100.412; C18.452.648.189.412; C18.452.648.202.810.444; C18.452.660.520
C565204	Parkinson Disease 13 (supp.)
C537492	Stickler syndrome, type 1 (supp.)

Drugs & pharmacology

Drug and pharmacology data

Is drug target: yes

ChEMBL targets (1): CHEMBL4105989 (SINGLE PROTEIN)

Molecules with ChEMBL bioactivity

3 molecules (phase ≥1), by development phase (incl. off-target/promiscuous compounds). Patent mentions across the top 20 by phase: 133,533 (via chembl_molecule»patent_compound — counts attach to the compound, not the gene–compound relationship, so off-target/promiscuous molecules can dominate).

Molecule	Name	Phase	Patents
CHEMBL1356238	PYRITHIONE	4	15,582
CHEMBL964	DISULFIRAM	4	38,611
CHEMBL120563	THIRAM	2	79,340

PharmGKB: 1 entry (VIP=true, CPIC=false)

ChEMBL bioactivities

21 potent at pChembl≥5 of 27 total, top 21 by pChembl (potency: 10 = 0.1 nM, 6 = 1 µM).

pChembl	Type	Value	Unit	Molecule
7.80	IC50	16	nM	CHEMBL4457578
7.03	IC50	93	nM	DISULFIRAM
6.96	IC50	110	nM	THIRAM
6.77	IC50	170	nM	CHEMBL1618272
6.67	IC50	214	nM	CHEMBL4068784
6.51	IC50	310	nM	CHEMBL1618272
6.07	IC50	860	nM	CHEMBL4568508
5.93	IC50	1170	nM	CHEMBL4063337
5.91	IC50	1220	nM	CHEMBL4092740
5.91	IC50	1220	nM	CHEMBL4457897
5.90	IC50	1250	nM	CHEMBL4444163
5.89	IC50	1300	nM	CHEMBL4245637
5.86	IC50	1380	nM	CHEMBL4079398
5.68	IC50	2100	nM	CHEMBL4240937
5.42	IC50	3850	nM	CHEMBL4441069
5.41	IC50	3860	nM	CHEMBL4550042
5.30	IC50	5000	nM	CHEMBL4238380
5.30	IC50	5000	nM	CHEMBL4237334
5.17	IC50	6780	nM	CHEMBL4564074
5.17	IC50	6690	nM	CHEMBL4574361
5.03	IC50	9310	nM	CHEMBL4551909

PubChem BioAssay actives

21 with measured affinity, of 44 total; 20 most potent distinct compounds. Largely complementary to BindingDB; screening values are coarse (µM, 4 dp), so sub-nM hits tie at the floor.

Compound	Assay	Type	Value	Unit
1-[(Z)-4-amino-2-fluorobut-2-enyl]-3-[3-(dimethylsulfamoyl)phenyl]-2-methylindole-5-carboxylic acid;hydrochloride	1526684: Inhibition of recombinant C-terminal His-tagged human LOXL3 (1 to 753 residues) expressed in CHO cells using putrescine as substrate preincubated with enzyme for 30 mins followed by substrate addition and measured every 2.5 mins for 30 mins by Amplex-Red oxidation assay	ic50	0.0160	uM
Disulfiram	1399351: Inhibition of recombinant human LOXL3 expressed in CHO cells using diaminopentane as substrate preincubated for 30 mins followed by substrate addition measured after 1 hr by fluorimetric method	ic50	0.0930	uM
dimethylcarbamothioylsulfanyl N,N-dimethylcarbamodithioate	1399351: Inhibition of recombinant human LOXL3 expressed in CHO cells using diaminopentane as substrate preincubated for 30 mins followed by substrate addition measured after 1 hr by fluorimetric method	ic50	0.1100	uM
3-aminopropanenitrile	1399351: Inhibition of recombinant human LOXL3 expressed in CHO cells using diaminopentane as substrate preincubated for 30 mins followed by substrate addition measured after 1 hr by fluorimetric method	ic50	0.1700	uM
(2-chloro-4-pyridinyl)methanamine	1430574: Inhibition of recombinant human C-terminal His10-tagged LOXL3 (1 to 753 residues) assessed as reduction in H2O2 production using DAP as substrate preincubated for 2 hrs followed by substrate addition measured every 2 minutes for 50 minutes by Amplex red dye based fluorescence assay	ic50	0.2140	uM
[5-(3-methylsulfonyl-5-phenylphenyl)sulfonyl-1,3-thiazol-2-yl]methanamine	1604048: Inhibition of recombinant C-terminal His-tagged human LOXL3 (1 to 753 residues) expressed in CHO cells using cadaverine hydrochloride as substrate preincubated for 1 hr followed by substrate addition by ROS-Glo assay	ic50	0.8600	uM
[3-[[4-(aminomethyl)-2-pyridinyl]oxy]phenyl]-[(3R,4R)-3-fluoro-4-hydroxypyrrolidin-1-yl]methanone;hydrochloride	1483222: Inhibition of recombinant human LOXL3 assessed as reduction of H2O2 production from oxidative deamination of DAP preincubated for 2 hrs followed by substrate addition measured every 2 mins for 1 hr by amplex red reagent-based fluorescence assay	ic50	1.1700	uM
[3-[[4-(aminomethyl)-2-pyridinyl]oxy]phenyl]-[(3S,4S)-3-fluoro-4-hydroxypyrrolidin-1-yl]methanone;hydrochloride	1483222: Inhibition of recombinant human LOXL3 assessed as reduction of H2O2 production from oxidative deamination of DAP preincubated for 2 hrs followed by substrate addition measured every 2 mins for 1 hr by amplex red reagent-based fluorescence assay	ic50	1.2200	uM
[5-[3-(1-methylpyrazol-4-yl)-5-methylsulfonylphenyl]sulfonyl-1,3-thiazol-2-yl]methanamine	1604048: Inhibition of recombinant C-terminal His-tagged human LOXL3 (1 to 753 residues) expressed in CHO cells using cadaverine hydrochloride as substrate preincubated for 1 hr followed by substrate addition by ROS-Glo assay	ic50	1.2200	uM
[5-[3-ethyl-5-(1-methylpyrazol-4-yl)phenyl]sulfonyl-1,3-thiazol-2-yl]methanamine	1604048: Inhibition of recombinant C-terminal His-tagged human LOXL3 (1 to 753 residues) expressed in CHO cells using cadaverine hydrochloride as substrate preincubated for 1 hr followed by substrate addition by ROS-Glo assay	ic50	1.2500	uM
4,5-dimethyl-2-phenyl-4H-pyrazol-3-one	1399351: Inhibition of recombinant human LOXL3 expressed in CHO cells using diaminopentane as substrate preincubated for 30 mins followed by substrate addition measured after 1 hr by fluorimetric method	ic50	1.3000	uM
[3-[[4-(aminomethyl)-6-(trifluoromethyl)-2-pyridinyl]oxy]phenyl]-[(3R,4R)-3-fluoro-4-hydroxypyrrolidin-1-yl]methanone;hydrochloride	1483222: Inhibition of recombinant human LOXL3 assessed as reduction of H2O2 production from oxidative deamination of DAP preincubated for 2 hrs followed by substrate addition measured every 2 mins for 1 hr by amplex red reagent-based fluorescence assay	ic50	1.3800	uM
(4Z)-4-(1-ethylquinolin-2-ylidene)-2-phenyl-5-phenyliminopyrazolidin-3-one	1399351: Inhibition of recombinant human LOXL3 expressed in CHO cells using diaminopentane as substrate preincubated for 30 mins followed by substrate addition measured after 1 hr by fluorimetric method	ic50	2.1000	uM
[5-(3-methylsulfonyl-5-phenylphenyl)sulfanyl-1,3-thiazol-2-yl]methanamine	1604048: Inhibition of recombinant C-terminal His-tagged human LOXL3 (1 to 753 residues) expressed in CHO cells using cadaverine hydrochloride as substrate preincubated for 1 hr followed by substrate addition by ROS-Glo assay	ic50	3.8500	uM
[4-(3-methylsulfonyl-5-phenylphenyl)sulfonyl-1,3-thiazol-2-yl]methanamine	1604048: Inhibition of recombinant C-terminal His-tagged human LOXL3 (1 to 753 residues) expressed in CHO cells using cadaverine hydrochloride as substrate preincubated for 1 hr followed by substrate addition by ROS-Glo assay	ic50	3.8600	uM
2-phenyl-6-thiophen-2-yl-1H-pyrazolo[3,4-b]pyridin-3-one	1399351: Inhibition of recombinant human LOXL3 expressed in CHO cells using diaminopentane as substrate preincubated for 30 mins followed by substrate addition measured after 1 hr by fluorimetric method	ic50	5.0000	uM
6-(2,5-dimethylfuran-3-yl)-2-phenyl-1H-pyrazolo[3,4-b]pyridin-3-one	1399351: Inhibition of recombinant human LOXL3 expressed in CHO cells using diaminopentane as substrate preincubated for 30 mins followed by substrate addition measured after 1 hr by fluorimetric method	ic50	5.0000	uM
[4-[3-(1-methylpyrazol-4-yl)-5-methylsulfonylphenyl]sulfonyl-1,3-thiazol-2-yl]methanamine	1604048: Inhibition of recombinant C-terminal His-tagged human LOXL3 (1 to 753 residues) expressed in CHO cells using cadaverine hydrochloride as substrate preincubated for 1 hr followed by substrate addition by ROS-Glo assay	ic50	6.6900	uM
[5-(3-ethyl-5-phenylphenyl)sulfonyl-1,3-thiazol-2-yl]methanamine	1604048: Inhibition of recombinant C-terminal His-tagged human LOXL3 (1 to 753 residues) expressed in CHO cells using cadaverine hydrochloride as substrate preincubated for 1 hr followed by substrate addition by ROS-Glo assay	ic50	6.7800	uM
[5-(3-methylsulfonyl-5-phenylphenyl)-1,3-thiazol-2-yl]methanamine	1604048: Inhibition of recombinant C-terminal His-tagged human LOXL3 (1 to 753 residues) expressed in CHO cells using cadaverine hydrochloride as substrate preincubated for 1 hr followed by substrate addition by ROS-Glo assay	ic50	9.3100	uM

CTD chemical–gene interactions

31 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Valproic Acid	increases expression, affects expression, decreases expression	3
Tetrachlorodibenzodioxin	increases expression	2
deoxynivalenol	decreases expression	1
tris(2-butoxyethyl) phosphate	affects expression	1
arsenite	affects expression	1
mono-(2-ethylhexyl)phthalate	affects methylation, increases abundance	1
tris(1,3-dichloro-2-propyl)phosphate	decreases expression	1
sodium arsenite	decreases expression	1
monobutyl phthalate	decreases methylation, increases abundance	1
chromium hexavalent ion	increases expression	1
CGP 52608	affects binding, increases reaction	1
abrine	increases expression	1
(+)-JQ1 compound	decreases expression	1
Irinotecan	decreases expression	1
Sunitinib	decreases expression	1
Glyphosate	increases expression	1
Atrazine	increases expression	1
Benzo(a)pyrene	decreases methylation, increases methylation	1
Carbamazepine	affects expression	1
Dexamethasone	decreases expression	1
Estradiol	increases expression	1
Niclosamide	increases expression	1
Phthalic Acids	decreases methylation, increases abundance	1
Silicon Dioxide	increases expression	1
Smoke	decreases expression	1
Thiram	decreases expression	1
Tretinoin	increases expression	1
Tunicamycin	decreases expression	1
2,4-Dichlorophenoxyacetic Acid	increases expression	1
Cadmium Chloride	decreases expression	1

ChEMBL screening assays

6 unique, capped per target: 6 binding

Representative assays (with source publication via chembl_document):

Assay ID	Type	Description	Source paper
CHEMBL3997548	Binding	Inhibition of recombinant human C-terminal His10-tagged LOXL3 (1 to 753 residues) assessed as reduction in H2O2 production using DAP as substrate preincubated for 2 hrs followed by substrate addition measured every 2 minutes for 50 minutes	Small Molecule Lysyl Oxidase-like 2 (LOXL2) Inhibitors: The Identification of an Inhibitor Selective for LOXL2 over LOX. — ACS Med Chem Lett

Clinical trials (associated diseases)

18 trials via MONDO — disease-level, not drug-specific.

Trial	Phase	Status	Title
NCT04465188	PHASE2	WITHDRAWN	Scleral Buckling for Retinal Detachment Prevention in Genetically Confirmed Stickler Syndrome
NCT01721733	PHASE2	COMPLETED	Safety and Efficacy Study of EPI-743 in Children With Leigh Syndrome
NCT02352896	PHASE2	COMPLETED	Long-Term Safety and Efficacy Evaluation of EPI-743 in Children With Leigh Syndrome
NCT03747328	PHASE2	WITHDRAWN	ABI-009 (Nab-sirolimus) in Patients With Genetically-confirmed Leigh or Leigh-like Syndrome
NCT06843811	PHASE2	ENROLLING_BY_INVITATION	Sirolimus for Leigh Syndrome
NCT06990984	PHASE2	NOT_YET_RECRUITING	A Dose-ranging Study of TTI-0102 in Adults and Children With Leigh Syndrome Spectrum (LSS)
NCT02544217	PHASE1	COMPLETED	A Dose-escalating Clinical Trial With KH176
NCT00270686	Not specified	COMPLETED	Studies of Heritable Disorders of Connective Tissue
NCT01793168	Not specified	RECRUITING	Rare Disease Patient Registry & Natural History Study - Coordination of Rare Diseases at Sanford
NCT03655223	Not specified	ENROLLING_BY_INVITATION	Early Check: Expanded Screening in Newborns
NCT07146516	Not specified	RECRUITING	Retinal Detachment Prevention (Laser Prophylaxis) in Stickler Syndrome (SS)
NCT04378075	PHASE2/PHASE3	TERMINATED	A Study to Evaluate Efficacy and Safety of Vatiquinone for Treating Mitochondrial Disease in Participants With Refractory Epilepsy
NCT01780168	Not specified	RECRUITING	The NIH MINI Study: Metabolism, Infection, and Immunity in Inborn Errors of Metabolism
NCT01803906	Not specified	ENROLLING_BY_INVITATION	Tissue Sample Study for Mitochondrial Disorders
NCT03137355	Not specified	RECRUITING	The International Registry for Leigh Syndrome
NCT05277363	Not specified	WITHDRAWN	A Study of the Natural Course of SURF1 Deficiency
NCT05554835	Not specified	RECRUITING	Global Registry and Natural History Study for Mitochondrial Disorders
NCT06967831	Not specified	RECRUITING	Drug Repurposing for Mitochondrial Disorders Using iPSCs Derived Neural Cells