LRRC10B

Summary

LRRC10B (leucine rich repeat containing 10B, HGNC:37215) is a protein-coding gene on chromosome 11q12.2, encoding Leucine-rich repeat-containing protein 10B (A6NIK2).

At a glance

• GWAS associations: 17
• Clinical variants (ClinVar): 62 total
• MANE Select transcript: NM_001145077

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:37215
Approved symbol	LRRC10B
Name	leucine rich repeat containing 10B
Location	11q12.2
Locus type	gene with protein product
Status	Approved
Ensembl gene	ENSG00000204950
Ensembl biotype	protein_coding
Entrez	390205

Gene structure

Transcript identifiers

Ensembl transcripts: 1 — 1 protein_coding

ENST00000378075

RefSeq mRNA: 1 — MANE Select: NM_001145077 NM_001145077

CCDS: CCDS44621

Canonical transcript exons

ENST00000378075 — 1 exons

Exon	Start	End
ENSE00001476176	61508749	61511018

Expression profiles

Bgee: expression breadth ubiquitous, 162 present calls, max score 99.02.

FANTOM5 (CAGE): breadth broad, TPM avg 1.0873 / max 109.8006, expressed in 345 samples.

FANTOM5 promoters (2 alternative TSS)

Promoter ID	TPM avg	Samples expressed
114589	1.0243	341
114588	0.0630	25

Top tissues by expression

246 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
bronchial epithelial cell	CL:0002328	99.02	gold quality
bronchus	UBERON:0002185	98.58	gold quality
right uterine tube	UBERON:0001302	95.67	gold quality
nasal cavity epithelium	UBERON:0005384	94.29	gold quality
putamen	UBERON:0001874	93.95	gold quality
mucosa of paranasal sinus	UBERON:0005030	93.09	gold quality
caudate nucleus	UBERON:0001873	92.87	gold quality
olfactory segment of nasal mucosa	UBERON:0005386	92.78	gold quality
cardiac muscle of right atrium	UBERON:0003379	91.99	gold quality
left ventricle myocardium	UBERON:0006566	91.18	gold quality
nucleus accumbens	UBERON:0001882	91.14	gold quality
caput epididymis	UBERON:0004358	87.98	gold quality
trachea	UBERON:0003126	87.21	gold quality
pituitary gland	UBERON:0000007	86.93	gold quality
myocardium	UBERON:0002349	86.85	gold quality
lateral globus pallidus	UBERON:0002476	85.94	silver quality
nasal cavity mucosa	UBERON:0001826	85.37	gold quality
adenohypophysis	UBERON:0002196	84.91	gold quality
epithelium of nasopharynx	UBERON:0001951	84.73	gold quality
oviduct epithelium	UBERON:0004804	84.51	gold quality
fallopian tube	UBERON:0003889	83.21	gold quality
kidney epithelium	UBERON:0004819	81.66	gold quality
parotid gland	UBERON:0001831	81.59	silver quality
ventricular zone	UBERON:0003053	80.48	gold quality
vena cava	UBERON:0004087	80.18	gold quality
popliteal artery	UBERON:0002250	80.12	gold quality
tibial artery	UBERON:0007610	80.10	gold quality
ganglionic eminence	UBERON:0004023	79.52	gold quality
forebrain	UBERON:0001890	78.57	gold quality
Ammon’s horn	UBERON:0001954	78.54	gold quality

Single-cell (SCXA)

Detected in 1 experiment(s), a significant marker in 1.

Experiment	Marker?	Max mean expression
E-ANND-3	yes	8.61

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

63 targeting LRRC10B, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-6873-3P	100.00	71.42	2626
HSA-MIR-7110-3P	100.00	73.18	2486
HSA-MIR-515-5P	99.92	69.82	2343
HSA-MIR-519E-5P	99.92	69.62	2358
HSA-MIR-137-3P	99.87	74.74	2401
HSA-MIR-4447	99.85	67.81	2900
HSA-MIR-6756-5P	99.82	67.97	2466
HSA-MIR-3133	99.81	70.92	3506
HSA-MIR-4659A-3P	99.80	72.62	4248
HSA-MIR-4659B-3P	99.80	72.62	4248
HSA-MIR-6817-3P	99.79	68.35	2126
HSA-MIR-4319	99.76	69.83	2586
HSA-MIR-1255A	99.74	68.09	744
HSA-MIR-1255B-5P	99.74	68.16	741
HSA-MIR-670-5P	99.67	69.94	1565
HSA-MIR-4441	99.49	66.56	3216
HSA-MIR-5695	99.41	67.48	1047
HSA-MIR-942-5P	99.41	68.40	1977
HSA-MIR-103A-2-5P	99.39	67.72	1577
HSA-MIR-125A-5P	99.36	70.59	1640
HSA-MIR-125B-5P	99.36	70.36	1662
HSA-MIR-4641	99.28	66.64	744
HSA-MIR-4505	99.27	67.81	2678
HSA-MIR-149-5P	99.25	67.16	1315
HSA-MIR-5693	99.24	66.67	1106
HSA-MIR-7974	99.24	65.48	1137
HSA-MIR-4477B	99.23	70.49	1733
HSA-MIR-5787	99.22	67.86	2628
HSA-MIR-6815-3P	99.13	68.98	1530
HSA-MIR-4758-3P	99.12	63.96	869

Literature-anchored findings (GeneRIF, showing 1)

• LRRC10B may be a downstream gene regulated by RPLP0P2 (PMID:27460542)

Cross-species orthologs

2 orthologs

Organism	Symbol	Gene ID
mus_musculus	Lrrc10b	ENSMUSG00000090291
rattus_norvegicus	Lrrc10b	ENSRNOG00000030180

Paralogs (31): LRRC7 (ENSG00000033122), PHLPP2 (ENSG00000040199), LRRC40 (ENSG00000066557), LRCH4 (ENSG00000077454), PHLPP1 (ENSG00000081913), SHOC2 (ENSG00000108061), ERBIN (ENSG00000112851), LRRC39 (ENSG00000122477), LRCH2 (ENSG00000130224), LRCH1 (ENSG00000136141), LRRC8A (ENSG00000136802), LRRC1 (ENSG00000137269), MFHAS1 (ENSG00000147324), LRRC27 (ENSG00000148814), LRRK1 (ENSG00000154237), LRRC58 (ENSG00000163428), LRRC2 (ENSG00000163827), LRRC18 (ENSG00000165383), LRRC28 (ENSG00000168904), LRRC8E (ENSG00000171017), LRRC8C (ENSG00000171488), LRRC8D (ENSG00000171492), PIDD1 (ENSG00000177595), SCRIB (ENSG00000180900), LRCH3 (ENSG00000186001), LRRIQ4 (ENSG00000188306), LRRC8B (ENSG00000197147), LRRC10 (ENSG00000198812), LRRC30 (ENSG00000206422), LRRC69 (ENSG00000214954), LRRD1 (ENSG00000240720)

Protein

Protein identifiers

Leucine-rich repeat-containing protein 10B — A6NIK2 (reviewed: A6NIK2)

All UniProt accessions (1): A6NIK2

RefSeq proteins (1): NP_001138549* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR001611	Leu-rich_rpt	Repeat
IPR003591	Leu-rich_rpt_typical-subtyp	Repeat
IPR032675	LRR_dom_sf	Homologous_superfamily
IPR050216	LRR_domain-containing	Family

Pfam: PF13855

UniProt features (13 total): repeat 9, region of interest 2, chain 1, compositionally biased region 1

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-A6NIK2-F1	84.82	0.70

Function

Pathways and Gene Ontology

Reactome pathways

0 pathways

MSigDB gene sets: 53 (showing top): SENGUPTA_NASOPHARYNGEAL_CARCINOMA_DN, GRYDER_PAX3FOXO1_ENHANCERS_IN_TADS, GRYDER_PAX3FOXO1_TOP_ENHANCERS, DODD_NASOPHARYNGEAL_CARCINOMA_DN, GRYDER_PAX3FOXO1_ENHANCERS_KO_DOWN, LMTK3_TARGET_GENES, ZNF10_TARGET_GENES, MIR7110_3P, MIR6873_3P, CREIGHTON_ENDOCRINE_THERAPY_RESISTANCE_2, MIR4319, MIR519E_5P, MIR515_5P, MIR125B_5P, MIR125A_5P

GO Biological Process (0):

GO Molecular Function (1): protein binding (GO:0005515)

GO Cellular Component (0):

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
binding	1

Protein interactions and networks

STRING

852 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
LRRC10B	TMEM218	A2RU14	439
LRRC10B	GPR88	Q9GZN0	420
LRRC10B	SYNDIG1L	A6NDD5	414
LRRC10B	SYT7	O43581	400
LRRC10B	C3orf70	A6NLC5	399
LRRC10B	CPNE5	Q9HCH3	387
LRRC10B	KLHDC8A	Q8IYD2	387
LRRC10B	ESPNL	Q6ZVH7	386
LRRC10B	CREG2	Q8IUH2	375
LRRC10B	CRYM	Q14894	370
LRRC10B	DDN	O94850	359
LRRC10B	CPNE4	Q96A23	359
LRRC10B	PLCXD2	Q0VAA5	357
LRRC10B	PRDM6	Q9NQX0	351
LRRC10B	ELFN2	Q5R3F8	350

IntAct

0 interactions, top by confidence:

BioGRID (5): LRRC10B (Negative Genetic), LRRC10B (Affinity Capture-MS), LRRC10B (Affinity Capture-MS), LRRC10B (Affinity Capture-MS), LRRC10B (Affinity Capture-MS)

ESM2 similar proteins: A0A8P0N4K0, A5YM72, A6NIK2, A6NIX2, D3KCC4, D3Z7H8, D3ZU57, O08742, O43822, O75427, O95382, P40197, Q02779, Q13470, Q14160, Q149C3, Q15653, Q16584, Q24K06, Q32P44, Q3UGP9, Q505F5, Q5BKY1, Q5I2M8, Q5RKR3, Q5U651, Q66HA1, Q6EMK4, Q6NSJ5, Q6UXK2, Q6UY18, Q76KP1, Q80U72, Q80XI6, Q80ZD5, Q86WK7, Q8C013, Q8K3W2, Q8N1G4, Q8WUA8

Diamond homologs: A6NIK2, Q24K06, Q5BKY1, Q8K3W2, O74874, Q9C2R2

SIGNOR signaling

0 interactions.

Disease & clinical

Clinical variants and AI predictions

ClinVar

62 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	61
Likely benign	1
Benign	0

Top pathogenic / likely-pathogenic (0)

SpliceAI

124 predictions. Top by Δscore:

Variant	Effect	Δscore
11:61509782:G:GT	donor_gain	0.9800
11:61509851:G:GT	donor_gain	0.9800
11:61509779:G:GT	donor_gain	0.9600
11:61509770:GA:G	donor_gain	0.9200
11:61509864:GAC:G	donor_gain	0.9200
11:61509776:G:GT	donor_gain	0.8300
11:61509870:GCACC:G	donor_gain	0.7900
11:61509917:G:GT	donor_gain	0.7200
11:61509929:G:GT	donor_gain	0.6800
11:61509798:G:GT	donor_gain	0.6700
11:61509771:A:G	donor_gain	0.6400
11:61510547:A:AG	acceptor_gain	0.5800
11:61510548:G:GG	acceptor_gain	0.5800
11:61509878:GCC:G	donor_gain	0.5700
11:61509761:GCCTT:G	donor_gain	0.5600
11:61509880:C:G	donor_gain	0.5200
11:61509865:A:T	donor_gain	0.5000
11:61509944:T:A	donor_gain	0.4600
11:61508826:G:GG	donor_gain	0.4500
11:61510544:C:T	acceptor_gain	0.4400
11:61510545:C:CA	acceptor_gain	0.4400
11:61509142:GCT:G	donor_gain	0.4100
11:61510575:CTG:C	acceptor_gain	0.4100
11:61510577:G:GC	acceptor_gain	0.4100
11:61509851:G:T	donor_gain	0.4000
11:61510578:G:GA	acceptor_gain	0.4000
11:61510598:C:CG	acceptor_gain	0.3900
11:61510050:T:TA	donor_gain	0.3800
11:61510051:A:AA	donor_gain	0.3800
11:61509080:C:G	donor_gain	0.3700

AlphaMissense

1834 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
11:61509367:C:A	N123K	0.999
11:61509367:C:G	N123K	0.999
11:61509420:T:A	L141H	0.999
11:61509436:C:A	N146K	0.999
11:61509436:C:G	N146K	0.999
11:61509504:A:T	N169I	0.999
11:61509505:C:A	N169K	0.999
11:61509505:C:G	N169K	0.999
11:61509567:A:T	D190V	0.999
11:61509222:A:T	D75V	0.998
11:61509420:T:C	L141P	0.998
11:61509428:G:T	G144C	0.998
11:61509429:G:T	G144V	0.998
11:61509435:A:T	N146I	0.998
11:61509480:T:C	L161S	0.998
11:61509558:T:A	L187H	0.998
11:61509573:A:T	N192I	0.998
11:61509624:T:C	F209S	0.998
11:61509633:A:T	D212V	0.998
11:61509640:C:A	N214K	0.998
11:61509640:C:G	N214K	0.998
11:61509687:G:T	G230V	0.998
11:61509273:T:A	L92H	0.997
11:61509297:A:T	N100I	0.997
11:61509298:C:A	N100K	0.997
11:61509298:C:G	N100K	0.997
11:61509351:T:A	L118H	0.997
11:61509360:A:T	E121V	0.997
11:61509428:G:C	G144R	0.997
11:61509480:T:G	L161W	0.997

dbSNP variants (sampled 300 via entrez): RS1000818697 (11:61509722 G>A,C,T), RS1000872709 (11:61510061 C>G), RS1001139183 (11:61510542 C>T), RS1002140019 (11:61508629 T>C), RS1002278898 (11:61509395 C>A), RS1002804317 (11:61509728 ACGCCCCGGCCTC>A,ACGCCCCGGCCTCCGCCCCGGCCTC), RS1002846853 (11:61509928 G>T), RS1003274709 (11:61508760 G>A,C), RS1003287241 (11:61507310 C>T), RS1003589247 (11:61508565 T>C,G), RS1007075561 (11:61511235 G>A), RS1007085600 (11:61510564 C>T), RS1007219991 (11:61509444 G>A), RS1007419395 (11:61508990 C>A,G,T), RS1008885448 (11:61508126 G>A)

Disease associations

OMIM: gene `` | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

17 associations (top):

Study	Trait	p-value
GCST003275_5	Mean arterial pressure	8.000000e-12
GCST004776_60	Systolic blood pressure	2.000000e-06
GCST004777_26	Diastolic blood pressure	2.000000e-09
GCST006166_5	Diastolic blood pressure x alcohol consumption interaction (2df test)	2.000000e-25
GCST006167_1	Mean arterial pressure x alcohol consumption interaction (2df test)	1.000000e-13
GCST006187_33	Diastolic blood pressure (cigarette smoking interaction)	2.000000e-24
GCST006188_12	Systolic blood pressure (cigarette smoking interaction)	1.000000e-17
GCST006258_37	Diastolic blood pressure	4.000000e-20
GCST006259_20	Systolic blood pressure	4.000000e-09
GCST007094_104	Diastolic blood pressure	8.000000e-16
GCST007099_122	Systolic blood pressure	4.000000e-08
GCST007703_112	Systolic blood pressure	4.000000e-07
GCST007704_42	Diastolic blood pressure	1.000000e-07
GCST007706_68	Mean arterial pressure	3.000000e-08
GCST007707_78	Hypertension	5.000000e-07
GCST007930_162	Medication use (agents acting on the renin-angiotensin system)	8.000000e-10
GCST010866_81	Coronary artery disease	4.000000e-08

EFO canonical traits (6, from GWAS)

EFO ID	Trait name
EFO:0006340	mean arterial pressure
EFO:0006335	systolic blood pressure
EFO:0006336	diastolic blood pressure
EFO:0004329	alcohol drinking
EFO:0006527	smoking status measurement
EFO:0009931	Agents acting on the renin-angiotensin system use measurement

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

17 total (human), top 17 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Valproic Acid	affects cotreatment, increases expression, affects expression, increases methylation	5
bisphenol A	affects cotreatment, decreases methylation, decreases expression	2
butyraldehyde	increases expression	1
pentanal	increases expression	1
4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	affects cotreatment, increases expression	1
belinostat	decreases expression	1
dorsomorphin	affects cotreatment, increases expression	1
Fulvestrant	affects cotreatment, decreases methylation	1
Vorinostat	decreases expression	1
Air Pollutants	increases abundance, increases expression	1
Benzo(a)pyrene	affects methylation, increases methylation	1
Diethylhexyl Phthalate	decreases expression	1
Smoke	increases expression, increases abundance	1
Tobacco Smoke Pollution	decreases expression	1
Triclosan	decreases expression	1
Gold Compounds	decreases expression, increases methylation	1
Acrylamide	decreases expression	1

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.