LRRC4

Summary

LRRC4 (leucine rich repeat containing 4, HGNC:15586) is a protein-coding gene on chromosome 7q32.1, encoding Leucine-rich repeat-containing protein 4 (Q9HBW1). Synaptic adhesion protein.

Predicted to be involved in modulation of chemical synaptic transmission and synapse organization. Predicted to act upstream of or within synapse organization. Predicted to be located in dendritic spine; excitatory synapse; and postsynaptic membrane. Predicted to be active in Schaffer collateral - CA1 synapse; glutamatergic synapse; and postsynaptic density membrane.

Source: NCBI Gene 64101 — RefSeq curated summary.

At a glance

• GWAS associations: 7
• Clinical variants (ClinVar): 83 total
• MANE Select transcript: NM_022143

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:15586
Approved symbol	LRRC4
Name	leucine rich repeat containing 4
Location	7q32.1
Locus type	gene with protein product
Status	Approved
Aliases	NAG14, NGL-2
Ensembl gene	ENSG00000128594
Ensembl biotype	protein_coding
OMIM	610486
Entrez	64101

Gene structure

Transcript identifiers

Ensembl transcripts: 5 — 5 protein_coding

ENST00000249363, ENST00000476782, ENST00000478726, ENST00000494115, ENST00000944855

RefSeq mRNA: 1 — MANE Select: NM_022143 NM_022143

CCDS: CCDS5799

Canonical transcript exons

ENST00000249363 — 2 exons

Exon	Start	End
ENSE00001122978	128027071	128030740
ENSE00001858996	128030913	128031437

Expression profiles

Bgee: expression breadth ubiquitous, 197 present calls, max score 93.68.

FANTOM5 (CAGE): breadth broad, TPM avg 3.0558 / max 103.9666, expressed in 630 samples.

FANTOM5 promoters (7 alternative TSS)

Promoter ID	TPM avg	Samples expressed
86044	1.1626	388
86046	0.5327	150
86045	0.4474	175
86043	0.3505	157
86042	0.3177	156
86040	0.1398	65
86041	0.1051	50

Top tissues by expression

251 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
ventricular zone	UBERON:0003053	93.68	gold quality
cortical plate	UBERON:0005343	93.41	gold quality
prefrontal cortex	UBERON:0000451	91.09	gold quality
right frontal lobe	UBERON:0002810	90.74	gold quality
bronchial epithelial cell	CL:0002328	89.98	gold quality
frontal cortex	UBERON:0001870	89.86	gold quality
dorsolateral prefrontal cortex	UBERON:0009834	89.86	gold quality
Brodmann (1909) area 9	UBERON:0013540	89.51	gold quality
right hemisphere of cerebellum	UBERON:0014890	89.47	gold quality
neocortex	UBERON:0001950	89.39	gold quality
cerebellar cortex	UBERON:0002129	89.39	gold quality
cerebellar hemisphere	UBERON:0002245	89.35	gold quality
cerebellum	UBERON:0002037	89.13	gold quality
bronchus	UBERON:0002185	88.95	gold quality
anterior cingulate cortex	UBERON:0009835	88.02	gold quality
cerebellar vermis	UBERON:0004720	87.70	gold quality
ganglionic eminence	UBERON:0004023	87.63	gold quality
cerebral cortex	UBERON:0000956	87.27	gold quality
Brodmann (1909) area 46	UBERON:0006483	86.80	gold quality
bone marrow cell	CL:0002092	86.02	gold quality
primary visual cortex	UBERON:0002436	85.82	gold quality
postcentral gyrus	UBERON:0002581	85.78	gold quality
superior frontal gyrus	UBERON:0002661	85.27	gold quality
olfactory segment of nasal mucosa	UBERON:0005386	84.69	gold quality
secondary oocyte	CL:0000655	84.56	gold quality
blood	UBERON:0000178	84.46	gold quality
parietal lobe	UBERON:0001872	84.34	gold quality
occipital lobe	UBERON:0002021	84.15	gold quality
primordial germ cell in gonad	CL:0000670 ∩ UBERON:0000991	83.88	gold quality
amygdala	UBERON:0001876	82.93	gold quality

Single-cell (SCXA)

Detected in 1 experiment(s), a significant marker in 1.

Experiment	Marker?	Max mean expression
E-ANND-3	yes	5.41

Regulation

Is transcription factor: yes

Downstream targets (CollecTRI)

6 targets.

Target	Regulation
CCND1	Repression
CCNE1	Repression
CDK2	Repression
CDK4	Repression
CDKN1A	Activation
CDKN1B	Activation

Upstream regulators (CollecTRI, top): TP53

miRNA regulators (miRDB)

103 targeting LRRC4, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-1277-5P	100.00	73.95	5056
HSA-LET-7A-3P	100.00	74.03	3932
HSA-LET-7B-3P	100.00	74.08	3913
HSA-LET-7F-1-3P	100.00	74.02	3928
HSA-MIR-98-3P	100.00	74.08	3907
HSA-MIR-4481	100.00	66.42	1669
HSA-MIR-5011-5P	100.00	83.46	5820
HSA-MIR-548C-3P	99.99	74.01	7587
HSA-MIR-33A-5P	99.99	68.62	1055
HSA-MIR-33B-5P	99.99	68.58	1062
HSA-MIR-3662	99.99	73.82	5684
HSA-MIR-4482-3P	99.98	72.50	3147
HSA-MIR-4745-5P	99.98	65.95	1028
HSA-MIR-32-5P	99.98	75.21	1964
HSA-MIR-92A-3P	99.98	75.21	1960
HSA-MIR-92B-3P	99.98	75.25	1955
HSA-MIR-25-3P	99.98	74.60	1817
HSA-MIR-363-3P	99.98	74.72	1821
HSA-MIR-367-3P	99.98	74.83	1819
HSA-MIR-8068	99.98	73.85	2376
HSA-MIR-607	99.97	73.62	5593
HSA-MIR-9-3P	99.96	70.88	2068
HSA-MIR-590-3P	99.96	74.34	6478
HSA-MIR-4666A-3P	99.96	71.71	3434
HSA-MIR-495-3P	99.96	72.81	4197
HSA-MIR-5688	99.96	73.23	4504
HSA-MIR-3658	99.96	73.87	4379
HSA-MIR-96-5P	99.95	72.80	2140
HSA-LET-7C-3P	99.95	73.42	2862
HSA-MIR-101-3P	99.94	75.03	2230

Literature-anchored findings (GeneRIF, showing 17)

• LRRC4 may play an important role in maintaining normal function and suppressing tumorigenesis in the central nervous system. (PMID:15967442)
• LRRC4 gene might be involved in tumor suppression by restraining DNA synthesis and nucleoli organizer regions-associated proteins. (PMID:16188120)
• these studies represent the first cDNA array analysis of the effects of LRRC4 on the involvement of different neurobiological genes in U251MG glioblastoma cells and provide new insights into the function of LRRC4 in glioma (PMID:16215635)
• LRRC4 plays a major role in suppressing U251 cell proliferation by regulating the extracellular signal-regulated kinase (ERK)/Akt/NF-kappaBp65, STAT3, and JNK2/c-Jun pathways. (PMID:16723503)
• LRRC4 may be a negative regulator of the RPTP-zeta receptor, and contribute to suppressing the invasion ability of gliomas cells (PMID:16941076)
• LRRC4 inhibits glioblastoma cell proliferation, migration, and angiogenesis by downgrading pleiotropic cytokine responses. (PMID:17541939)
• Methylation-mediated inactivation of LRRC4 is a frequent and glioma-specific event. (PMID:18976507)
• As a glioma suppressor, LRRC4 inhibits the endogenous expression of small regulatory microRNA hsa-miR-381 and decreases cell proliferation and tumor growth in cultured glioma cells. (PMID:21435336)
• Potentially, modulation of LRRC4 or STMN1 expression may be useful for design of new therapies for the intervention of glioma (PMID:21809374)
• LRRC4 inhibited the miR-185 pathway function in glioma (PMID:22834685)
• Disturbing miR-182 and -381 inhibits BRD7 transcription and glioma growth by directly targeting LRRC4. (PMID:24404152)
• polymorphisms and haplotypes in the LRRC4 may have a role in pituitary adenoma in a Chinese population (PMID:24563334)
• Results show a strong negative correlation between the expression of miR-381 and LRRC4 in osteosarcoma (OS) tissues, indicating LRRC4 as a direct target gene of miR-381. (PMID:27612424)
• Following EGF stimuli, the D domain of LRRC4 anchors ERK1/2 in the cytoplasm and abrogates ERK1/2 activation and nuclear translocation. (PMID:27884160)
• High LRRC4 expression is associated with Liposarcoma . (PMID:30790560)
• Leucine-rich repeat containing 4 act as an autophagy inhibitor that restores sensitivity of glioblastoma to temozolomide. (PMID:32372061)
• Leucine-rich repeats containing 4 protein (LRRC4) in memory, psychoneurosis, and glioblastoma. (PMID:36780420)

Cross-species orthologs

4 orthologs

Organism	Symbol	Gene ID
danio_rerio	lrrc4.2	ENSDARG00000003020
danio_rerio	lrrc4.1	ENSDARG00000069402
mus_musculus	Lrrc4	ENSMUSG00000049939
rattus_norvegicus	Lrrc4	ENSRNOG00000008098

Paralogs (22): DCN (ENSG00000011465), RTN4R (ENSG00000040608), ASPN (ENSG00000106819), FLRT3 (ENSG00000125848), FLRT1 (ENSG00000126500), LRRC4B (ENSG00000131409), PODNL1 (ENSG00000132000), LRTM1 (ENSG00000144771), LRRC4C (ENSG00000148948), LRRTM1 (ENSG00000162951), LRRC15 (ENSG00000172061), PODN (ENSG00000174348), LRRTM4 (ENSG00000176204), BGN (ENSG00000182492), LRRC19 (ENSG00000184434), FLRT2 (ENSG00000185070), GP1BA (ENSG00000185245), RTN4RL1 (ENSG00000185924), RTN4RL2 (ENSG00000186907), NYX (ENSG00000188937), LRRC66 (ENSG00000188993), LRRTM3 (ENSG00000198739)

Protein

Protein identifiers

Leucine-rich repeat-containing protein 4 — Q9HBW1 (reviewed: Q9HBW1)

Alternative names: Brain tumor-associated protein BAG, Nasopharyngeal carcinoma-associated gene 14 protein, Netrin-G2 ligand

All UniProt accessions (4): Q9HBW1, C9J7K7, C9J7V8, C9JA92

UniProt curated annotations — full annotation on UniProt →

Function. Synaptic adhesion protein. Regulates the formation of exitatory synapses through the recruitment of pre-and-postsynaptic proteins. Organize the lamina/pathway-specific differentiation of dendrites. Plays an important role for auditory synaptic responses. Involved in the suppression of glioma.

Subunit / interactions. Interacts with DLG4. Interacts (via LRR repeats) with NTNG2. Forms a complex with DLG4 and with NMDA receptors.

Subcellular location. Membrane. Postsynaptic cell membrane.

Tissue specificity. Specifically expressed in brain.

Post-translational modifications. N-glycosylated.

Domain organisation. The last 4 C-terminal residues bind to the first 2 PDZ domains of DLG4.

RefSeq proteins (1): NP_071426* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR000372	LRRNT	Domain
IPR000483	Cys-rich_flank_reg_C	Domain
IPR001611	Leu-rich_rpt	Repeat
IPR003591	Leu-rich_rpt_typical-subtyp	Repeat
IPR003598	Ig_sub2	Domain
IPR003599	Ig_sub	Domain
IPR007110	Ig-like_dom	Domain
IPR013098	Ig_I-set	Domain
IPR013783	Ig-like_fold	Homologous_superfamily
IPR032675	LRR_dom_sf	Homologous_superfamily
IPR036179	Ig-like_dom_sf	Homologous_superfamily
IPR050541	LRR_TM_domain-containing	Family

Pfam: PF07679, PF13855

UniProt features (74 total): strand 25, turn 10, repeat 9, glycosylation site 9, disulfide bond 5, sequence conflict 4, domain 3, helix 3, topological domain 2, signal peptide 1, chain 1, transmembrane region 1, sequence variant 1

Structure

Experimental structures (PDB)

2 structures.

PDB	Method	Resolution (Å)
3ZYI	X-RAY DIFFRACTION	2.6
2DL9	SOLUTION NMR

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q9HBW1-F1	76.95	0.59

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Disulfide bonds (5): 46–52, 50–61, 304–329, 306–350, 374–424

Glycosylation sites (9): 277, 322, 363, 388, 410, 434, 440, 447, 450

Function

Pathways and Gene Ontology

Reactome pathways

0 pathways

MSigDB gene sets: 146 (showing top): GOBP_SYNAPSE_ASSEMBLY, AAAYRNCTG_UNKNOWN, GOBP_CELL_CELL_SIGNALING, GOBP_CELL_CELL_ADHESION, GOBP_CELL_JUNCTION_ORGANIZATION, FOSTER_TOLERANT_MACROPHAGE_DN, AAACCAC_MIR140, TGCTGAY_UNKNOWN, GOBP_POSTSYNAPTIC_MEMBRANE_ORGANIZATION, GATA1_01, chr7q32, GOBP_SYNAPTIC_SIGNALING, NKX25_01, GOBP_CELL_JUNCTION_ASSEMBLY, GOCC_NEURON_PROJECTION

GO Biological Process (5): modulation of chemical synaptic transmission (GO:0050804), postsynaptic density protein 95 clustering (GO:0097119), synaptic membrane adhesion (GO:0099560), excitatory synapse assembly (GO:1904861), synapse organization (GO:0050808)

GO Molecular Function (2): cell-cell adhesion mediator activity (GO:0098632), protein binding (GO:0005515)

GO Cellular Component (10): plasma membrane (GO:0005886), dendritic spine (GO:0043197), excitatory synapse (GO:0060076), Schaffer collateral - CA1 synapse (GO:0098685), postsynaptic density membrane (GO:0098839), glutamatergic synapse (GO:0098978), membrane (GO:0016020), neuron spine (GO:0044309), synapse (GO:0045202), postsynaptic membrane (GO:0045211)

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
synapse	3
cell-cell adhesion	2
postsynapse	2
chemical synaptic transmission	1
regulation of trans-synaptic signaling	1
postsynaptic membrane organization	1
protein localization to membrane	1
postsynaptic density organization	1
synapse organization	1
synapse assembly	1
cell junction organization	1
cell adhesion mediator activity	1
binding	1
membrane	1
cell periphery	1
dendrite	1
neuron spine	1
postsynaptic density	1
postsynaptic membrane	1
postsynaptic specialization membrane	1
cellular anatomical structure	1
neuron projection	1
cell junction	1
synaptic membrane	1

Protein interactions and networks

STRING

1278 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
LRRC4	NTNG2	Q96CW9	982
LRRC4	NTNG1	Q9Y2I2	799
LRRC4	DLG4	P78352	660
LRRC4	PTPRS	Q13332	615
LRRC4	RBM28	Q9NW13	535
LRRC4	NLGN2	Q8NFZ4	520
LRRC4	GSTCD	Q8NEC7	499
LRRC4	CCNA1	P78396	496
LRRC4	LRCH4	O75427	476
LRRC4	HSP90AA1	P07900	472
LRRC4	HSP90AB1	P08238	472
LRRC4	CDK2	P24941	465
LRRC4	SND1	Q7KZF4	456
LRRC4	LRRC43	Q8N309	424
LRRC4	PRKCZ	Q05513	416

IntAct

122 interactions, top by confidence:

A	B	Type	Score
NTNG2	LRRC4	psi-mi:“MI:0407”(direct interaction)	0.620
LRRC4	NTNG2	psi-mi:“MI:0407”(direct interaction)	0.620
LRRC4C	DVL2	psi-mi:“MI:0914”(association)	0.530
LRRC4	MAST2	psi-mi:“MI:0407”(direct interaction)	0.440
LRRC4	PDZD7	psi-mi:“MI:0407”(direct interaction)	0.440
SNX27	LRRC4	psi-mi:“MI:0407”(direct interaction)	0.440
LRRC4	WHRN	psi-mi:“MI:0407”(direct interaction)	0.440
LRRC4	PDZK1	psi-mi:“MI:0407”(direct interaction)	0.440
LRRC4	SCRIB	psi-mi:“MI:0407”(direct interaction)	0.440
LRRC4	SNTG2	psi-mi:“MI:0407”(direct interaction)	0.440
LRRC4	SNTB1	psi-mi:“MI:0407”(direct interaction)	0.440
LRRC4	PTPN3	psi-mi:“MI:0407”(direct interaction)	0.440
LRRC4	DLG1	psi-mi:“MI:0407”(direct interaction)	0.440
LRRC4	SNTG1	psi-mi:“MI:0407”(direct interaction)	0.440
LRRC4	SNTA1	psi-mi:“MI:0407”(direct interaction)	0.440
LRRC4	MAGI3	psi-mi:“MI:0407”(direct interaction)	0.440
LRRC4	RHPN1	psi-mi:“MI:0407”(direct interaction)	0.440
DLG4	LRRC4	psi-mi:“MI:0407”(direct interaction)	0.440
LRRC4	SYNJ2BP	psi-mi:“MI:0407”(direct interaction)	0.440
LRRC4	DLG2	psi-mi:“MI:0407”(direct interaction)	0.440
LRRC4	PDZRN4	psi-mi:“MI:0407”(direct interaction)	0.440
LRRC4	DLG3	psi-mi:“MI:0407”(direct interaction)	0.440
LRRC4	ARHGEF12	psi-mi:“MI:0407”(direct interaction)	0.440
LRRC4	GOPC	psi-mi:“MI:0407”(direct interaction)	0.440
LRRC4	DLG4	psi-mi:“MI:0407”(direct interaction)	0.440
DLG1	LRRC4	psi-mi:“MI:0407”(direct interaction)	0.440

BioGRID (31): LRRC4 (Affinity Capture-MS), FAM114A2 (Affinity Capture-MS), TBCD (Affinity Capture-MS), XPO4 (Affinity Capture-MS), DPP9 (Affinity Capture-MS), KIAA1524 (Affinity Capture-MS), POMT2 (Affinity Capture-MS), TNPO2 (Affinity Capture-MS), MID1 (Affinity Capture-MS), ITGB5 (Affinity Capture-MS), LRRC4 (Affinity Capture-MS), LRRC4 (Affinity Capture-Western), MAPK3 (Affinity Capture-Western), MAPK1 (Affinity Capture-Western), LRRC4 (Affinity Capture-Western)

ESM2 similar proteins: C0STK7, C3YZ59, O00206, O15455, O42235, O60938, O62702, O93233, P58727, Q0PV50, Q2V898, Q45R42, Q58A48, Q5BK65, Q5M7S9, Q5TJ59, Q62192, Q65YW8, Q65Z91, Q68Y56, Q6AXL3, Q6DF55, Q6R5N8, Q6R5P0, Q7Z2Q7, Q80X72, Q8BMT4, Q8BZT5, Q8C031, Q8N6Y2, Q8R5M3, Q8SPE8, Q8SPE9, Q965M2, Q99467, Q99MB1, Q99PH1, Q9CQ76, Q9CXD9, Q9DE66

Diamond homologs: A0A1Y9G8H0, A0A452E9Y6, A1KZ92, A2A8L5, A2AJ76, A4IFW2, A4IGL7, A4IIW9, A5JUY8, A7MBJ4, A8WGA3, A8WQH2, B0BNK7, B3A0P3, D2HFT7, D3YXG0, D4A1J9, D4ABX8, G5EBF1, G5EG78, H2A0M7, O15146, O35158, O55005, O89026, P05164, P07202, P09933, P0C6S8, P0C7J6, P11247, P11678, P14650, P16621, P22079, P23468, P35419, P49290, P70193, P80025

SIGNOR signaling

9 interactions.

A	Effect	B	Mechanism
NTNG2	“up-regulates activity”	LRRC4	binding
LRRC4	“up-regulates activity”	DLG4	binding
LRRC4	“up-regulates quantity by expression”	CDKN1B	“transcriptional regulation”
LRRC4	“up-regulates quantity by expression”	CDKN1A	“transcriptional regulation”
LRRC4	“down-regulates quantity by repression”	CCND1	“transcriptional regulation”
LRRC4	“down-regulates quantity by repression”	CCNE1	“transcriptional regulation”
LRRC4	“down-regulates quantity by repression”	CDK2	“transcriptional regulation”
LRRC4	“down-regulates quantity by repression”	CDK4	“transcriptional regulation”
LRRC4	down-regulates	Angiogenesis

Enriched among interaction partners

Reactome pathways and GO biological processes over-represented among this gene’s 81 IntAct physical interaction partners (hypergeometric vs the genome-wide background, BH-FDR, gene-set size 15–500, ranked by fold). A functional readout of the neighbourhood — distinct from this gene’s own memberships above, and biased toward well-studied / hub proteins, so read it as themes rather than proof.

Reactome pathways:

Pathway	Partners	Fold	FDR
Assembly and cell surface presentation of NMDA receptors	7	34.2×	1e-07
Neurexins and neuroligins	8	30.3×	4e-08

GO biological processes:

GO term	Partners	Fold	FDR
establishment or maintenance of epithelial cell apical/basal polarity	7	52.1×	3e-08
protein localization to synapse	5	49.1×	3e-06
receptor clustering	6	48.0×	4e-07
regulation of postsynaptic membrane neurotransmitter receptor levels	6	38.1×	1e-06
cell-cell adhesion	9	11.7×	5e-06
chemical synaptic transmission	7	6.9×	2e-03

Disease & clinical

Clinical variants and AI predictions

ClinVar

83 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	76
Likely benign	2
Benign	4

Top pathogenic / likely-pathogenic (0)

SpliceAI

271 predictions. Top by Δscore:

Variant	Effect	Δscore
7:128030908:CCTA:C	donor_loss	0.9900
7:128030909:CTAC:C	donor_loss	0.9900
7:128030910:TA:T	donor_loss	0.9900
7:128030911:A:C	donor_loss	0.9900
7:128030912:CCT:C	donor_gain	0.9900
7:128030911:A:AC	donor_gain	0.9700
7:128030912:C:CC	donor_gain	0.9700
7:128031468:G:GT	donor_gain	0.9300
7:128030907:ACCT:A	donor_loss	0.9200
7:128030741:C:CC	acceptor_gain	0.9000
7:128031461:T:G	donor_gain	0.8800
7:128030930:A:T	donor_gain	0.8600
7:128031900:GCGGC:G	donor_gain	0.8600
7:128030738:CATCT:C	acceptor_loss	0.8500
7:128030740:TCTGG:T	acceptor_loss	0.8500
7:128030741:CT:C	acceptor_loss	0.8500
7:128030742:T:C	acceptor_loss	0.8500
7:128030911:AC:A	donor_gain	0.8300
7:128030912:CC:C	donor_gain	0.8300
7:128030737:CCAT:C	acceptor_gain	0.8200
7:128030738:CATC:C	acceptor_gain	0.8200
7:128030738:CAT:C	acceptor_gain	0.8100
7:128031950:G:GT	donor_gain	0.8000
7:128030710:GCT:G	donor_gain	0.7900
7:128032103:AAT:A	donor_gain	0.7900
7:128030635:C:A	acceptor_gain	0.7600
7:128031436:T:TA	donor_gain	0.7600
7:128030929:G:GT	donor_gain	0.7300
7:128030633:AGCTT:A	acceptor_gain	0.7100
7:128030736:TCCAT:T	acceptor_gain	0.7100

AlphaMissense

4275 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
7:128029022:G:T	A540D	1.000
7:128029047:A:G	C532R	1.000
7:128029369:G:C	C424W	1.000
7:128029371:A:G	C424R	1.000
7:128029377:A:C	Y422D	1.000
7:128029489:C:A	W384C	1.000
7:128029489:C:G	W384C	1.000
7:128029491:A:G	W384R	1.000
7:128029491:A:T	W384R	1.000
7:128029735:C:A	W302C	1.000
7:128029735:C:G	W302C	1.000
7:128029737:A:G	W302R	1.000
7:128029737:A:T	W302R	1.000
7:128029741:G:C	N300K	1.000
7:128029741:G:T	N300K	1.000
7:128029813:A:C	N276K	1.000
7:128029813:A:T	N276K	1.000
7:128029829:A:G	L271P	1.000
7:128029901:A:G	L247P	1.000
7:128029973:A:G	L223P	1.000
7:128030039:A:G	L201P	1.000
7:128030048:A:T	L198H	1.000
7:128030114:A:G	L176P	1.000
7:128030123:A:G	L173P	1.000
7:128030123:A:T	L173H	1.000
7:128030170:G:C	N157K	1.000
7:128030170:G:T	N157K	1.000
7:128030180:A:G	L154P	1.000
7:128030180:A:T	L154H	1.000
7:128030186:A:G	L152P	1.000

dbSNP variants (sampled 300 via entrez): RS1000118787 (7:128032502 G>A), RS1000171627 (7:128030788 G>A,C,T), RS1000302461 (7:128031225 G>A,T), RS1000723428 (7:128031452 C>G), RS1001261120 (7:128031048 G>A,T), RS1001781000 (7:128032376 G>C), RS1002004835 (7:128027659 AAAAC>A), RS1002060772 (7:128028063 G>A), RS1002199279 (7:128033564 C>T), RS1003046458 (7:128031771 ACCGCCCGTCG>A,ACCGCCCGTCGCCGCCCGTCG), RS1003741622 (7:128033960 C>T), RS1003774576 (7:128029231 C>T), RS1004077274 (7:128027547 G>A,C), RS1004638703 (7:128029189 C>T), RS1004810185 (7:128031061 A>C,G)

Disease associations

OMIM: gene MIM:610486 | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

7 associations (top):

Study	Trait	p-value
GCST007323_89	Risk-taking tendency (4-domain principal component model)	1.000000e-09
GCST007324_12	Adventurousness	6.000000e-11
GCST007324_148	Adventurousness	2.000000e-09
GCST007328_49	Alcohol consumption (drinks per week)	2.000000e-08
GCST010136_49	Fruit consumption	9.000000e-10
GCST010702_42	Subcortical volume (MOSTest)	2.000000e-10
GCST010703_208	Brain morphology (MOSTest)	2.000000e-11

EFO canonical traits (3, from GWAS)

EFO ID	Trait name
EFO:0008579	risk-taking behaviour
EFO:0008111	diet measurement
EFO:0004346	neuroimaging measurement

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

27 total (human), top 27 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Valproic Acid	affects cotreatment, decreases expression, affects expression	7
trichostatin A	affects cotreatment, decreases expression	3
Estradiol	affects cotreatment, increases expression, decreases expression	3
entinostat	decreases expression, affects cotreatment	2
triphenyl phosphate	affects expression	1
bisphenol A	decreases expression	1
kojic acid	decreases expression	1
sodium arsenite	affects expression	1
S-(1,2-dichlorovinyl)cysteine	affects response to substance, increases expression	1
di-n-butylphosphoric acid	affects expression	1
CGP 52608	affects binding, increases reaction	1
4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	decreases expression, affects cotreatment	1
dorsomorphin	affects cotreatment, decreases expression	1
Sunitinib	increases expression	1
Norethindrone Acetate	affects cotreatment, increases expression	1
Air Pollutants	decreases expression, increases abundance	1
Arbutin	decreases expression	1
Benzo(a)pyrene	increases methylation	1
Carbamazepine	affects expression	1
Dimethyl Sulfoxide	affects expression	1
Folic Acid	decreases expression	1
Lipopolysaccharides	decreases expression, affects response to substance, increases expression	1
Oxygen	decreases expression	1
Tobacco Smoke Pollution	increases expression	1
Triclosan	decreases expression	1
Zearalenone	decreases expression	1
Particulate Matter	increases abundance, decreases expression	1

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.