LRRC45

Summary

LRRC45 (leucine rich repeat containing 45, HGNC:28302) is a protein-coding gene on chromosome 17q25.3, encoding Leucine-rich repeat-containing protein 45 (Q96CN5). Component of the proteinaceous fiber-like linker between two centrioles, required for centrosome cohesion.

Located in cytosol; microtubule organizing center; and plasma membrane.

Source: NCBI Gene 201255 — RefSeq curated summary.

At a glance

• Gene–disease (curated): neurodevelopmental disorder (Moderate, GenCC) — +1 more curated relationship
• GWAS associations: 2
• Clinical variants (ClinVar): 192 total — 1 pathogenic
• MANE Select transcript: NM_144999

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:28302
Approved symbol	LRRC45
Name	leucine rich repeat containing 45
Location	17q25.3
Locus type	gene with protein product
Status	Approved
Aliases	MGC20806
Ensembl gene	ENSG00000169683
Ensembl biotype	protein_coding
OMIM	621312
Entrez	201255

Gene structure

Transcript identifiers

Ensembl transcripts: 14 — 10 protein_coding, 2 retained_intron, 1 nonsense_mediated_decay, 1 protein_coding_CDS_not_defined

ENST00000306688, ENST00000577638, ENST00000581227, ENST00000582083, ENST00000583302, ENST00000583383, ENST00000891005, ENST00000891006, ENST00000891007, ENST00000891008, ENST00000891009, ENST00000920878, ENST00000920879, ENST00000920880

RefSeq mRNA: 1 — MANE Select: NM_144999 NM_144999

CCDS: CCDS11797

Canonical transcript exons

ENST00000306688 — 17 exons

Exon	Start	End
ENSE00001163008	82029093	82029185
ENSE00001163014	82028613	82028683
ENSE00001163070	82026899	82027011
ENSE00001163079	82025379	82025507
ENSE00001163100	82024278	82024339
ENSE00001322054	82030609	82031151
ENSE00002729899	82023305	82023863
ENSE00003509720	82030319	82030466
ENSE00003518219	82025000	82025178
ENSE00003522514	82028234	82028311
ENSE00003538648	82024693	82024763
ENSE00003565752	82028397	82028508
ENSE00003589885	82030065	82030238
ENSE00003609288	82028011	82028146
ENSE00003617333	82029543	82029635
ENSE00003652128	82027386	82027444
ENSE00003681328	82027674	82027751

Expression profiles

Bgee: expression breadth ubiquitous, 164 present calls, max score 92.71.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 4.2752 / max 36.7071, expressed in 1564 samples.

FANTOM5 promoters (2 alternative TSS)

Promoter ID	TPM avg	Samples expressed
163445	4.0349	1556
163446	0.2403	125

Top tissues by expression

242 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
right uterine tube	UBERON:0001302	92.71	gold quality
right hemisphere of cerebellum	UBERON:0014890	92.14	gold quality
cerebellar hemisphere	UBERON:0002245	91.64	gold quality
cerebellar cortex	UBERON:0002129	91.44	gold quality
mucosa of transverse colon	UBERON:0004991	90.17	gold quality
cerebellum	UBERON:0002037	89.77	gold quality
olfactory segment of nasal mucosa	UBERON:0005386	87.50	gold quality
granulocyte	CL:0000094	87.14	gold quality
right lobe of liver	UBERON:0001114	86.73	gold quality
primordial germ cell in gonad	CL:0000670 ∩ UBERON:0000991	86.50	gold quality
ganglionic eminence	UBERON:0004023	84.69	gold quality
apex of heart	UBERON:0002098	84.40	gold quality
tendon of biceps brachii	UBERON:0008188	84.26	gold quality
body of stomach	UBERON:0001161	83.67	gold quality
ventricular zone	UBERON:0003053	83.65	gold quality
cortical plate	UBERON:0005343	83.64	gold quality
right lobe of thyroid gland	UBERON:0001119	83.10	gold quality
lower esophagus mucosa	UBERON:0035834	83.09	gold quality
esophagus mucosa	UBERON:0002469	82.54	gold quality
minor salivary gland	UBERON:0001830	82.51	gold quality
transverse colon	UBERON:0001157	82.39	gold quality
right frontal lobe	UBERON:0002810	82.09	gold quality
spleen	UBERON:0002106	81.62	gold quality
metanephros cortex	UBERON:0010533	81.56	gold quality
small intestine Peyer’s patch	UBERON:0003454	81.37	gold quality
mouth mucosa	UBERON:0003729	81.18	gold quality
body of pancreas	UBERON:0001150	81.12	gold quality
skin of abdomen	UBERON:0001416	80.99	gold quality
saliva-secreting gland	UBERON:0001044	80.85	gold quality
stomach	UBERON:0000945	80.72	gold quality

Single-cell (SCXA)

Detected in 1 experiment(s), a significant marker in 1.

Experiment	Marker?	Max mean expression
E-ANND-3	yes	3.26

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

1 targeting LRRC45, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-1307-5P	72.89	61.08	5

Literature-anchored findings (GeneRIF, showing 1)

• LRRC45 is a critical component of the proteinaceous linker between two centrioles and is required for centrosome cohesion. (PMID:24035387)

Cross-species orthologs

3 orthologs

Organism	Symbol	Gene ID
danio_rerio	lrrc45	ENSDARG00000014005
mus_musculus	Lrrc45	ENSMUSG00000025145
rattus_norvegicus	Lrrc45	ENSRNOG00000045926

Paralogs (1): CEP83 (ENSG00000173588)

Protein

Protein identifiers

Leucine-rich repeat-containing protein 45 — Q96CN5 (reviewed: Q96CN5)

All UniProt accessions (2): Q96CN5, J3KTD4

UniProt curated annotations — full annotation on UniProt →

Function. Component of the proteinaceous fiber-like linker between two centrioles, required for centrosome cohesion.

Subunit / interactions. Homomer. Interacts with CROCC/rootletin and CEP250. Interacts with CEP44. Interacts with CCDC102B (via N-terminus).

Subcellular location. Cytoplasm. Cytoskeleton. Microtubule organizing center. Centrosome.

Post-translational modifications. Phosphorylated by NEK2 during misosis, phosphorylation reduces centrosomal localization which subsequently leads to centrosome separation.

RefSeq proteins (1): NP_659436* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR001611	Leu-rich_rpt	Repeat
IPR032675	LRR_dom_sf	Homologous_superfamily
IPR052116	Centro_Cilium_Assembly	Family

Pfam: PF13516

UniProt features (9 total): repeat 6, chain 1, coiled-coil region 1, modified residue 1

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q96CN5-F1	83.38	0.42

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Post-translational modifications (1): 661

Function

Pathways and Gene Ontology

Reactome pathways

0 pathways

MSigDB gene sets: 66 (showing top): GOCC_MICROTUBULE_ORGANIZING_CENTER, GOCC_CENTROSOME, FISCHER_DREAM_TARGETS, NIKOLSKY_BREAST_CANCER_17Q21_Q25_AMPLICON, GOCC_CILIUM, GOCC_CILIARY_BASAL_BODY, CHENG_IMPRINTED_BY_ESTRADIOL, E2F3_UP.V1_UP, ASH1L_TARGET_GENES, CEBPZ_TARGET_GENES, CREB3L4_TARGET_GENES, FOXN3_TARGET_GENES, HDAC4_TARGET_GENES, HSD17B8_TARGET_GENES, RBM34_TARGET_GENES

GO Biological Process (0):

GO Molecular Function (1): protein binding (GO:0005515)

GO Cellular Component (8): centrosome (GO:0005813), cytosol (GO:0005829), plasma membrane (GO:0005886), ciliary basal body (GO:0036064), sperm midpiece (GO:0097225), sperm principal piece (GO:0097228), cytoplasm (GO:0005737), cytoskeleton (GO:0005856)

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
cellular anatomical structure	4
microtubule organizing center	2
sperm flagellum	2
binding	1
centriole	1
cytoplasm	1
membrane	1
cell periphery	1
cilium	1
intracellular anatomical structure	1
intracellular membraneless organelle	1

Protein interactions and networks

STRING

817 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
LRRC45	CROCC	Q5TZA2	981
LRRC45	CNTLN	Q9NXG0	924
LRRC45	CEP250	Q9BV73	809
LRRC45	CEP89	Q96ST8	782
LRRC45	CDK5RAP2	Q96SN8	766
LRRC45	SCLT1	Q96NL6	665
LRRC45	CEP135	Q66GS9	642
LRRC45	GAS2L1	Q99501	606
LRRC45	CEP83	Q9Y592	605
LRRC45	CEP164	Q9UPV0	603
LRRC45	NEK2	P51955	597
LRRC45	FBF1	Q8TES7	571
LRRC45	ERICH5	Q6P6B1	543
LRRC45	CCDC120	Q96HB5	511
LRRC45	NEDD1	Q8NHV4	506

IntAct

46 interactions, top by confidence:

A	B	Type	Score
PRMT8	SYNCRIP	psi-mi:“MI:0914”(association)	0.830
KXD1	LRRC45	psi-mi:“MI:0915”(physical association)	0.670
LRRC45	KXD1	psi-mi:“MI:0915”(physical association)	0.670
CCDC89	LRRC45	psi-mi:“MI:0915”(physical association)	0.670
LRRC45	SSX2	psi-mi:“MI:0915”(physical association)	0.560
SSX7	LRRC45	psi-mi:“MI:0915”(physical association)	0.560
LRRC45	SSX7	psi-mi:“MI:0915”(physical association)	0.560
ALAS1	LRRC45	psi-mi:“MI:0915”(physical association)	0.560
MCC	LRRC45	psi-mi:“MI:0915”(physical association)	0.560
SSX2	LRRC45	psi-mi:“MI:0915”(physical association)	0.560
LRRC45	MID2	psi-mi:“MI:0915”(physical association)	0.560
HTT	LRRC45	psi-mi:“MI:0915”(physical association)	0.560
SCLT1	CCDC22	psi-mi:“MI:0914”(association)	0.420
LRRC45	ANXA6	psi-mi:“MI:0915”(physical association)	0.400
LRRC45	UPP1	psi-mi:“MI:0915”(physical association)	0.400
LRRC45	PAK6	psi-mi:“MI:0915”(physical association)	0.400
	LRRC45	psi-mi:“MI:0915”(physical association)	0.370
THAP11	LRRC45	psi-mi:“MI:0915”(physical association)	0.370
LRRC45	ZDHHC17	psi-mi:“MI:0915”(physical association)	0.370
ENTHD1	C1orf226	psi-mi:“MI:0914”(association)	0.350
CKAP2	WDR46	psi-mi:“MI:0914”(association)	0.350
H2AP	GNPAT	psi-mi:“MI:0914”(association)	0.350
PRMT8	HNRNPR	psi-mi:“MI:0914”(association)	0.350

BioGRID (22): LRRC45 (Two-hybrid), LRRC45 (Two-hybrid), LRRC45 (Two-hybrid), LRRC45 (Affinity Capture-MS), KXD1 (Two-hybrid), UPP1 (Affinity Capture-MS), LRRC45 (Two-hybrid), LRRC45 (Two-hybrid), MCC (Two-hybrid), CCDC89 (Two-hybrid), SSX7 (Two-hybrid), SSX2 (Two-hybrid), SSX2B (Two-hybrid), LRRC45 (Proximity Label-MS), LRRC45 (Affinity Capture-MS)

ESM2 similar proteins: A0JNH6, A1A5D9, A6NC98, A6NGB0, A6NI56, A7YH32, A9X1A5, B0KWC9, B1MTG4, B3EX63, B8JK76, F6XLV1, H7BZ55, P55937, P59242, Q08378, Q0P5D1, Q14980, Q29RS0, Q2KJ21, Q2TAC2, Q3TMW1, Q494R4, Q4QRL3, Q5RD60, Q5TZA2, Q60952, Q6PGZ0, Q6PHN1, Q6QZQ4, Q8CB62, Q8CHW5, Q8CJ40, Q8HZ57, Q8HZ58, Q8HZ59, Q8HZ60, Q8K2I2, Q8N137, Q8TD31

Diamond homologs: P29315, Q5ZI11, Q6B966, Q8CIM1, Q91VI7, Q96CN5

SIGNOR signaling

4 interactions.

A	Effect	B	Mechanism
LRRC45	“up-regulates activity”	CEP250	binding
LRRC45	“up-regulates activity”	CROCC	binding
NEK2	“down-regulates activity”	LRRC45	phosphorylation
CCDC102B	“up-regulates activity”	LRRC45	binding

Disease & clinical

Clinical variants and AI predictions

ClinVar

192 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	1
Likely pathogenic	0
Uncertain significance	133
Likely benign	35
Benign	0

Top pathogenic / likely-pathogenic (1)

Variant ID	HGVS	Classification
3393451	NM_144999.4(LRRC45):c.1402-2A>G	Pathogenic

SpliceAI

2315 predictions. Top by Δscore:

Variant	Effect	Δscore
17:82023860:G:GT	donor_gain	1.0000
17:82023860:GAAGG:G	donor_loss	1.0000
17:82023861:A:T	donor_gain	1.0000
17:82023861:AAG:A	donor_loss	1.0000
17:82023864:GTG:G	donor_loss	1.0000
17:82023865:T:G	donor_loss	1.0000
17:82024575:G:GT	donor_gain	1.0000
17:82024687:TCCTA:T	acceptor_loss	1.0000
17:82024689:CTA:C	acceptor_loss	1.0000
17:82024690:TA:T	acceptor_loss	1.0000
17:82024691:AG:A	acceptor_gain	1.0000
17:82024692:GG:G	acceptor_gain	1.0000
17:82024761:GAG:G	donor_gain	1.0000
17:82024995:T:TA	acceptor_gain	1.0000
17:82024995:TGCA:T	acceptor_loss	1.0000
17:82024996:GCAG:G	acceptor_loss	1.0000
17:82024997:CAG:C	acceptor_loss	1.0000
17:82024998:A:AG	acceptor_gain	1.0000
17:82024998:AGC:A	acceptor_loss	1.0000
17:82024999:G:A	acceptor_loss	1.0000
17:82024999:G:GC	acceptor_gain	1.0000
17:82024999:GC:G	acceptor_gain	1.0000
17:82024999:GCC:G	acceptor_gain	1.0000
17:82024999:GCCT:G	acceptor_gain	1.0000
17:82024999:GCCTC:G	acceptor_gain	1.0000
17:82025112:A:G	donor_gain	1.0000
17:82025124:G:GT	donor_gain	1.0000
17:82025174:GCTGG:G	donor_gain	1.0000
17:82025175:C:G	donor_gain	1.0000
17:82025177:GG:G	donor_gain	1.0000

AlphaMissense

4346 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
17:82025018:C:A	N124K	0.994
17:82025018:C:G	N124K	0.994
17:82025392:T:A	N182K	0.994
17:82025392:T:G	N182K	0.994
17:82024698:C:A	N96K	0.990
17:82024698:C:G	N96K	0.990
17:82025013:T:A	W123R	0.990
17:82025013:T:C	W123R	0.990
17:82025108:C:A	N154K	0.990
17:82025108:C:G	N154K	0.990
17:82025391:A:T	N182I	0.990
17:82025476:C:A	N210K	0.990
17:82025476:C:G	N210K	0.990
17:82025098:T:A	L151H	0.987
17:82025098:T:C	L151P	0.986
17:82025387:T:A	W181R	0.986
17:82025387:T:C	W181R	0.986
17:82025391:A:C	N182T	0.986
17:82030753:T:A	V654D	0.986
17:82025015:G:C	W123C	0.985
17:82025015:G:T	W123C	0.985
17:82025382:T:C	L179P	0.984
17:82025017:A:T	N124I	0.982
17:82025390:A:T	N182Y	0.981
17:82025113:T:C	I156T	0.980
17:82025390:A:C	N182H	0.979
17:82025017:A:C	N124T	0.976
17:82025106:A:T	N154Y	0.976
17:82025412:G:A	G189D	0.976
17:82025016:A:T	N124Y	0.974

dbSNP variants (sampled 300 via entrez): RS1000218612 (17:82027580 A>C,G,T), RS1000334058 (17:82023022 C>A,G,T), RS1000585646 (17:82026285 G>A), RS1000661885 (17:82021823 G>C), RS1000956484 (17:82026560 T>C), RS1001041313 (17:82029451 C>A,G,T), RS1001060305 (17:82031245 C>G,T), RS1001547112 (17:82023238 C>G), RS1001581258 (17:82023073 C>A,G), RS1001611613 (17:82031546 GCCCCGCCAGCCGCGCGGCCGGGCGCC>G), RS1001885566 (17:82022158 G>A), RS1001916894 (17:82021892 C>T), RS1002121413 (17:82023441 C>T), RS1002573889 (17:82028274 C>G,T), RS1002809921 (17:82026799 C>T)

Disease associations

OMIM: gene MIM:621312 | disease phenotypes:

GenCC curated gene-disease

Disease	Classification	Inheritance
neurodevelopmental disorder	Moderate	Autosomal recessive
ciliopathy	Limited	Autosomal recessive

Mondo (2): ciliopathy (MONDO:0005308), neurodevelopmental disorder (MONDO:0700092)

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

2 associations (top):

Study	Trait	p-value
GCST010002_133	Refractive error	2.000000e-50
GCST011053_11	Neuroblastoma (pediatric)	3.000000e-17

MeSH disease descriptors (1)

Descriptor	Name	Tree numbers
D065886	Neurodevelopmental Disorders	F03.625

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

36 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
sodium arsenite	increases expression, decreases expression	3
Cyclosporine	decreases expression	2
FR900359	decreases phosphorylation	1
bisphenol A	affects expression	1
methylparaben	increases expression	1
sulforaphane	decreases expression	1
tris(1,3-dichloro-2-propyl)phosphate	decreases expression	1
aflatoxin B2	increases methylation	1
S-(1,2-dichlorovinyl)cysteine	affects response to substance, increases expression	1
beta-methylcholine	affects expression	1
di-n-butylphosphoric acid	affects expression	1
abrine	decreases expression	1
Grape Seed Proanthocyanidins	affects cotreatment, increases expression	1
jinfukang	affects cotreatment, increases expression	1
NSC 689534	affects binding, decreases expression	1
Acetaminophen	decreases expression	1
Air Pollutants	decreases expression, increases abundance	1
Atrazine	decreases expression	1
Benzo(a)pyrene	increases methylation	1
Caffeine	decreases phosphorylation	1
Calcitriol	decreases expression, affects cotreatment	1
Cannabidiol	decreases expression	1
Catechin	affects cotreatment, increases expression	1
Cisplatin	affects cotreatment, increases expression	1
Copper	affects binding, decreases expression	1
Lipopolysaccharides	decreases expression, affects response to substance, increases expression	1
Oxygen	decreases expression	1
Testosterone	affects cotreatment, decreases expression	1
Tobacco Smoke Pollution	decreases expression	1
Urethane	decreases expression	1

Clinical trials (associated diseases)

204 trials via MONDO — disease-level, not drug-specific.

Trial	Phase	Status	Title
NCT04586348	PHASE4	UNKNOWN	Prenatal Iodine Supplementation and Early Childhood Neurodevelopment
NCT04873115	PHASE4	UNKNOWN	Double-blind, Placebo-controlled, Randomized Clinical Trial Comparing the Efficacy and Safety of Sialanar Plus orAl rehabiLitation Against Placebo Plus Oral Rehabilitation for chIldren and Adolescents With seVere Sialorrhoea and Neurodisabilties,
NCT02559102	PHASE3	COMPLETED	Dexmedetomidine Sedation Versus General Anaesthesia for Inguinal Hernia Surgery in Infants
NCT02757079	PHASE3	COMPLETED	Study of the Efficacy and Safety of NPC-15 for Sleep Disorders of Children With Neurodevelopmental Disorders
NCT06915480	PHASE3	RECRUITING	Reducing Missed Appointments
NCT07377032	PHASE3	RECRUITING	TAP-GRIN: Interventional Study on Patients With GRIN-related Neurodevelopmental Disorders
NCT02909959	PHASE2	COMPLETED	Sulforaphane for the Treatment of Young Men With Autism Spectrum Disorder
NCT06081348	PHASE2	RECRUITING	Sertraline vs. Placebo in the Treatment of Anxiety in Children and AdoLescents With NeurodevelopMental Disorders
NCT06352372	PHASE2	COMPLETED	Safety and Efficacy of tPBM for Epileptiform Activity in Autism
NCT00503191	PHASE1	COMPLETED	NeuroModulation Technique Treatment of Autism
NCT04475848	PHASE1	COMPLETED	A Study to Investigate the Safety, Tolerability, Pharmacokinetics, Pharmacodynamics and Food Effect of RO6953958 in Healthy Participants
NCT06300398	PHASE1	COMPLETED	IAMA-6 Oral Dose Study in Healthy Adults
NCT00068224	Not specified	COMPLETED	Clinical and Molecular Investigations Into Ciliopathies
NCT04874909	Not specified	COMPLETED	Classification, Functional Stratification and Biomarkers in Ciliopathy (CILLICORIRCM)
NCT01783041	PHASE2/PHASE3	COMPLETED	Effect of Early L-Carnitine Supplementation on Neurodevelopmental Outcomes in Very Preterm Infants
NCT05767385	PHASE2/PHASE3	RECRUITING	Fetal Cerebrovascular Autoregulation in Congenital Heart Disease and Association With Neonatal Neurobehavior
NCT05675098	EARLY_PHASE1	NOT_YET_RECRUITING	Central Nervous System Stimulants and Physical Function in Children With Cerebral Palsy
NCT00783783	Not specified	COMPLETED	CYP2D6 Pharmacogenetics in Risperidone-Treated Children
NCT01778504	Not specified	RECRUITING	Studying Childhood-onset Behavioral, Psychiatric, and Developmental Disorders
NCT01850784	Not specified	UNKNOWN	High Energy Formula Feeding in Infants With Congenital Heart Disease
NCT01922791	Not specified	COMPLETED	Nutrition and Pregnancy Intervention Study
NCT01942525	Not specified	UNKNOWN	Influence of Intrauterine Growth Restriction on Amplitude-integrated EEG in Preterm Infants
NCT02003170	Not specified	COMPLETED	Etiology and Early Diagnosis of Neurodevelopmental Disorders
NCT02118649	Not specified	ACTIVE_NOT_RECRUITING	Enhancing Behavior and Brain Response to Visual Targets Using a Computer Game
NCT02557191	Not specified	TERMINATED	Biomarkers, Neurodevelopment and Preterm Infants
NCT02690675	Not specified	COMPLETED	Iron Supplement Effect on Child Development
NCT02694003	Not specified	COMPLETED	Better Nights, Better Days for Children With Neurodevelopment Disorders
NCT02792894	Not specified	COMPLETED	Family Networks (FaNs) for Children With Developmental Disorders and Delays
NCT02871674	Not specified	UNKNOWN	Good Night Project: Behavioural Sleep Interventions for Children With ADHD: A Randomised Controlled Trial
NCT02887157	Not specified	COMPLETED	Analyzing Retinal Microanatomy in ROP
NCT02898298	Not specified	COMPLETED	Positive Emotion Regulation Training in Children, Adolescents and Young Adults With and Without Developmental Disorder
NCT02912780	Not specified	UNKNOWN	Introduction of Microsystems in a Level 3 Neonatal Intensive Care Unit
NCT03023293	Not specified	COMPLETED	n-3 PUFAs, Irisin and Maternal Glucose Metabolism From Pregnancy to Postpartum
NCT03023644	Not specified	COMPLETED	Improving Neurodevelopmental Outcomes in Children With Congenital Heart Disease: An Intervention Study
NCT03032991	Not specified	UNKNOWN	Early Biomarkers of Neurodevelopment in Offspring of Diabetic Mothers
NCT03088189	Not specified	TERMINATED	Effect of Parental Peri-conceptional Vitamin B12 Supplementation on Infant Neurocognitive Development in Offspring
NCT03096028	Not specified	COMPLETED	Developmental Origins of Mental Health Disorders
NCT03148782	Not specified	COMPLETED	Brain Plasticity Underlying Acquisition of New Organizational Skills in Children-R61 Phase
NCT03172104	Not specified	COMPLETED	Neurobehavioural Development of Infants Born <30 Weeks Gestational Age Between Birth and Five Years of Age
NCT03222375	Not specified	RECRUITING	SQUED™ Series 28.1 Home-use and Treatment of Autowave Reverberator of Autism