LSM11

Summary

LSM11 (LSM11, U7 small nuclear RNA associated, HGNC:30860) is a protein-coding gene on chromosome 5q33.3, encoding U7 snRNA-associated Sm-like protein LSm11 (P83369). Component of the U7 snRNP complex that is involved in the histone 3’-end pre-mRNA processing. It is a selective cancer dependency (DepMap: 83.6% of cell lines).

Enables U7 snRNA binding activity. Involved in mRNA 3’-end processing by stem-loop binding activity and cleavage; positive regulation of G1/S transition of mitotic cell cycle; and regulation of chromatin organization. Located in nuclear body. Part of U7 snRNP and telomerase holoenzyme complex. Implicated in Aicardi-Goutieres syndrome.

Source: NCBI Gene 134353 — automated summary from GO annotations (Alliance of Genome Resources).

At a glance

• Gene–disease (curated): Aicardi-Goutieres syndrome 8 (Limited, GenCC) — +1 more curated relationship
• GWAS associations: 2
• Clinical variants (ClinVar): 61 total — 1 pathogenic
• GTEx eGene: eQTL in 19 tissues, sQTL in 1 (q < 0.05)
• Phenotypes (HPO): 80
• Cancer dependency (DepMap): dependent in 83.6% of screened cell lines
• Constraint (gnomAD): pLI 0.00 (LoF-tolerant), LOEUF 0.93 (unconstrained)
• MANE Select transcript: NM_173491
• Notable: 61 clinical variants but no curated precision-oncology (CIViC) evidence yet

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:30860
Approved symbol	LSM11
Name	LSM11, U7 small nuclear RNA associated
Location	5q33.3
Locus type	gene with protein product
Status	Approved
Aliases	FLJ38273
Ensembl gene	ENSG00000155858
Ensembl biotype	protein_coding
OMIM	617910
Entrez	134353

Gene structure

Transcript identifiers

Ensembl transcripts: 2 — 2 protein_coding

MANE Select: ENST00000286307

Transcript support level (Ensembl TSL; 1 = fully mRNA-supported): TSL 1: 1

ENST00000286307, ENST00001134300

RefSeq mRNA: 1 — MANE Select: NM_173491 NM_173491

CCDS: CCDS4342

Canonical transcript exons

ENST00000286307 — 4 exons

Exon	Start	End
ENSE00001023124	157754004	157754087
ENSE00001233466	157751390	157751529
ENSE00001233474	157754854	157760709
ENSE00001233480	157743712	157744198

Expression profiles

Bgee: expression breadth ubiquitous, 234 present calls, max score 95.30.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 3.8349 / max 48.0852, expressed in 1533 samples.

Highest expression (Bgee): secondary oocyte, endothelial cell, Brodmann (1909) area 23, middle temporal gyrus, oocyte.

Genetic regulation across tissues (GTEx eQTL / sQTL)

LSM11 is an eGene in GTEx v10 — its expression is genetically regulated (eQTL) in 19 tissues and its splicing (sQTL) in 1 (q < 0.05). Strongest associations first; slope = normalized effect of the lead variant’s alternative allele.

20 significant tissue × QTL associations:

Tissue	QTL	q-value	Slope	Lead variant
Nerve Tibial	eqtl	2.6e-07	+0.33	5:157283735:G:A
Muscle Skeletal	eqtl	6.7e-05	+0.16	5:157741640:A:G
Adrenal Gland	eqtl	8.4e-05	+0.36	5:157735217:C:T
Cells EBV-transformed lymphocytes	eqtl	1.2e-03	-0.24	5:157642073:C:T
Skin Sun Exposed Lower leg	eqtl	2.3e-03	+0.12	5:157700170:C:T
Skin Not Sun Exposed Suprapubic	eqtl	3.2e-03	+0.20	5:157695657:T:A
Artery Aorta	eqtl	6.5e-03	+1.03	5:157541583:T:C
Adipose Subcutaneous	eqtl	6.9e-03	+0.12	5:157375011:A:G
Esophagus Mucosa	eqtl	7.8e-03	+0.19	5:157757772:A:G
Pancreas	eqtl	8.1e-03	+1.17	5:157705546:TA:T
Adipose Visceral Omentum	eqtl	1.3e-02	+0.30	5:157263460:G:A
Brain Anterior cingulate cortex BA24	eqtl	1.5e-02	-0.10	5:157751211:T:C
Esophagus Gastroesophageal Junction	eqtl	2.1e-02	+0.34	5:158154714:C:T
Spleen	eqtl	2.3e-02	+0.23	5:158534796:T:C
Cells Cultured fibroblasts	eqtl	2.5e-02	-0.39	5:157372282:G:A
Esophagus Muscularis	eqtl	2.5e-02	-0.10	5:157371918:GTTATCATATAGTGGGAATAA:G
Testis	eqtl	2.8e-02	+0.13	5:157761088:G:A
Esophagus Muscularis	sqtl	4.4e-02	-1.27	5:158099649:A:G
Stomach	eqtl	4.6e-02	+0.18	5:157543139:G:C
Brain Frontal Cortex BA9	eqtl	4.9e-02	-0.10	5:157759052:T:C

FANTOM5 promoters

1 alternative TSS:

Promoter ID	TPM avg	Samples expressed
59839	3.8349	1533

Top tissues by expression

showing 100 of 251 tissues by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
secondary oocyte	CL:0000655	95.30	gold quality
endothelial cell	CL:0000115	94.85	gold quality
Brodmann (1909) area 23	UBERON:0013554	94.32	gold quality
middle temporal gyrus	UBERON:0002771	91.81	gold quality
oocyte	CL:0000023	91.27	gold quality
cortical plate	UBERON:0005343	90.94	gold quality
Brodmann (1909) area 46	UBERON:0006483	85.56	gold quality
superior frontal gyrus	UBERON:0002661	84.91	gold quality
postcentral gyrus	UBERON:0002581	84.90	gold quality
primordial germ cell in gonad	CL:0000670 ∩ UBERON:0000991	84.57	gold quality
adrenal tissue	UBERON:0018303	84.42	gold quality
entorhinal cortex	UBERON:0002728	84.29	gold quality
cerebellar vermis	UBERON:0004720	84.23	gold quality
primary visual cortex	UBERON:0002436	83.87	gold quality
parietal lobe	UBERON:0001872	83.53	gold quality
cauda epididymis	UBERON:0004360	82.68	gold quality
cartilage tissue	UBERON:0002418	82.65	gold quality
occipital lobe	UBERON:0002021	81.92	gold quality
tibialis anterior	UBERON:0001385	80.79	silver quality
male germ line stem cell (sensu Vertebrata) in testis	CL:0000089 ∩ UBERON:0000473	80.69	gold quality
lower esophagus muscularis layer	UBERON:0035833	80.58	gold quality
lower esophagus	UBERON:0013473	80.48	gold quality
mucosa of sigmoid colon	UBERON:0004993	79.25	gold quality
pigmented layer of retina	UBERON:0001782	78.47	gold quality
skin of hip	UBERON:0001554	78.09	gold quality
prefrontal cortex	UBERON:0000451	77.77	gold quality
colonic mucosa	UBERON:0000317	77.63	gold quality
urinary bladder	UBERON:0001255	77.60	gold quality
embryo	UBERON:0000922	77.55	gold quality
ganglionic eminence	UBERON:0004023	77.55	gold quality
dorsolateral prefrontal cortex	UBERON:0009834	77.52	gold quality
oviduct epithelium	UBERON:0004804	77.48	gold quality
ileal mucosa	UBERON:0000331	77.46	gold quality
esophagogastric junction muscularis propria	UBERON:0035841	77.44	gold quality
pons	UBERON:0000988	77.32	gold quality
visceral pleura	UBERON:0002401	77.29	gold quality
frontal cortex	UBERON:0001870	77.25	gold quality
lateral nuclear group of thalamus	UBERON:0002736	77.23	gold quality
neocortex	UBERON:0001950	76.92	gold quality
cerebral cortex	UBERON:0000956	76.84	gold quality
ventricular zone	UBERON:0003053	76.68	gold quality
eye	UBERON:0000970	76.34	gold quality
esophagus squamous epithelium	UBERON:0006920	76.33	gold quality
germinal epithelium of ovary	UBERON:0001304	76.22	gold quality
pancreatic ductal cell	CL:0002079	76.19	silver quality
myometrium	UBERON:0001296	76.19	gold quality
muscle layer of sigmoid colon	UBERON:0035805	76.00	gold quality
Brodmann (1909) area 9	UBERON:0013540	75.97	gold quality
cerebellum	UBERON:0002037	75.84	gold quality
parietal pleura	UBERON:0002400	75.75	gold quality
palpebral conjunctiva	UBERON:0001812	75.65	gold quality
tibia	UBERON:0000979	75.63	gold quality
cerebellar cortex	UBERON:0002129	75.42	gold quality
cerebellar hemisphere	UBERON:0002245	75.28	gold quality
seminal vesicle	UBERON:0000998	75.09	gold quality
stromal cell of endometrium	CL:0002255	74.92	gold quality
substantia nigra pars compacta	UBERON:0001965	74.67	gold quality
temporal lobe	UBERON:0001871	74.63	gold quality
body of uterus	UBERON:0009853	74.46	gold quality
jejunal mucosa	UBERON:0000399	74.01	gold quality
sperm	CL:0000019	73.96	silver quality
adult organism	UBERON:0007023	73.94	gold quality
right hemisphere of cerebellum	UBERON:0014890	73.94	gold quality
smooth muscle tissue	UBERON:0001135	73.71	gold quality
saphenous vein	UBERON:0007318	73.38	gold quality
deltoid	UBERON:0001476	73.35	silver quality
esophagus	UBERON:0001043	73.18	gold quality
amniotic fluid	UBERON:0000173	73.09	gold quality
anterior cingulate cortex	UBERON:0009835	72.97	gold quality
uterus	UBERON:0000995	72.59	gold quality
colon	UBERON:0001155	72.53	gold quality
large intestine	UBERON:0000059	72.52	gold quality
superior vestibular nucleus	UBERON:0007227	72.26	gold quality
trabecular bone tissue	UBERON:0002483	72.13	gold quality
placenta	UBERON:0001987	72.04	gold quality
prostate gland	UBERON:0002367	72.04	gold quality
right frontal lobe	UBERON:0002810	71.81	gold quality
brain	UBERON:0000955	71.68	gold quality
duodenum	UBERON:0002114	71.51	gold quality
female reproductive system	UBERON:0000474	71.46	gold quality
upper leg skin	UBERON:0004262	71.44	gold quality
Ammon’s horn	UBERON:0001954	71.20	gold quality
medulla oblongata	UBERON:0001896	71.15	gold quality
metanephros	UBERON:0000081	71.10	gold quality
forebrain	UBERON:0001890	71.01	gold quality
decidua	UBERON:0002450	70.93	gold quality
intestine	UBERON:0000160	70.84	gold quality
epithelium of mammary gland	UBERON:0003244	70.71	gold quality
ectocervix	UBERON:0012249	70.68	gold quality
mammary duct	UBERON:0001765	70.62	gold quality
right coronary artery	UBERON:0001625	70.61	gold quality
endometrium	UBERON:0001295	70.51	gold quality
vagina	UBERON:0000996	70.34	gold quality
ovary	UBERON:0000992	70.28	gold quality
islet of Langerhans	UBERON:0000006	70.23	gold quality
endocervix	UBERON:0000458	70.16	gold quality
gingival epithelium	UBERON:0001949	70.13	silver quality
fallopian tube	UBERON:0003889	70.08	gold quality
ventral tegmental area	UBERON:0002691	70.04	gold quality
descending thoracic aorta	UBERON:0002345	70.03	gold quality

Single-cell (SCXA)

Detected in 1 experiment(s), a significant marker in 0.

Experiment	Marker?	Max mean expression
E-ANND-3	no	5.37

HPA expression

RNA tissue specificity: Low tissue specificity

showing 60 of 80 HPA tissues / cells by nTPM:

Tissue / cell	Axis	nTPM	Protein (IHC)
Cerebral cortex	tissue	13.4	medium
Occipital cortex	tissue	13.4
Postcentral gyrus	tissue	13.0
Somatosensory cortex	tissue	13.0
Frontal cortex	tissue	10.8
Thalamus	tissue	9.3
Locus coeruleus	tissue	8.7
Hippocampal formation	tissue	8.5
Entorhinal cortex	tissue	8.5
Pons	tissue	8.0
Temporal cortex	tissue	7.8
Prefrontal cortex	tissue	7.7
Motor cortex	tissue	7.6
Midbrain	tissue	7.3
Retrosplenial and cingulate cortex	tissue	7.1
Retina	tissue	6.6
Retrosplenial cortex	tissue	6.0
Superior colliculi	tissue	5.8
Hippocampus	tissue	5.8	high
Insular cortex	tissue	5.8
Seminal vesicle	tissue	4.5	low
Cerebellum	tissue	4.4	medium
Spinal cord	tissue	4.2
Periaqueductal gray	tissue	4.2
Amygdala	tissue	4.0
Prostate	tissue	4.0	low
Medulla oblongata	tissue	3.9
Testis	tissue	3.8	medium
Hypothalamus	tissue	3.8
Endometrium 1	tissue	3.6	not detected
Urinary bladder	tissue	3.4	low
Nucleus accumbens	tissue	3.4
Vagina	tissue	3.2	medium
Smooth muscle	tissue	3.1	low
Substantia nigra	tissue	3.0
Ovary	tissue	2.9	not detected
Septum	tissue	2.8
Choroid plexus	tissue	2.7
Ventral forebrain	tissue	2.5
Rectum	tissue	2.4	medium
Caudate putamen	tissue	2.3
Cervix	tissue	2.2	low
Breast	tissue	2.1	medium
Esophagus	tissue	2.1	medium
Basal ganglia	tissue	2.1	medium
Gallbladder	tissue	2.1	high
Duodenum	tissue	2.1	low
Corpus callosum	tissue	2.1
Pituitary gland	tissue	2.0
Skin 1	tissue	2.0	medium
Lymph node	tissue	2.0	low
Colon	tissue	2.0	medium
Putamen	tissue	2.0
Placenta	tissue	2.0	medium
Tonsil	tissue	2.0	low
Olfactory bulb	tissue	2.0
Appendix	tissue	1.8	medium
Salivary gland	tissue	1.7	medium
Parathyroid gland	tissue	1.7	medium
Pancreas	tissue	1.7	medium

Brain sub-regions (HPA Brain Atlas): detected in 192; highest nTPM — Olfactory area (11.7), Postcentral gyrus, middle (11.4), Perirhinal gyrus (11.3), Transversal temporal gyrus, anterior (11.3), Precentral gyrus, middle (11.1).

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

Targeting LSM11 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific).

showing 30 of 274 miRNAs:

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-3613-3P	100.00	76.36	7965
HSA-MIR-29A-3P	100.00	73.11	1835
HSA-MIR-29B-3P	100.00	73.18	1833
HSA-MIR-29C-3P	100.00	73.15	1833
HSA-MIR-4476	100.00	68.18	2030
HSA-MIR-6876-5P	100.00	67.68	2126
HSA-MIR-4533	100.00	69.48	2758
HSA-MIR-429	100.00	73.44	2698
HSA-MIR-513A-5P	100.00	69.77	2465
HSA-MIR-450A-1-3P	100.00	69.33	1837
HSA-MIR-5692A	100.00	74.40	6850
HSA-MIR-6748-5P	100.00	65.81	1057
HSA-MIR-548C-3P	99.99	74.01	7587
HSA-MIR-371B-5P	99.99	75.34	4759
HSA-MIR-4500	99.99	72.72	2367
HSA-MIR-4789-3P	99.99	70.75	2484
HSA-MIR-186-5P	99.99	70.83	3707
HSA-MIR-513B-5P	99.99	69.96	2150
HSA-MIR-5696	99.98	72.36	4487
HSA-MIR-373-5P	99.98	75.36	4753
HSA-MIR-616-5P	99.98	75.58	4775
HSA-MIR-4775	99.98	75.00	6394
HSA-LET-7A-5P	99.98	72.29	1790
HSA-LET-7B-5P	99.98	72.31	1790
HSA-LET-7C-5P	99.98	72.29	1790
HSA-LET-7E-5P	99.98	72.29	1790
HSA-LET-7F-5P	99.98	72.56	1784
HSA-LET-7G-5P	99.98	72.37	1784
HSA-LET-7I-5P	99.98	72.37	1788
HSA-MIR-98-5P	99.98	72.33	1787

Functional genomics

gnomAD constraint: pLI 0.00212, LOEUF 0.93, missense Z -1.52 — population loss-of-function intolerance (pLI ≥ 0.9 = LoF-intolerant; lower LOEUF = more constrained). gnomAD

Regional missense constraint (gnomAD RMC): no regional variation along ENST00000286307 — one region, missense o/e 0.97. DepMap (CRISPR cell-line fitness): dependent in 83.6% of screened cell lines.

Most-dependent cell lines (DepMap gene-effect, lower = stronger; ≤ −0.5 shown): SK-N-AS (-1.547), KP-N-SI9s (-1.487), HLF (-1.371), Panc 03.27 (-1.318), SNU-620 (-1.302), PA-TU-8988T (-1.284), GCIY (-1.256), RD-ES (-1.241), KP-4 (-1.232), IST-MES2 (-1.228), GSU (-1.213), KALS-1 (-1.211), COR-L279 (-1.197), NCI-H2052 (-1.189), KP-N-RT-BM-1 (-1.185).

Literature-anchored findings (GeneRIF, showing 5)

• Lsm10 and Lsm11, which replace the Sm proteins D1 and D2 in the histone RNA processing U7 snRNPs, associate with pICln in vitro and in vivo without receiving sDMA modifications and with PRMT5 and SMN complexes (PMID:16087681)
• The overexpression of Lsm10 and Lsm11 increases the cellular levels of U7 snRNP but has no effect on histone pre-mRNA processing. (PMID:16914750)
• FLASH/Lsm11 complex bind a unique combination of polyadenylation factors (PMID:23071092)
• While the molecular basis for this altered cleavage activity is unknown, one possibility is that binding of Lsm10 and Lsm11 to the spliceosomal Sm site affects the overall geometry of the U7-specific Sm ring, resulting in misalignment of the CPSF73 endonuclease with the substrate. (PMID:31819999)
• cGAS-mediated induction of type I interferon due to inborn errors of histone pre-mRNA processing. (PMID:33230297)

Cross-species orthologs

5 orthologs

Organism	Symbol	Gene ID
danio_rerio	lsm11	ENSDARG00000090854
mus_musculus	Lsm11	ENSMUSG00000044847
rattus_norvegicus	Lsm11	ENSRNOG00000005450
drosophila_melanogaster	Lsm11	FBGN0033450
caenorhabditis_elegans		WBGENE00016791

Mouse-model phenotypes

Observed phenotypes of the mouse ortholog (MGI:1919540) from MGI (Alliance of Genome Resources) — knockout/mutant phenotypes, ranked by annotation count. 1 distinct phenotype terms.

Mouse phenotype (MP)	Records
increased mean corpuscular hemoglobin	1

Additional cross-species homologs

Sequence homologs in species beyond Ensembl Compara’s model organisms, by Diamond local protein alignment (% sequence identity; best hit per species). Lower-identity rows are more distant homologs. The matched accessions’ gene symbols aren’t in biobtree yet, so each row shows the UniProt accession.

Organism	UniProt	Identity	Method
Xenopus laevis	Q7T076	49.1%	Diamond
Dictyostelium discoideum	Q54HH8	43.1%	Diamond

Genomic neighbors (locus context)

Genes flanking this one on the chromosome (NCBI/Entrez gene neighborhood). Positional context only — some neighbors share regulatory elements (bidirectional promoters, antisense/overlapping transcripts), but chromosomal adjacency is not itself a functional relationship (see Interactions for that).

Symbol	Type	Entrez
C5orf52	protein-coding	100190949
SOX30	protein-coding	11063
THG1L	protein-coding	54974
CLINT1	protein-coding	9685

Protein

Protein identifiers

U7 snRNA-associated Sm-like protein LSm11 — P83369 (reviewed: P83369)

All UniProt accessions (1): P83369

UniProt curated annotations — full annotation on UniProt →

Function. Component of the U7 snRNP complex that is involved in the histone 3’-end pre-mRNA processing. Increases U7 snRNA levels but not histone 3’-end pre-mRNA processing activity, when overexpressed. Required for cell cycle progression from G1 to S phases. Binds specifically to the Sm-binding site of U7 snRNA.

Subunit / interactions. Component of the heptameric ring U7 snRNP complex, or U7 Sm protein core complex, at least composed of LSM10, LSM11, SNRPB, SNRPD3, SNRPE, SNRPF, SNRPG and U7 snRNA. Formation of the U7 snRNP is an ATP-dependent process mediated by a specialized SMN complex containing at least the Sm protein core complex and additionally, the U7-specific LSM10 and LSM11 proteins. Identified in a histone pre-mRNA complex, at least composed of ERI1, LSM11, SLBP, SNRPB, SYNCRIP and YBX1. Interacts (via the Sm domains) with CLNS1A. Interacts with SMN and ZNF473. Interacts with PRMT5 and WDR77.

Subcellular location. Nucleus.

Disease relevance. Aicardi-Goutieres syndrome 8 (AGS8) [MIM:619486] A form of Aicardi-Goutieres syndrome, a genetically heterogeneous disease characterized by cerebral atrophy, leukoencephalopathy, intracranial calcifications, chronic cerebrospinal fluid (CSF) lymphocytosis, increased CSF alpha-interferon, and negative serologic investigations for common prenatal infection. Clinical features as thrombocytopenia, hepatosplenomegaly and elevated hepatic transaminases along with intermittent fever may erroneously suggest an infective process. Severe neurological dysfunctions manifest in infancy as progressive microcephaly, spasticity, dystonic posturing and profound psychomotor retardation. Death often occurs in early childhood. AGS8 inheritance is autosomal recessive. The disease is caused by variants affecting the gene represented in this entry. Impaired histone 3’-end pre-mRNA processing caused by disease variants affects chromatin structure, relieving CGAS inhibition by nucleosomes. This activates the cGAS-STING pathway, triggering type-I interferon production and autoinflammation.

Domain organisation. The C-terminal SM 1 domain is both necessary for the binding to the Sm-binding site of U7 snRNA and U7 snRNP assembly. The N-terminal domain is essential for histone pre-mRNA cleavage. Amino acids 63-82 are sufficient to interact with ZNF473.

Similarity. Belongs to the snRNP Sm proteins family.

RefSeq proteins (1): NP_775762* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR001163	Sm_dom_euk/arc	Domain
IPR010920	LSM_dom_sf	Homologous_superfamily
IPR034109	Lsm11_M	Domain
IPR039267	Lsm11	Family
IPR047575	Sm	Domain
IPR060343	LSM11_N	Domain

Pfam: PF28412

UniProt features (28 total): strand 8, modified residue 5, region of interest 5, helix 3, compositionally biased region 2, chain 1, domain 1, cross-link 1, sequence variant 1, turn 1

Structure

Experimental structures (PDB)

4 structures by resolution:

PDB	Title	Method	Resolution (Å)
9NH5	CRYO-EM STRUCTURE OF HUMAN U7 SNRNP WITH METHYLATED noncleavable H2A* SUBSTRATE PRE-MRNA …	ELECTRON MICROSCOPY	2.82
9NH6	CRYO-EM STRUCTURE OF HUMAN U7 SNRNP WITH METHYLATED noncleavable H2A* SUBSTRATE PRE-MRNA …	ELECTRON MICROSCOPY	2.82
8G1U	Structure of the methylosome-Lsm10/11 complex	ELECTRON MICROSCOPY	2.83
6V4X	Cryo-EM structure of an active human histone pre-mRNA 3’-end processing machinery at 3.2 …	ELECTRON MICROSCOPY	3.2

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-P83369-F1	65.63	0.18

Human Protein Atlas

Protein class: Predicted intracellular proteins, Disease related genes, Human disease related genes, Essential proteins

Protein evidence: Evidence at protein level

Subcellular location (HPA, imaging): nucleoplasm; nuclear bodies

Antibody reliability (HPA): IH uncertain · IF supported

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Post-translational modifications (6)

Type	Positions
Phosphoserine	21, 154, 280, 15
Omega-n-methylarginine	41
Glycyl lysine isopeptide (lys-gly) (interchain with g-cter in sumo2)	120

Function

Pathways and Gene Ontology

Reactome pathways

3 curated (TAS) of 7; 0 disease pathways. Curated-first; evidence = TAS (manually curated) vs IEA (electronic inference).

7 pathways:

ID	Pathway	Evidence
R-HSA-73856	RNA Polymerase II Transcription Termination	curated
R-HSA-77588	SLBP Dependent Processing of Replication-Dependent Histone Pre-mRNAs	curated
R-HSA-111367	SLBP independent Processing of Histone Pre-mRNAs	curated
R-HSA-74160	Gene expression (Transcription)	—
R-HSA-8953854	Metabolism of RNA	—
R-HSA-75067	Processing of Capped Intronless Pre-mRNA	—
R-HSA-73857	RNA Polymerase II Transcription	—

MSigDB gene sets: 330 (showing top): GSE45365_NK_CELL_VS_CD8A_DC_MCMV_INFECTION_UP, GSE18804_SPLEEN_MACROPHAGE_VS_BRAIN_TUMORAL_MACROPHAGE_UP, GSE45365_NK_CELL_VS_CD8A_DC_DN, TGGTGCT_MIR29A_MIR29B_MIR29C, GOBP_CELL_CYCLE_PHASE_TRANSITION, GOBP_POSITIVE_REGULATION_OF_MITOTIC_CELL_CYCLE, GOBP_MACROMOLECULE_CATABOLIC_PROCESS, GOBP_RNA_METHYLATION, GOBP_POSITIVE_REGULATION_OF_G1_S_TRANSITION_OF_MITOTIC_CELL_CYCLE, GOBP_RNA_MODIFICATION, GOBP_REGULATION_OF_CELL_CYCLE, GOBP_MRNA_3_END_PROCESSING, GOBP_REGULATION_OF_CELL_CYCLE_G1_S_PHASE_TRANSITION, GOBP_POSITIVE_REGULATION_OF_CELL_CYCLE_PROCESS, GOBP_CELL_CYCLE_G1_S_PHASE_TRANSITION

GO Biological Process (6): mRNA 3’-end processing by stem-loop binding and cleavage (GO:0006398), 7-methylguanosine cap hypermethylation (GO:0036261), nuclear histone mRNA catabolic process (GO:0071045), positive regulation of G1/S transition of mitotic cell cycle (GO:1900087), regulation of chromatin organization (GO:1902275), mRNA processing (GO:0006397)

GO Molecular Function (3): U7 snRNA binding (GO:0071209), RNA binding (GO:0003723), protein binding (GO:0005515)

GO Cellular Component (7): nucleus (GO:0005634), nucleoplasm (GO:0005654), U7 snRNP (GO:0005683), telomerase holoenzyme complex (GO:0005697), nuclear body (GO:0016604), histone pre-mRNA 3’end processing complex (GO:0071204), ribonucleoprotein complex (GO:1990904)

Reactome top-level categories

4 top-level categories:

Category	Pathways
Processing of Capped Intronless Pre-mRNA	2
RNA Polymerase II Transcription	1
Gene expression (Transcription)	1
Metabolism of RNA	1

GO top-level categories

26 GO namespaces:

Category	Terms
nuclear protein-containing complex	2
ribonucleoprotein complex	2
histone mRNA metabolic process	1
mRNA 3’-end processing	1
RNA methylation	1
RNA capping	1
histone mRNA catabolic process	1
G1/S transition of mitotic cell cycle	1
positive regulation of mitotic cell cycle phase transition	1
positive regulation of cell cycle G1/S phase transition	1
regulation of G1/S transition of mitotic cell cycle	1
chromatin organization	1
regulation of cellular component organization	1
RNA processing	1
mRNA metabolic process	1
snRNA binding	1
nucleic acid binding	1
binding	1
intracellular membrane-bounded organelle	1
nuclear lumen	1
cellular anatomical structure	1
small nuclear ribonucleoprotein complex	1
catalytic complex	1
nucleoplasm	1
intracellular membraneless organelle	1
protein-containing complex	1

Experimentally-supported GO annotations

GO terms backed by direct experimental evidence (ECO experimental codes) — 9 of 16 annotations. The rest are phylogenetic / computational / electronic (IEA).

9 experimentally-supported GO terms:

GO term	NS	Evidence
mRNA 3’-end processing by stem-loop binding and cleavage	BP	mutant phenotype
positive regulation of G1/S transition of mitotic cell cycle	BP	mutant phenotype
regulation of chromatin organization	BP	mutant phenotype
U7 snRNP	CC	direct assay
nuclear body	CC	direct assay
nucleoplasm	CC	direct assay
nucleus	CC	direct assay
telomerase holoenzyme complex	CC	direct assay
U7 snRNA binding	MF	direct assay

Protein interactions and networks

STRING

showing 15 of 428 interactions by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
LSM11	LSM10	Q969L4	921
LSM11	CPSF3	Q9UKF6	914
LSM11	CASP8AP2	Q9UKL3	871
LSM11	NPAT	Q14207	862
LSM11	SLBP	Q14493	801
LSM11	SYMPK	Q92797	770
LSM11	SNRPD1	P13641	750
LSM11	LSM2	Q9Y333	738
LSM11	SNRPD2	P43330	732
LSM11	COIL	P38432	718
LSM11	CPSF2	Q9P2I0	711
LSM11	RNASEH2A	O75792	707
LSM11	CSTF2	P33240	688
LSM11	RNASEH2C	Q8TDP1	675
LSM11	SNRPD3	P43331	667

IntAct

Human interaction partners of LSM11 in IntAct, one row per partner (best MIscore; records = supporting IntAct interaction records).

1 partners by confidence:

Partner	Interaction type	MIscore	Records
RAB19	physical association	0.560	3

BioGRID (75 interactions; top human partners by supporting records): CLNS1A (Affinity Capture-MS; 4 records), SMN1 (Affinity Capture-MS; 4 records), SNRPF (Affinity Capture-MS; 3 records), DDX20 (Affinity Capture-MS; 2 records), GEMIN7 (Affinity Capture-MS; 2 records), KRAS (Affinity Capture-MS; 2 records), SNRPE (Affinity Capture-MS; 2 records), SNRPG (Affinity Capture-MS; 2 records), SNRPN (Affinity Capture-MS; 2 records), SSSCA1 (Affinity Capture-MS; 2 records), WDR77 (Affinity Capture-MS; 2 records), ARHGAP36 (Affinity Capture-MS), ATG16L1 (Proximity Label-MS), ATL2 (Affinity Capture-MS), COIL (Proximity Label-MS)

Protein complexes (CORUM) (1)

Experimentally-characterized complexes this protein is a subunit of (★ = the complex contains a known drug target).

1 complexes by size:

Complex	Subunits	Members
SMN complex, U7 snRNA specific	7	SNRPB, SNRPD3, SNRPE, SNRPF, SNRPG, LSM10, LSM11

Disease & clinical

Genetic variants

Variant evidence for LSM11: 61 ClinVar records (1 pathogenic / likely pathogenic); 2 GWAS associations. Per-variant detail is on Sugi Variant.

ClinVar

61 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	1
Likely pathogenic	0
Uncertain significance	49
Likely benign	7
Benign	0

Top pathogenic / likely-pathogenic (1)

Showing all 1 pathogenic / likely-pathogenic ClinVar records, ranked by ClinVar review status (expert panel → multiple submitters → single submitter), then by number of submitting labs.

Variant ID	HGVS	Classification	Review	Submitters
1202617	NM_173491.4(LSM11):c.631G>A (p.Gly211Ser)	Pathogenic	no assertion criteria provided	1

Per-variant reference — Sugi Variant

Explore LSM11’s pathogenic and likely-pathogenic variants individually — each with its ClinVar classification and conditions, applied ACMG criteria (ClinGen expert panel, where curated), the calibrated in-silico predictors (AlphaMissense, REVEL, SaProt, conservation), gnomAD frequency, and the predictor-disagreement QC signal — on Sugi Variant.

SpliceAI

Top 10 splice-impact sites by Δscore (adjacent positions with the same effect merged into one range; 33 predictions of 424):

Position(s)	Effect	Δscore	Sites
5:157751388–157751389	acceptor_loss	1.0000	6
5:157751530–157751531	donor_loss	1.0000	6
5:157753989	acceptor_gain	1.0000
5:157754958	donor_gain	1.0000
5:157751382	acceptor_gain	0.9900
5:157753988	acceptor_gain	0.9900
5:157754002–157754003	acceptor_loss	0.9900	6
5:157754088–157754089	donor_loss	0.9900	4
5:157754852–157754853	acceptor_loss	0.9900	6
5:157754937	donor_gain	0.9900

AlphaMissense

850 missense substitutions predicted likely pathogenic (of 2,275 scored), across 169 residues. Top 20 hotspot residues, ranked by the number of likely-pathogenic substitutions (of those reachable by a single-nucleotide change), then by mean score:

Residue	Likely-pathogenic substitutions	Mean am_pathogenicity	Max am_pathogenicity
M148	9	0.975	0.999
D191	8	1.000	1.000
N195	8	1.000	1.000
F347	8	0.998	1.000
D200	8	0.995	0.999
H342	8	0.995	1.000
H172	8	0.988	0.999
F190	8	0.988	1.000
F31	8	0.986	0.999
D202	8	0.983	0.995
F176	8	0.979	0.999
F193	8	0.968	1.000
F53	8	0.961	0.998
F226	8	0.961	0.993
N143	8	0.956	0.997
N352	8	0.953	0.999
F186	8	0.947	1.000
N55	8	0.906	0.997
H357	8	0.885	0.986
D334	8	0.880	0.950

HPA cancer prognostics

RNA cancer specificity: Low cancer specificity

Human Protein Atlas survival analysis — favorable = higher expression predicts better survival.

1 prognostic cancer types:

Cancer	Prognostic	p-value
Bladder Urothelial Carcinoma (TCGA)	favorable	0.000871

Disease associations

OMIM: gene MIM:617910 | disease phenotypes: MIM:619486

GenCC curated gene-disease

2 curated gene-disease records:

Disease	Classification	Inheritance	Records
Aicardi-Goutieres syndrome 8	Limited	Unknown	2
Tourette syndrome	No Known Disease Relationship	Unknown

Genomics England panels (PanelApp)

Clinical diagnostic gene panels including this gene (1 panels, 0 green/diagnostic-grade). Confidence: green = diagnostic, amber = moderate.

1 panels:

Panel	Rating
Fetal anomalies	amber

Mondo (2): Aicardi-Goutieres syndrome 8 (MONDO:0030361), Tourette syndrome (MONDO:0007661)

HPO phenotypes

showing 60 of 80 phenotypes (HPO-id order):

HPO	Term
HP:0000007	Autosomal recessive inheritance
HP:0000050	Hypoplastic male external genitalia
HP:0000054	Micropenis
HP:0000252	Microcephaly
HP:0000369	Low-set ears
HP:0000444	Convex nasal ridge
HP:0000496	Abnormality of eye movement
HP:0000501	Glaucoma
HP:0000508	Ptosis
HP:0000625	Eyelid coloboma
HP:0000639	Nystagmus
HP:0000737	Irritability
HP:0000819	Diabetes mellitus
HP:0000821	Hypothyroidism
HP:0000958	Dry skin
HP:0000965	Cutis marmorata
HP:0001063	Acrocyanosis
HP:0001087	Developmental glaucoma
HP:0001250	Seizure
HP:0001257	Spasticity
HP:0001263	Global developmental delay
HP:0001276	Hypertonia
HP:0001288	Gait disturbance
HP:0001332	Dystonia
HP:0001337	Tremor
HP:0001357	Plagiocephaly
HP:0001369	Arthritis
HP:0001433	Hepatosplenomegaly
HP:0001609	Hoarse voice
HP:0001639	Hypertrophic cardiomyopathy
HP:0001640	Cardiomegaly
HP:0001955	Unexplained fevers
HP:0002059	Cerebral atrophy
HP:0002071	Abnormality of extrapyramidal motor function
HP:0002079	Hypoplasia of the corpus callosum
HP:0002119	Ventriculomegaly
HP:0002132	Porencephalic cyst
HP:0002135	Basal ganglia calcification
HP:0002139	Arrhinencephaly
HP:0002187	Profound intellectual disability
HP:0002313	Spastic paraparesis
HP:0002315	Headache
HP:0002371	Loss of speech
HP:0002376	Developmental regression
HP:0002415	Leukodystrophy
HP:0002500	Abnormal cerebral white matter morphology
HP:0002510	Spastic tetraplegia
HP:0002514	Cerebral calcification
HP:0002650	Scoliosis
HP:0002828	Multiple joint contractures
HP:0002910	Elevated circulating hepatic transaminase concentration
HP:0002960	Autoimmunity
HP:0003552	Muscle stiffness
HP:0003577	Congenital onset
HP:0004322	Short stature
HP:0004374	Hemiplegia/hemiparesis
HP:0004809	Neonatal alloimmune thrombocytopenia
HP:0004942	Aortic aneurysm
HP:0004963	Calcification of the aorta
HP:0005550	Chronic lymphatic leukemia

GWAS associations

2 associations:

Study	Trait	p-value
GCST90002396_616	Mean reticulocyte volume	9e-16
GCST90002397_500	Mean spheric corpuscular volume	1e-15

EFO canonical traits (from GWAS)

1 canonical traits:

EFO ID	Trait name
EFO:0010701	mean reticulocyte volume

MeSH disease descriptors

1 disease descriptors:

Descriptor	Name	Tree numbers
D005879	Tourette Syndrome	C10.228.140.079.898; C10.228.662.825.800; C10.574.500.850; C16.320.400.820; F03.625.992.850

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (CPIC guideline: no)

CTD chemical–gene interactions

37 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Valproic Acid	affects cotreatment, increases expression, decreases expression	3
FR900359	increases phosphorylation	1
triphenyl phosphate	affects expression	1
trichostatin A	affects expression	1
sodium arsenite	increases abundance, increases expression, affects cotreatment	1
butyraldehyde	decreases expression	1
manganese chloride	increases abundance, increases expression, affects cotreatment	1
coumarin	decreases phosphorylation	1
pentanal	decreases expression	1
CGP 52608	affects binding, increases reaction	1
2-palmitoylglycerol	increases expression	1
4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	increases expression, affects cotreatment	1
abrine	decreases expression	1
dorsomorphin	affects cotreatment, increases expression	1
bisphenol S	increases expression	1
jinfukang	affects cotreatment, decreases expression	1
Arsenic Trioxide	increases expression	1
Vorinostat	decreases expression	1
Arsenic	affects cotreatment, increases abundance, increases expression	1
Benzo(a)pyrene	increases expression	1
Cisplatin	affects cotreatment, decreases expression	1
Dichlorodiphenyl Dichloroethylene	increases expression	1
Doxorubicin	decreases expression	1
Drugs, Chinese Herbal	increases expression	1
Ethyl Methanesulfonate	increases expression	1
Lead	affects expression	1
Manganese	increases abundance, increases expression, affects cotreatment	1
Methyl Methanesulfonate	increases expression	1
Naphthoquinones	increases expression	1
Smoke	decreases expression	1

Cellosaurus cell lines

1 cell lines: 1 cancer cell line

First 10 cell lines (id-ordered, not curated):

Cellosaurus	Name	Category	Sex
CVCL_F4PH	HyCyte Huh-7 stable cell line for hLSM11 overexpression	Cancer cell line	Male

Clinical trials (associated diseases)

Via MONDO — disease-level, not drug-specific.

showing 60 of 185 trials:

NCT	Phase	Status	Title
NCT00152750	Phase 4	UNKNOWN	Study of Clonidine on Sleep Architecture in Children With Tourette’s Syndrome (TS) and Comorbid ADHD
NCT00226824	Phase 4	TERMINATED	Safety Study of Galantamine in Tic Disorders
NCT00241176	Phase 4	COMPLETED	Open Label Trial of Aripiprazole in Children and Adolescents With Tourette’s Disorder
NCT00370838	Phase 4	COMPLETED	Comparison of Keppra and Clonidine in the Treatment of Tics
NCT01018056	Phase 4	COMPLETED	Developing New Treatments for Tourette Syndrome: Therapeutic Trials With Modulators of Glutamatergic Neurotransmission
NCT01547000	Phase 4	COMPLETED	Guanfacine in Children With Tic Disorders
NCT03239210	Phase 4	COMPLETED	Effects of Ondansetron in Obsessive-compulsive and Tic Disorders
NCT00004376	Phase 3	COMPLETED	Phase III Randomized, Double-Blind, Placebo-Controlled Study of Guanfacine for Tourette Syndrome and Attention Deficit Hyperactivity Disorder
NCT00206323	Phase 3	COMPLETED	A Randomized, Placebo-controlled, Tourette Syndrome Study.
NCT00206336	Phase 3	COMPLETED	An Open-label Study to Determine the Efficacy and Safety of Topiramate in the Treatment of Tourette Syndrome.
NCT00478842	Phase 3	COMPLETED	Pallidal Stimulation and Gilles de la Tourette Syndrome
NCT00681863	Phase 3	TERMINATED	Open-label Extension Study of Pramipexole in the Treatment of Children and Adolescents With Tourette Syndrome
NCT01501695	Phase 3	COMPLETED	Phase III Study of 5LGr to Treat Tic Disorder
NCT03087201	Phase 3	COMPLETED	CANNAbinoids in the Treatment of TICS (CANNA-TICS)
NCT03487783	Phase 3	COMPLETED	Aripiprazole Oral Solution in the Treatment of Children and Adolescents With Tourette’s Syndrome
NCT03567291	Phase 3	TERMINATED	Evaluation of Safety and Tolerability of Long-term TEV-50717 (Deutetrabenazine) for Treatment of Tourette Syndrome in Children and Adolescents
NCT03571256	Phase 3	COMPLETED	A Study to Test if TEV-50717 is Effective in Relieving Tics Associated With Tourette Syndrome (TS)
NCT06021522	Phase 3	ACTIVE_NOT_RECRUITING	A Study to Evaluate Long-term Safety of Ecopipam Tablets in Children, Adolescents and Adults With Tourette’s Disorder
NCT00004393	Phase 2	COMPLETED	Phase II Double Blind Placebo Controlled Trial of Risperidone in Tourette Syndrome
NCT00004652	Phase 2	COMPLETED	Phase II Pilot Controlled Study of Short Vs Longer Term Pimozide (Orap) Therapy in Tourette Syndrome
NCT00231985	Phase 2	COMPLETED	Effectiveness of Behavior Therapy and Psychosocial Therapy for the Treatment of Tourette Syndrome and Chronic Tic Disorder
NCT00311909	Phase 2	COMPLETED	Thalamic Deep Brain Stimulation for Tourette Syndrome
NCT00529308	Phase 2	COMPLETED	Transcranial Magnetic Stimulation (TMS) for Individuals With Tourette’s Syndrome
NCT00558467	Phase 2	COMPLETED	Pramipexole Pilot Phase II Study in Children and Adolescents With Tourette Disorder According to DSM-IV Criteria
NCT01043549	Phase 2	TERMINATED	Repetitive Transcranial Magnetic Stimulation of the Posterior Parietal Cortex in Patients Suffering From Gilles de la Tourette Syndrome
NCT01133353	Phase 2	WITHDRAWN	A Study of the Effectiveness and Safety of Tetrabenazine MR in Pediatric Subjects With Tourette’s Syndrome
NCT01475383	Phase 2	WITHDRAWN	Study Evaluating The Safety And Efficacy Of PF-03654746 In Adult Subjects With Tourette’s Syndrome
NCT01647269	Phase 2	COMPLETED	A Trial of Bilateral Deep Brain Stimulation to the Globus Pallidus Internum in Tourette Syndrome
NCT01904773	Phase 2	COMPLETED	Safety, Tolerability, Pharmacokinetic, and Efficacy Study of AZD5213 in Adolescents With Tourette’s Disorder
NCT02102698	Phase 2	COMPLETED	Ecopipam Treatment of Tourette’s Syndrome in Subjects 7-17 Years
NCT02217007	Phase 2	WITHDRAWN	A Trial Evaluating the Efficacy, Safety, and Pharmacokinetics of SNC-102 in Subjects With Tourette Syndrome
NCT02247206	Phase 2	COMPLETED	VoIP Delivered Behavior Therapy for Tourette Syndrome
NCT02581865	Phase 2	COMPLETED	Safety and Efficacy Study of NBI-98854 in Adults With Tourette Syndrome
NCT02619084	Phase 2	COMPLETED	Subthalamic Stimulation in Tourette’s Syndrome
NCT02679079	Phase 2	COMPLETED	Safety and Efficacy Study of NBI-98854 in Children and Adolescents With Tourette Syndrome
NCT02879578	Phase 2	COMPLETED	Safety and Tolerability Study of NBI-98854 for the Treatment of Subjects With Tourette Syndrome
NCT03066193	Phase 2	COMPLETED	Efficacy of a Therapeutic Combination of Dronabinol and PEA for Tourette Syndrome
NCT03247244	Phase 2	TERMINATED	Safety and Efficacy of Cannabis in Tourette Syndrome
NCT03325010	Phase 2	COMPLETED	Safety, Tolerability, and Efficacy of NBI-98854 for the Treatment of Pediatric Subjects With Tourette Syndrome
NCT03444038	Phase 2	COMPLETED	Open-Label Safety and Tolerability Study of NBI-98854 for the Treatment of Pediatric Subjects With Tourette Syndrome
NCT03530293	Phase 2	TERMINATED	Safety and Efficacy of NBI-98854 in Pediatric Subjects With Tourette Syndrome
NCT03625453	Phase 2	COMPLETED	Study of ABX-1431 in Adult Patients With Tourette Syndrome or Chronic Motor Tic Disorder
NCT03651726	Phase 2	UNKNOWN	A Study to Examine the Efficacy of a Therapeutic THX-110 for Tourette Syndrome
NCT03732534	Phase 2	TERMINATED	Rollover Study for Continuing NBI-98854 Administration in Pediatric Subjects With Tourette Syndrome
NCT03944447	Phase 2	UNKNOWN	Outcomes Mandate National Integration With Cannabis as Medicine
NCT04007991	Phase 2	COMPLETED	Ecopipam Tablets to Study Tourette’s Syndrome in Children and Adolescents
NCT04354103	Phase 2	TERMINATED	Atomoxetine in Patients With Tourette’s Syndrome
NCT04978428	Phase 2	COMPLETED	Epidiolex in Obsessive Compulsive Disorder and Related Disorders
NCT05126888	Phase 2	NOT_YET_RECRUITING	SCI-110 in the Treatment of Tourette Syndrome
NCT05434546	Phase 2	COMPLETED	A Study to Explore the Effect of Sepranolone in Tourette Syndrome
NCT06081348	Phase 2	RECRUITING	Sertraline vs. Placebo in the Treatment of Anxiety in Children and AdoLescents With NeurodevelopMental Disorders
NCT06194305	Phase 2	RECRUITING	Multimodal Profiling of Response to Pediatric Comprehensive Behavioral Intervention for Tics
NCT06315751	Phase 2	ACTIVE_NOT_RECRUITING	Efficacy and Safety of Gemlapodect (NOE-105) in Adults and Adolescents With Tourette Syndrome
NCT06678737	Phase 2	RECRUITING	CBIT+TMS R33 Phase
NCT00139308	Phase 1	COMPLETED	High Frequency Stimulation of the GPi or Thalamus in Tourette’s Syndrome
NCT00634556	Phase 1	COMPLETED	Dopaminergic Effects on Cortical Function in Tourette’s (Levodopa Protocol)
NCT00952601	Phase 1	TERMINATED	Pilot Study of the Modified Atkins Diet for Tourette Syndrome
NCT01440023	Phase 1	COMPLETED	Developing Cognitive Training for Tourette Syndrome
NCT01719523	Phase 1	COMPLETED	Open-Trial of EPI-743 for Adults With Tourette Syndrome
NCT02134080	Phase 1	TERMINATED	FAAH Inhibitor Trial for Adults With Tourette Syndrome