LTAP1

Summary

LTAP1 (lipid transport auxiliary protein 1, HGNC:29876) is a protein-coding gene on chromosome 1q21.3, encoding Lipid transport auxiliary protein 1 (Q9BWL3). Required for the formation of endoplasmic reticulum-plasma membrane junctions and functions as an accessory protein for bridge-like lipid transfer protein BLTP1, participating in lipid delivery between endoplasmic reticulum and cell membranes.

Involved in phagocytosis. Located in Golgi apparatus; cytosol; and mitochondrion.

Source: NCBI Gene 25912 — RefSeq curated summary.

At a glance

• GWAS associations: 9
• Clinical variants (ClinVar): 23 total — 1 pathogenic
• MANE Select transcript: NM_001098616

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:29876
Approved symbol	LTAP1
Name	lipid transport auxiliary protein 1
Location	1q21.3
Locus type	gene with protein product
Status	Approved
Aliases	NICE-3, DKFZp586G1722
Ensembl gene	ENSG00000143612
Ensembl biotype	protein_coding
OMIM	617428
Entrez	25912

Gene structure

Transcript identifiers

Ensembl transcripts: 18 — 14 protein_coding, 2 nonsense_mediated_decay, 2 protein_coding_CDS_not_defined

ENST00000350592, ENST00000362076, ENST00000368516, ENST00000368518, ENST00000368519, ENST00000368521, ENST00000470180, ENST00000483282, ENST00000493814, ENST00000640799, ENST00000648267, ENST00000882189, ENST00000882190, ENST00000882191, ENST00000882192, ENST00000940679, ENST00000940680, ENST00000958841

RefSeq mRNA: 8 — MANE Select: NM_001098616 NM_001098616, NM_001297717, NM_001297718, NM_001297720, NM_001297721, NM_001297723, NM_015449, NM_138740

CCDS: CCDS1061, CCDS1062, CCDS41404, CCDS72924, CCDS76219, CCDS76220

Canonical transcript exons

ENST00000368521 — 7 exons

Exon	Start	End
ENSE00000961109	154219836	154219937
ENSE00000961110	154214457	154214574
ENSE00000961112	154212458	154212624
ENSE00001284813	154206720	154207648
ENSE00001915171	154220342	154220590
ENSE00003502774	154213893	154213946
ENSE00003685514	154212320	154212378

Expression profiles

Bgee: expression breadth ubiquitous, 256 present calls, max score 99.77.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 116.8835 / max 619.8655, expressed in 1827 samples.

FANTOM5 promoters (3 alternative TSS)

Promoter ID	TPM avg	Samples expressed
14793	103.9375	1827
14794	11.6835	1797
14795	1.2625	787

Top tissues by expression

256 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
kidney epithelium	UBERON:0004819	99.77	gold quality
left ventricle myocardium	UBERON:0006566	99.77	gold quality
cardiac muscle of right atrium	UBERON:0003379	99.69	gold quality
tibialis anterior	UBERON:0001385	99.67	gold quality
ileal mucosa	UBERON:0000331	99.61	gold quality
deltoid	UBERON:0001476	99.61	gold quality
quadriceps femoris	UBERON:0001377	99.57	gold quality
vastus lateralis	UBERON:0001379	99.56	gold quality
myocardium	UBERON:0002349	99.56	gold quality
skeletal muscle tissue of biceps brachii	UBERON:0004502	99.52	gold quality
biceps brachii	UBERON:0001507	99.48	gold quality
upper arm skin	UBERON:0004263	99.40	gold quality
heart right ventricle	UBERON:0002080	99.28	gold quality
Brodmann (1909) area 46	UBERON:0006483	99.28	gold quality
skeletal muscle tissue of rectus abdominis	UBERON:0004511	99.27	gold quality
skeletal muscle tissue	UBERON:0001134	99.17	gold quality
adult organism	UBERON:0007023	99.15	gold quality
jejunal mucosa	UBERON:0000399	99.10	gold quality
nasal cavity epithelium	UBERON:0005384	99.06	gold quality
body of tongue	UBERON:0011876	99.06	gold quality
palpebral conjunctiva	UBERON:0001812	99.05	gold quality
muscle tissue	UBERON:0002385	99.03	gold quality
pons	UBERON:0000988	99.02	gold quality
jejunum	UBERON:0002115	99.02	gold quality
bronchial epithelial cell	CL:0002328	99.01	gold quality
bronchus	UBERON:0002185	98.98	gold quality
caput epididymis	UBERON:0004358	98.98	gold quality
corpus epididymis	UBERON:0004359	98.97	gold quality
epithelial cell of pancreas	CL:0000083	98.96	gold quality
cartilage tissue	UBERON:0002418	98.96	gold quality

Single-cell (SCXA)

Detected in 2 experiment(s), a significant marker in 1.

Experiment	Marker?	Max mean expression
E-GEOD-125970	no	3.25
E-ANND-3	no	0.00

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

40 targeting LTAP1, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-5692A	100.00	74.40	6850
HSA-MIR-432-3P	100.00	67.86	705
HSA-MIR-340-5P	100.00	72.50	4437
HSA-MIR-3667-3P	99.99	67.17	1636
HSA-MIR-3658	99.96	73.87	4379
HSA-MIR-1250-3P	99.96	70.04	4038
HSA-MIR-2110	99.96	66.68	1930
HSA-MIR-153-5P	99.89	73.86	6317
HSA-MIR-9902	99.89	69.15	2250
HSA-MIR-204-5P	99.79	71.62	2439
HSA-MIR-211-5P	99.79	71.65	2440
HSA-MIR-6505-5P	99.73	69.25	1595
HSA-MIR-1825	99.72	68.11	1089
HSA-MIR-494-3P	99.70	71.45	2795
HSA-MIR-3202	99.66	67.70	2737
HSA-MIR-6832-3P	99.52	70.44	1726
HSA-MIR-12123	99.52	71.79	2990
HSA-MIR-6081	99.48	66.07	1446
HSA-MIR-1275	99.47	67.90	2749
HSA-MIR-3911	99.38	66.95	1087
HSA-MIR-6853-3P	99.36	70.79	1558
HSA-MIR-625-5P	99.02	68.64	2031
HSA-MIR-4699-5P	98.99	67.50	1210
HSA-MIR-29B-1-5P	98.86	68.35	1364
HSA-MIR-4477A	98.83	69.75	2952
HSA-MIR-502-5P	98.77	66.51	906
HSA-MIR-4662A-5P	98.48	67.18	1007
HSA-MIR-619-3P	98.38	65.58	693
HSA-MIR-18B-3P	98.05	65.55	595
HSA-MIR-637	97.91	64.05	1517

Literature-anchored findings (GeneRIF, showing 1)

• our findings indicate that NICE-3 may contribute to human hepatocellular carcinoma by promoting cell proliferation. (PMID:23167344)

Cross-species orthologs

6 orthologs

Organism	Symbol	Gene ID
danio_rerio	C16H1orf43	ENSDARG00000055613
		ENSDARG00000116978
mus_musculus	4933434E20Rik	ENSMUSG00000027942
rattus_norvegicus	Ns5atp4	ENSRNOG00000017758
rattus_norvegicus	Ns5atp4-ps3	ENSRNOG00000027533
drosophila_melanogaster	CG6665	FBGN0034172

Protein

Protein identifiers

Lipid transport auxiliary protein 1 — Q9BWL3 (reviewed: Q9BWL3)

Alternative names: Hepatitis C virus NS5A-transactivated protein 4, Protein NICE-3, S863-3, Spigot ortholog

All UniProt accessions (7): Q9BWL3, A0A1W2PQP6, A0A1W2PQS0, A0A3B3IS96, Q09GN0, X6R6F3, X6R6S3

UniProt curated annotations — full annotation on UniProt →

Function. Required for the formation of endoplasmic reticulum-plasma membrane junctions and functions as an accessory protein for bridge-like lipid transfer protein BLTP1, participating in lipid delivery between endoplasmic reticulum and cell membranes. Regulates the phagocytosis of Gram-negative bacteria like L. pneumophila and E. coli, as well as Gram-positive bacteria such as S. aureus.

Subunit / interactions. Interacts with BLTP1 (via the N-terminus); the interaction is direct.

Subcellular location. Cell membrane. Golgi apparatus. Mitochondrion. Endoplasmic reticulum membrane.

Domain organisation. N-terminal region is required for phagocytosis of Gram negative bacterium.

Similarity. Belongs to the lipid transport auxiliary protein 1 family.

Isoforms (5)

UniProt ID	Names	Canonical?
Q9BWL3-1	1	yes
Q9BWL3-2	2, Nice-3
Q9BWL3-3	3
Q9BWL3-4	4
Q9BWL3-5	5

RefSeq proteins (8): NP_001092086, NP_001284646, NP_001284647, NP_001284649, NP_001284650, NP_001284652, NP_056264, NP_620077 (=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR010876	LTAP1	Family

Pfam: PF07406

UniProt features (10 total): splice variant 5, topological domain 2, chain 1, transmembrane region 1, sequence conflict 1

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q9BWL3-F1	73.35	0.27

Function

Pathways and Gene Ontology

Reactome pathways

0 pathways

MSigDB gene sets: 164 (showing top): FREAC2_01, HNF3ALPHA_Q6, RODRIGUES_THYROID_CARCINOMA_POORLY_DIFFERENTIATED_UP, GOBP_VESICLE_MEDIATED_TRANSPORT, FOXO4_01, FOXO1_01, GGGTGGRR_PAX4_03, PATIL_LIVER_CANCER, MODULE_239, USF_01, WTGAAAT_UNKNOWN, FOXJ2_01, HFH3_01, TGACATY_UNKNOWN, P300_01

GO Biological Process (2): in utero embryonic development (GO:0001701), phagocytosis (GO:0006909)

GO Molecular Function (0):

GO Cellular Component (5): mitochondrion (GO:0005739), Golgi apparatus (GO:0005794), cytosol (GO:0005829), membrane (GO:0016020), endoplasmic reticulum-plasma membrane contact site (GO:0140268)

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
cytoplasm	3
intracellular membrane-bounded organelle	2
cellular anatomical structure	2
chordate embryonic development	1
endocytosis	1
endomembrane system	1
organelle membrane contact site	1

Protein interactions and networks

STRING

488 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
LTAP1	EMC7	Q9NPA0	818
LTAP1	CRCT1	Q9UGL9	657
LTAP1	CHMP2A	O43633	637
LTAP1	PSMB4	P28070	606
LTAP1	S100A7A	Q86SG5	581
LTAP1	PSMB2	P31145	538
LTAP1	VPS29	Q9UBQ0	490
LTAP1	OR2T5	Q6IEZ7	447
LTAP1	REEP5	Q00765	439
LTAP1	RAB7A	P51149	423
LTAP1	CNTN3	Q9P232	415
LTAP1	VCP	P55072	414
LTAP1	CFAP141	Q5VU69	406
LTAP1	EMC2	Q15006	404
LTAP1	CABP2	Q9NPB3	379

IntAct

65 interactions, top by confidence:

A	B	Type	Score
ENTREP1	WWP2	psi-mi:“MI:0914”(association)	0.850
CFTR	ESYT2	psi-mi:“MI:2364”(proximity)	0.710
ADCY9	NEMP1	psi-mi:“MI:0914”(association)	0.640
KCNA5	TMEM223	psi-mi:“MI:0914”(association)	0.530
CXCR4	TMEM120B	psi-mi:“MI:0914”(association)	0.530
SLC39A4	TMEM120B	psi-mi:“MI:0914”(association)	0.530
BTNL3	FAM171A2	psi-mi:“MI:0914”(association)	0.530
KCNS3	UPK3BL1	psi-mi:“MI:0914”(association)	0.530
LRRTM1	UPK3BL1	psi-mi:“MI:0914”(association)	0.530
ZNRF4	UPK3BL1	psi-mi:“MI:0914”(association)	0.530
MRAP2	GOLIM4	psi-mi:“MI:0914”(association)	0.530
GDPD5	GOLIM4	psi-mi:“MI:0914”(association)	0.530
CNGA3	C2CD2L	psi-mi:“MI:0914”(association)	0.530
PCDHB7	C2CD2L	psi-mi:“MI:0914”(association)	0.530
KCNA10	GAPDHS	psi-mi:“MI:0914”(association)	0.530
CHRNA9	CHEK1	psi-mi:“MI:0914”(association)	0.530
TEX264	PER1	psi-mi:“MI:0914”(association)	0.530
CHRND	TPST2	psi-mi:“MI:0914”(association)	0.530
KCNJ6	MB21D2	psi-mi:“MI:0914”(association)	0.530
C1orf43	BDKRB1	psi-mi:“MI:0915”(physical association)	0.370
incE	STX7	psi-mi:“MI:0914”(association)	0.350
KCNA2	TMEM129	psi-mi:“MI:0914”(association)	0.350
TTMP	TMEM223	psi-mi:“MI:0914”(association)	0.350
TTYH1	TMEM223	psi-mi:“MI:0914”(association)	0.350
CHRNA4	TMEM223	psi-mi:“MI:0914”(association)	0.350
OR1M1	NBAS	psi-mi:“MI:0914”(association)	0.350
ZDHHC12	NBAS	psi-mi:“MI:0914”(association)	0.350
IL17RC	TMEM131L	psi-mi:“MI:0914”(association)	0.350
PDE3A	TMEM131L	psi-mi:“MI:0914”(association)	0.350
SIDT2	KLRG2	psi-mi:“MI:0914”(association)	0.350

BioGRID (135): C1orf43 (Affinity Capture-RNA), C1orf43 (Affinity Capture-RNA), C1orf43 (Affinity Capture-MS), C1orf43 (Affinity Capture-MS), C1orf43 (Affinity Capture-MS), C1orf43 (Affinity Capture-MS), C1orf43 (Affinity Capture-MS), C1orf43 (Affinity Capture-MS), C1orf43 (Affinity Capture-MS), C1orf43 (Affinity Capture-MS), C1orf43 (Affinity Capture-MS), C1orf43 (Affinity Capture-MS), C1orf43 (Affinity Capture-MS), C1orf43 (Affinity Capture-MS), C1orf43 (Affinity Capture-MS)

ESM2 similar proteins: A0A1B0GVV1, A0M8S0, A0M8T1, A0M8U1, A3KN28, A4D7R9, A9JRA0, B1AZA5, E9Q2Z6, P01134, P48030, Q00PJ0, Q07DV5, Q07DW9, Q07DX8, Q07DY8, Q07E08, Q07E45, Q09YH4, Q09YI5, Q09YJ7, Q09YK8, Q09YN2, Q108U3, Q1RLU8, Q2IBA8, Q2IBD0, Q2IBE0, Q2IBE8, Q2PG42, Q2QL86, Q2QLA6, Q2QLB7, Q2QLD7, Q2QLE8, Q2QLG2, Q3KRC4, Q3SXP7, Q5T292, Q68FW3

Diamond homologs: Q5E943, Q5RF08, Q5XII8, Q8R092, Q9BWL3

SIGNOR signaling

0 interactions.

Enriched among interaction partners

Reactome pathways and GO biological processes over-represented among this gene’s 95 IntAct physical interaction partners (hypergeometric vs the genome-wide background, BH-FDR, gene-set size 15–500, ranked by fold). A functional readout of the neighbourhood — distinct from this gene’s own memberships above, and biased toward well-studied / hub proteins, so read it as themes rather than proof.

Reactome pathways:

Pathway	Partners	Fold	FDR
Neurotransmitter receptors and postsynaptic signal transmission	7	12.5×	2e-04
Potassium Channels	5	12.0×	1e-03
Transmission across Chemical Synapses	7	9.5×	4e-04
Neuronal System	12	9.5×	8e-07
Transport of small molecules	9	4.0×	4e-03

GO biological processes:

GO term	Partners	Fold	FDR
action potential	5	23.0×	5e-04
regulation of membrane potential	7	20.7×	2e-05
potassium ion transport	6	14.7×	5e-04
monoatomic ion transmembrane transport	5	13.3×	2e-03
protein homooligomerization	6	9.4×	2e-03
potassium ion transmembrane transport	5	8.7×	6e-03
positive regulation of cytosolic calcium ion concentration	5	7.5×	1e-02

Disease & clinical

Clinical variants and AI predictions

ClinVar

23 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	1
Likely pathogenic	0
Uncertain significance	1
Likely benign	0
Benign	0

Top pathogenic / likely-pathogenic (1)

Variant ID	HGVS	Classification
60011	GRCh38/hg38 1q21.3(chr1:153759563-154219803)x1	Pathogenic

SpliceAI

941 predictions. Top by Δscore:

Variant	Effect	Δscore
1:154207647:CC:C	acceptor_gain	1.0000
1:154207648:CC:C	acceptor_gain	1.0000
1:154212452:GCTTA:G	donor_loss	1.0000
1:154212453:CTTA:C	donor_loss	1.0000
1:154212454:TTACC:T	donor_loss	1.0000
1:154212455:TACC:T	donor_loss	1.0000
1:154212456:ACC:A	donor_gain	1.0000
1:154212456:ACCCC:A	donor_loss	1.0000
1:154212457:CCC:C	donor_gain	1.0000
1:154212519:ACAC:A	donor_gain	1.0000
1:154212520:CACC:C	donor_gain	1.0000
1:154212620:GATCT:G	acceptor_gain	1.0000
1:154212621:ATCT:A	acceptor_gain	1.0000
1:154212623:CT:C	acceptor_gain	1.0000
1:154212624:TCTGT:T	acceptor_loss	1.0000
1:154212625:C:CC	acceptor_gain	1.0000
1:154212626:T:G	acceptor_loss	1.0000
1:154214427:A:AC	donor_gain	1.0000
1:154214428:C:CC	donor_gain	1.0000
1:154214453:ATAC:A	donor_loss	1.0000
1:154214454:TACT:T	donor_loss	1.0000
1:154214455:A:AC	donor_gain	1.0000
1:154214455:A:AT	donor_loss	1.0000
1:154214456:C:CG	donor_loss	1.0000
1:154214456:C:CT	donor_gain	1.0000
1:154214456:CT:C	donor_gain	1.0000
1:154214465:C:A	donor_gain	1.0000
1:154214583:A:C	acceptor_gain	1.0000
1:154207644:TAACC:T	acceptor_gain	0.9900
1:154207645:AACC:A	acceptor_gain	0.9900

AlphaMissense

1649 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
1:154219905:C:A	R33S	1.000
1:154219905:C:G	R33S	1.000
1:154219906:C:A	R33M	1.000
1:154219906:C:G	R33T	1.000
1:154220345:G:C	S21R	1.000
1:154220345:G:T	S21R	1.000
1:154220347:T:G	S21R	1.000
1:154220349:C:T	G20E	1.000
1:154220350:C:G	G20R	1.000
1:154220350:C:T	G20R	1.000
1:154207486:C:A	K243N	0.999
1:154207486:C:G	K243N	0.999
1:154207499:A:G	L239S	0.999
1:154212474:G:T	A164D	0.999
1:154213924:C:A	R103S	0.999
1:154213924:C:G	R103S	0.999
1:154213925:C:A	R103M	0.999
1:154213925:C:G	R103T	0.999
1:154219843:G:T	A54D	0.999
1:154219852:C:T	G51E	0.999
1:154219853:C:G	G51R	0.999
1:154219853:C:T	G51R	0.999
1:154219891:A:G	F38S	0.999
1:154219895:G:T	R37S	0.999
1:154219900:A:C	I35S	0.999
1:154219900:A:G	I35T	0.999
1:154219900:A:T	I35N	0.999
1:154219903:T:G	Q34P	0.999
1:154219908:C:A	K32N	0.999
1:154219908:C:G	K32N	0.999

dbSNP variants (sampled 300 via entrez): RS1000488447 (1:154208900 A>G), RS1000674737 (1:154208977 A>C), RS1000876453 (1:154207026 A>G), RS1000972075 (1:154212874 T>C), RS1001040845 (1:154218291 A>G,T), RS1001067363 (1:154213513 T>C), RS1001069079 (1:154207362 G>A), RS1001309662 (1:154218503 C>G), RS1001352044 (1:154218385 G>A), RS1001417321 (1:154207659 G>C), RS1002086919 (1:154221013 GGCGGCAGCGGCA>G,GGCGGCAGCGGCAGCGGCA,GGCGGCAGCGGCAGCGGCAGCGGCA), RS1002434522 (1:154213259 A>G), RS1002936747 (1:154210791 A>G), RS1002992267 (1:154216006 T>C), RS1003040598 (1:154210282 G>A,C)

Disease associations

OMIM: gene MIM:617428 | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

9 associations (top):

Study	Trait	p-value
GCST010142_92	Fish- and plant-related diet	6.000000e-14
GCST010696_22	Cortical thickness (min-P)	4.000000e-10
GCST010697_50	Cortical surface area (min-P)	1.000000e-12
GCST010698_81	Subcortical volume (min-P)	1.000000e-23
GCST010699_7	Brain morphology (min-P)	1.000000e-10
GCST010700_11	Cortical thickness (MOSTest)	4.000000e-13
GCST010701_73	Cortical surface area (MOSTest)	4.000000e-09
GCST010702_45	Subcortical volume (MOSTest)	4.000000e-10
GCST010703_276	Brain morphology (MOSTest)	2.000000e-15

EFO canonical traits (3, from GWAS)

EFO ID	Trait name
EFO:0008111	diet measurement
EFO:0004346	neuroimaging measurement
EFO:0004840	cortical thickness

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

34 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Valproic Acid	affects cotreatment, increases expression, affects expression, decreases methylation	6
aristolochic acid I	increases expression	1
FR900359	increases phosphorylation	1
triphenyl phosphate	affects expression	1
uranyl acetate	affects expression	1
bisphenol A	affects expression	1
trichostatin A	affects expression	1
beta-lapachone	increases expression	1
tris(1,3-dichloro-2-propyl)phosphate	increases expression	1
perfluorooctane sulfonic acid	increases expression	1
K 7174	increases expression	1
4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	affects cotreatment, increases expression	1
dorsomorphin	affects cotreatment, increases expression	1
4-(4-((5-(4,5-dimethyl-2-nitrophenyl)-2-furanyl)methylene)-4,5-dihydro-3-methyl-5-oxo-1H-pyrazol-1-yl)benzoic acid	decreases expression	1
Bortezomib	decreases expression	1
Irinotecan	decreases expression	1
Sunitinib	increases expression	1
Cadmium	increases abundance, increases expression	1
Doxorubicin	increases expression	1
Gasoline	affects cotreatment, increases abundance, increases expression	1
Hydrogen Peroxide	decreases expression, affects cotreatment, increases expression	1
Nickel	increases expression	1
Polycyclic Aromatic Hydrocarbons	increases abundance, increases expression, affects cotreatment	1
Smoke	decreases expression	1
Dronabinol	increases expression	1
Theophylline	affects cotreatment, increases expression	1
Thiram	decreases expression	1
Tobacco Smoke Pollution	increases expression	1
Uranium	affects expression	1
Aflatoxin B1	increases expression	1

Cellosaurus cell lines

5 cell lines: 4 cancer cell line, 1 transformed cell line

First 10 cell lines (id-ordered, not curated):

Cellosaurus	Name	Category	Sex
CVCL_B2T9	Abcam HEK293T C1orf43 KO	Transformed cell line	Female
CVCL_SG23	HAP1 C1orf43 (-) 1	Cancer cell line	Male
CVCL_SG24	HAP1 C1orf43 (-) 2	Cancer cell line	Male
CVCL_SG25	HAP1 C1orf43 (-) 3	Cancer cell line	Male
CVCL_SG26	HAP1 C1orf43 (-) 4	Cancer cell line	Male

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.