LTF

Summary

LTF (lactotransferrin, HGNC:6720) is a protein-coding gene on chromosome 3p21.31, encoding Lactotransferrin (P02788). Transferrins are iron binding transport proteins which can bind two Fe(3+) ions in association with the binding of an anion, usually bicarbonate.

This gene is a member of the transferrin family of genes and its protein product is found in the secondary granules of neutrophils. The protein is a major iron-binding protein in milk and body secretions with an antimicrobial activity, making it an important component of the non-specific immune system. The protein demonstrates a broad spectrum of properties, including regulation of iron homeostasis, host defense against a broad range of microbial infections, anti-inflammatory activity, regulation of cellular growth and differentiation and protection against cancer development and metastasis. Antimicrobial, antiviral, antifungal and antiparasitic activity has been found for this protein and its peptides. Activity against both DNA and RNA viruses has been found, including activity against SARS-CoV-2, and HIV.

Source: NCBI Gene 4057 — RefSeq curated summary.

At a glance

• GWAS associations: 7
• Clinical variants (ClinVar): 141 total
• Druggable target: yes
• MANE Select transcript: NM_002343

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:6720
Approved symbol	LTF
Name	lactotransferrin
Location	3p21.31
Locus type	gene with protein product
Status	Approved
Aliases	HLF2
Ensembl gene	ENSG00000012223
Ensembl biotype	protein_coding
OMIM	150210
Entrez	4057

Gene structure

Transcript identifiers

Ensembl transcripts: 13 — 10 protein_coding, 2 protein_coding_CDS_not_defined, 1 retained_intron

ENST00000231751, ENST00000417439, ENST00000426532, ENST00000431944, ENST00000443496, ENST00000462667, ENST00000478874, ENST00000493056, ENST00000498301, ENST00000947210, ENST00000947211, ENST00000947212, ENST00000947213

RefSeq mRNA: 4 — MANE Select: NM_002343 NM_001199149, NM_001321121, NM_001321122, NM_002343

CCDS: CCDS33747, CCDS56251, CCDS82763

Canonical transcript exons

ENST00000231751 — 17 exons

Exon	Start	End
ENSE00000492524	46447308	46447398
ENSE00000492526	46445281	46445436
ENSE00000492527	46443441	46443582
ENSE00000767138	46446440	46446493
ENSE00000767140	46448863	46449017
ENSE00000767141	46449854	46450028
ENSE00000825945	46437940	46438129
ENSE00000825946	46450495	46450673
ENSE00000825947	46454305	46454360
ENSE00001078630	46456290	46456398
ENSE00001289842	46435645	46436229
ENSE00001607578	46464825	46464905
ENSE00003460363	46459656	46459819
ENSE00003464184	46455295	46455442
ENSE00003475503	46455796	46455978
ENSE00003507305	46439296	46439480
ENSE00003641462	46441416	46441483

Expression profiles

Bgee: expression breadth ubiquitous, 224 present calls, max score 99.93.

FANTOM5 (CAGE): breadth broad, TPM avg 60.8386 / max 38602.3123, expressed in 408 samples.

FANTOM5 promoters (6 alternative TSS)

Promoter ID	TPM avg	Samples expressed
41988	60.2383	198
41989	0.3778	188
41985	0.0759	18
41981	0.0714	15
41986	0.0415	16
41987	0.0337	11

Top tissues by expression

295 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
trachea	UBERON:0003126	99.93	gold quality
trabecular bone tissue	UBERON:0002483	99.89	gold quality
olfactory segment of nasal mucosa	UBERON:0005386	99.84	gold quality
parotid gland	UBERON:0001831	99.83	gold quality
bone marrow cell	CL:0002092	99.73	gold quality
bone marrow	UBERON:0002371	99.72	gold quality
pylorus	UBERON:0001166	99.59	gold quality
seminal vesicle	UBERON:0000998	99.58	gold quality
corpus epididymis	UBERON:0004359	99.05	gold quality
bone element	UBERON:0001474	97.69	gold quality
epithelium of mammary gland	UBERON:0003244	97.62	gold quality
mammary duct	UBERON:0001765	97.60	gold quality
cauda epididymis	UBERON:0004360	96.48	gold quality
nasopharynx	UBERON:0001728	96.39	gold quality
epithelium of nasopharynx	UBERON:0001951	96.39	gold quality
saliva-secreting gland	UBERON:0001044	96.35	gold quality
tonsil	UBERON:0002372	95.60	gold quality
minor salivary gland	UBERON:0001830	95.47	gold quality
mammary gland	UBERON:0001911	95.35	gold quality
thoracic mammary gland	UBERON:0005200	95.34	gold quality
cardia of stomach	UBERON:0001162	95.21	gold quality
bronchial epithelial cell	CL:0002328	94.25	gold quality
caput epididymis	UBERON:0004358	93.99	gold quality
nasal cavity mucosa	UBERON:0001826	93.16	gold quality
bronchus	UBERON:0002185	93.05	gold quality
epithelium of bronchus	UBERON:0002031	92.80	gold quality
vermiform appendix	UBERON:0001154	91.77	gold quality
lacrimal gland	UBERON:0001817	90.62	gold quality
spleen	UBERON:0002106	90.11	gold quality
mouth mucosa	UBERON:0003729	90.03	gold quality

Single-cell (SCXA)

Detected in 8 experiment(s), a significant marker in 8.

Experiment	Marker?	Max mean expression
E-MTAB-9801	yes	47752.64
E-MTAB-9841	yes	21997.08
E-MTAB-10885	yes	15920.57
E-GEOD-150728	yes	14923.13
E-MTAB-10855	yes	14854.61
E-CURD-112	yes	4194.48
E-CURD-98	yes	124.07
E-ANND-3	no	0.00

Regulation

Is transcription factor: no

Upstream regulators (CollecTRI, top): CEBPA, CEBPE, CEBPG, ESR1, ESRRA, ETS1, ETV5, FOXC1, GLI2, KLF5, NCOA1, NCOA3, NFKB, NR2F2, NR5A1, PGR, REL, SP1, STAT5A, SUPT20H, TFAP2A

miRNA regulators (miRDB)

19 targeting LTF, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-3065-5P	99.97	71.56	3281
HSA-MIR-6825-5P	99.96	69.81	3431
HSA-MIR-6763-5P	99.76	64.68	1767
HSA-MIR-3150A-3P	99.76	64.44	1640
HSA-MIR-4306	99.72	70.50	3630
HSA-MIR-3175	99.65	66.30	2031
HSA-MIR-7159-5P	99.53	72.12	2472
HSA-MIR-3123	99.47	67.15	2693
HSA-MIR-185-5P	99.35	68.60	2497
HSA-MIR-4644	99.35	69.12	2514
HSA-MIR-6852-5P	99.17	66.69	2073
HSA-MIR-6510-5P	99.14	66.59	1081
HSA-MIR-3619-5P	99.00	68.87	2308
HSA-MIR-214-3P	98.71	68.12	2128
HSA-MIR-761	98.71	68.07	2051
HSA-MIR-6792-5P	98.39	68.16	1330
HSA-MIR-939-5P	97.10	65.80	1579
HSA-MIR-874-5P	96.93	63.92	1014
HSA-MIR-1343-5P	96.48	66.06	1506

Literature-anchored findings (GeneRIF, showing 40)

• Bacteriostatic activity of human lactoferrin against Staphylococcus aureus is a function of its iron-binding properties and is not influenced by antibiotic resistance. (PMID:11549422)
• has been found to possess antibacterial, antimycotic, antiviral, antineoplastic and anti-inflammatory activity (PMID:11697537)
• Results show that lactoferrin gene expression is responsive to estrogen in the endometrium. (PMID:11756570)
• data demonstrate that human lactoferrin in the milk of transgenic dams promotes intestinal development of suckling neonates (PMID:11787671)
• genetic polymorphisms of the lactoferrin gene exist in selected exons and additional mutations of the lactoferrin gene do occur in the cancer cells (PMID:11908638)
• Studies of the ceruloplasmin-lactoferrin complex (PMID:11908641)
• Lactoferrin: influences on langerhans cells, epidermal cytokines, and cutaneous inflammation. (PMID:11911118)
• Lactoferrin mediates both antimicrobial and immunomodulatory activities with downstream effects on the outcome of immune pathology in infectious and inflammatory disease. (PMID:11937551)
• lactoferrin, a ubiquitous and abundant constituent of human external secretions, blocks biofilm development by the opportunistic pathogen Pseudomonas aeruginosa (PMID:12037568)
• Lactoferrin forms amyloid in the cornea in patients with lactoferrin mutation.However a heterozygotic Glu561Asp mutation appeared in 44.8% of healthy Japanese, suggesting that the mutation may not be essential for amyloid formation. (PMID:12065686)
• Lactotransferrin adherent to the surface epithelium may contribute to the activation of eosinophils that infiltrate the airway lumen. (PMID:12097406)
• generated monoclonal antibodies (mAbs) to human lactoferrin as tools to assist both structure-function studies and the development of recombinant human lactoferrin for applications in human health care (PMID:12165435)
• high-capacity multivalent metal-inducible mechanism for Fe acquisition from transferrin and lactoferrin (PMID:12165535)
• The mechanism of action for lactoferrin contains a component for differential regulation of cellular immune responses during in vivo models of sepsis. (PMID:12296849)
• LTF at concentration normally found in human colostrum blocks development of S. flexneri-induced inflammatory enteritis (PMID:12438385)
• Three specific sites are variably occupied by polar groups in lactoferrin mutants R210G, R210E, and R210L and other Ltf proteins, which when coupled with iron-release data give new insights into factors that most influence iron retention at low pH. (PMID:12450380)
• A highly amyloidogenic region of lactoferrin is reported and characterized (sequence of NAGDVAFV). (PMID:12525164)
• conclude that lactoferrin is a serine protease capable of cleaving arginine-rich sequences; speculate that lactoferrin may cleave arginine-rich sequences in a variety of microbial virulence proteins, contributing to its antimicrobial properties (PMID:12535064)
• Results identify the transcription start sites of the Delta lactoferrin (delta LF) in mammary gland and bone marrow and demonstrated that delta LF is the product of an alternative promoter present in the first intron of the lactoferrin gene. (PMID:12565886)
• Arg 25 and Arg 28 are the critical basic residues at the lactoferrin N terminus responsible for heparin binding (PMID:12646274)
• The content of LTF was studied in the CSF and blood of patients with tick-borne encephalitis of the meningeal and focal types. (PMID:12774664)
• New functions of lactoferrin and beta-casein in mammalian milk as cysteine protease inhibitors. They might play a role in antiseptic and antiinfectious functions due to cysteine protease inhibition of bacteria and viruses. (PMID:12788072)
• high prevalence of autoantibodies against human carbonic anhydrase II and lactoferrin strongly suggests the involvement of autoimmunity against the exocrine pancreas as well as the endocrine pancreas in some type 1 diabetic patients (PMID:12826902)
• lactoferrin has powerful anabolic, differentiating, and antiapoptotic effects on osteoblasts and inhibits osteoclastogenesis. (PMID:15166119)
• Recombinant compound shows promise as a safe and well-tolerated novel immunomodulatory anticancer agent. (PMID:15221967)
• Results describe the methylation profile in three regions of the human lactoferrin gene by bisulfite genomic sequencing. (PMID:15222484)
• Results suggest that delta-lactoferrin may play an important role in the regulation of normal cell growth. (PMID:15222485)
• Plasma levels do not affect the number of infections or ocmplications in sickle-cell anemia. (PMID:15297857)
• exerts its candidacidal effect through a mechanism different from membrane permeabilization described for other cationic peptides. (PMID:15364102)
• describes that lactoferrin specifically transactivates the p53 tumor suppressor gene through the activation of nuclear factor-kappaB and consequently regulates p53-responsive oncogenes (PMID:15378004)
• the context of the lactoferrin gene influences the ERalpha-mediated transcriptional activity. (PMID:15525592)
• Prognostic marker, high concentrations being associated with a longer overall breast cancer survival. (PMID:15543612)
• induced delayed tobramycin-killing effect on Pseudomonas aeruginosa cells correlated to induced cell depolarization (PMID:15793153)
• This work identifies lactoferrin in saliva as ligand for HHV-8 and suggests that this glycoprotein could be used as carrier for viral particles. (PMID:15955101)
• Lactotransferrin gene is inactivated by genetic and epigenetic mechanisms in lung cancer (PMID:16152584)
• In a pilot case-controlled study of aggressive periodontitis, analysis of 46 African-American patients and 78 controls showed that patients were twice as likely to express the G nucleotide (alanine) allele over controls. (PMID:16208406)
• Lactoferrin can be considered not only a primary defense factor against mucosal infections, but also a polyvalent regulator which interacts with several microbial, viral and host components involved in infectious processes. (PMID:16261253)
• Overview of multifunctional roles of lactoferrin (LTF) provides an update on our current understanding of the cellular and molecular mechanisms of action responsible for the biological activities of LTF. (PMID:16261256)
• Transcription of the LTF and transcription of the SLC38A3 gene, were impaired in all 5 RCC cell lines analyzed. Our data indicate these genes as putative tumour suppressor genes. (PMID:16432833)
• Women with minimal endometriosis had lower PF lactoferrin concentrations compared to both patients with high revised American Fertility Society classification scores and women with follicle ovarian cysts. (PMID:16644090)

Cross-species orthologs

3 orthologs

Organism	Symbol	Gene ID
danio_rerio	tfa	ENSDARG00000016771
mus_musculus	Ltf	ENSMUSG00000032496
rattus_norvegicus	Ltf	ENSRNOG00000031779

Paralogs (3): TF (ENSG00000091513), SRPRB (ENSG00000144867), MELTF (ENSG00000163975)

Protein

Protein identifiers

Lactotransferrin — P02788 (reviewed: P02788)

Alternative names: Growth-inhibiting protein 12, Talalactoferrin

All UniProt accessions (6): P02788, A0A804HKN5, C9JCF5, E7EQB2, E7ER44, V9HWI4

UniProt curated annotations — full annotation on UniProt →

Function. Transferrins are iron binding transport proteins which can bind two Fe(3+) ions in association with the binding of an anion, usually bicarbonate. Major iron-binding and multifunctional protein found in exocrine fluids such as breast milk and mucosal secretions. Has antimicrobial activity, which depends on the extracellular cation concentration. Antimicrobial properties include bacteriostasis, which is related to its ability to sequester free iron and thus inhibit microbial growth, as well as direct bactericidal properties leading to the release of lipopolysaccharides from the bacterial outer membrane. Can also prevent bacterial biofilm development in P.aeruginosa infection. Has weak antifungal activity against C.albicans. Has anabolic, differentiating and anti-apoptotic effects on osteoblasts and can also inhibit osteoclastogenesis, possibly playing a role in the regulation of bone growth. Promotes binding of species C adenoviruses to epithelial cells, promoting adenovirus infection. Can inhibit papillomavirus infections. Stimulates the TLR4 signaling pathway leading to NF-kappa-B activation and subsequent pro-inflammatory cytokine production while also interfering with the lipopolysaccharide (LPS)-stimulated TLR4 signaling. Inhibits neutrophil granulocyte migration to sites of apoptosis, when secreted by apoptotic cells. Stimulates VEGFA-mediated endothelial cell migration and proliferation. Binds heparin, chondroitin sulfate and possibly other glycosaminoglycans (GAGs). Also binds specifically to pneumococcal surface protein A (PspA), the lipid A portion of bacterial lipopolysaccharide (LPS), lysozyme and DNA. Lactoferricin binds to the bacterial surface and is crucial for the bactericidal functions. Has some antiviral activity against papillomavirus infection. N-terminal region shows strong antifungal activity against C.albicans. Contains two BBXB heparin-binding consensus sequences that appear to form the predominate functional GAG-binding site. Has antimicrobial activity and is able to permeabilize different ions through liposomal membranes. Has opioid antagonist activity. Shows preference for mu-receptor. Has opioid antagonist activity. Shows higher degrees of preference for kappa-receptors than for mu-receptors. Has opioid antagonist activity. Shows higher degrees of preference for kappa-receptors than for mu-receptors. The lactotransferrin transferrin-like domain 1 functions as a serine protease of the peptidase S60 family that cuts arginine rich regions. This function contributes to the antimicrobial activity. Shows a preferential cleavage at -Arg-Ser-Arg-Arg-|- and -Arg-Arg-Ser-Arg-|-, and of Z-Phe-Arg-|-aminomethylcoumarin sites. Transcription factor with antiproliferative properties and ability to induce cell cycle arrest. Binds to the DeltaLf response element found in the SKP1, BAX, DCPS, and SELENOH promoters.

Subunit / interactions. Monomer. Found in a complex with LTF, CLU, EPPIN and SEMG1. Found in a complex with MPO and LTF; interacts directly with CP, allows Fe(3+) incorporation into LTF and activation of CP ferroxidase activity. (Microbial infection) Interacts (via N-terminus) with Human adenovirus C serotype 5 hexon protein; this interaction seems to be part of the mechanisms of cellular entry by the virus.

Subcellular location. Secreted. Cytoplasmic granule Cytoplasm. Nucleus.

Tissue specificity. High levels are found in saliva and tears, intermediate levels in serum and plasma, and low levels in urine. In kidney, detected in the distal collecting tubules in the medulla but not in the cortical region or in blood vessels. Detected in peripheral blood neutrophils (at protein level). Isoform 1 and isoform DeltaLf are expressed in breast, prostate, spleen, pancreas, kidney, small intestine, lung, skeletal muscle, uterus, thymus and fetal liver. Isoform 1 is expressed in brain, testis and peripheral blood leukocytes; isoform DeltaLf is barely detectable in these tissues. Isoform DeltaLf is expressed in placenta, liver and ovary; isoform 1 is barely detectable in these tissues. In kidney, isoform 1 is expressed at high levels in the collecting tubules of the medulla but at very low levels in the cortex.

Post-translational modifications. Phosphorylation at Ser-10 activates the transcriptional activity. Phosphorylation at Ser-10 also promotes proteasomal degradation. Alternatively can undergo O-GlcNAcylation at Ser-10. O-GlcNAcylation at Ser-10 inhibits DNA binding and negatively regulates the transcriptional activity. Alternatively can undergo phosphorylation at Ser-10. Poly-N-acetyllactosaminic carbohydrate moiety seems to be needed for TLR4 activation.

Polymorphism. The sequence shown corresponds to the reference genome sequence and is likely to represent the minor allele, whereas most publications refer to the longer sequence containing variant Arg-22 ins. Insertion of the additional arginine in variant Arg-22 ins creates an N-terminal basic cluster of four arginines, all of which appear to be important for the full functionality of the protein, including bactericidal and antifungal activities as well as binding to glycosaminoglycans, pspA, LPS, lysozyme and DNA.

Miscellaneous. Contains a phosphoserine at position 10 (alternate). Contains a O-linked (GlcNAc) serine at position 10 (alternate). O-GlcNAcylation at Ser-10 inhibits DNA binding and negatively regulates DeltaLf transcriptional activity, whereas phosphorylation activates it. Phosphorylation at Ser-10 also promotes proteasomal degradation.

Similarity. Belongs to the transferrin family.

Isoforms (2)

UniProt ID	Names	Canonical?
P02788-1	1	yes
P02788-2	DeltaLf, Delta-lactoferrin

RefSeq proteins (4): NP_001186078, NP_001308050, NP_001308051, NP_002334* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR001156	Transferrin-like_dom	Domain
IPR016357	Transferrin	Family
IPR018195	Transferrin_Fe_BS	Binding_site
IPR030684	Lactotransferrin	Family

Pfam: PF00405

UniProt features (180 total): strand 38, helix 36, binding site 16, disulfide bond 16, sequence conflict 16, turn 11, mutagenesis site 11, region of interest 8, sequence variant 6, peptide 5, glycosylation site 4, site 3, active site 2, cross-link 2, domain 2, signal peptide 1, chain 1, modified residue 1, splice variant 1

Structure

Experimental structures (PDB)

34 structures, top 30 by resolution.

PDB	Method	Resolution (Å)
1H45	X-RAY DIFFRACTION	1.95
1CB6	X-RAY DIFFRACTION	2
1EH3	X-RAY DIFFRACTION	2
1H44	X-RAY DIFFRACTION	2
1LCF	X-RAY DIFFRACTION	2
1LCT	X-RAY DIFFRACTION	2
1DSN	X-RAY DIFFRACTION	2.05
1LFI	X-RAY DIFFRACTION	2.1
2HD4	X-RAY DIFFRACTION	2.15
1B0L	X-RAY DIFFRACTION	2.2
1FCK	X-RAY DIFFRACTION	2.2
1H43	X-RAY DIFFRACTION	2.2
1HSE	X-RAY DIFFRACTION	2.2
1LFG	X-RAY DIFFRACTION	2.2
1VFE	X-RAY DIFFRACTION	2.3
1BKA	X-RAY DIFFRACTION	2.4
2BJJ	X-RAY DIFFRACTION	2.4
1SQY	X-RAY DIFFRACTION	2.5
1VFD	X-RAY DIFFRACTION	2.5
1LFH	X-RAY DIFFRACTION	2.8
7JRD	X-RAY DIFFRACTION	2.85
2DP4	X-RAY DIFFRACTION	2.9
2PMS	X-RAY DIFFRACTION	2.91
1L5T	X-RAY DIFFRACTION	3
1LGB	X-RAY DIFFRACTION	3.3
1N76	X-RAY DIFFRACTION	3.4
7N88	ELECTRON MICROSCOPY	3.7
1U62	SOLUTION NMR
1XV4	SOLUTION NMR
1XV7	SOLUTION NMR

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-P02788-F1	95.06	0.94

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Catalytic / active sites (5): 92; 278 (nucleophile); 23 (interaction with pspa); 32 (interaction with pspa); 229 (important for iron binding)

Ligand- & substrate-binding residues (16): 79; 111; 136; 140; 142; 143; 211; 272; 414; 454; 480; 484 …

Post-translational modifications (3): 10, 379, 391

Disulfide bonds (16): 28–64, 38–55, 134–217, 176–192, 189–200, 250–264, 367–399, 377–390, 424–705, 446–668, 478–553, 502–696, 512–526, 523–536, 594–608, 646–651

Glycosylation sites (4): 10, 156, 497, 642

Mutagenesis-validated functional residues (11):

Position	Phenotype
20–23	abolishes binding to heparin, lipid a, lysozyme and dna.
20–22	greatly impairs binding to heparin, lipid a, lysozyme and dna. impairs antibacterial activity.
20–21	impairs binding to heparin, lipid a, lysozyme and dna.
79	impairs iron binding and changes domain closure.
92	almost no protease activity.
140	disrupts anion binding site and destabilizes iron binding.
229	destabilizes iron binding slightly.
229	destabilizes iron binding significantly.
270	no effect.
272	destabilizes iron binding.
278	no protease activity.

Function

Pathways and Gene Ontology

Reactome pathways

5 pathways

ID	Pathway
R-HSA-1222449	Mtb iron assimilation by chelation
R-HSA-6798695	Neutrophil degranulation
R-HSA-6799990	Metal sequestration by antimicrobial proteins
R-HSA-6803157	Antimicrobial peptides
R-HSA-977225	Amyloid fiber formation

MSigDB gene sets: 377 (showing top): GOBP_MYELOID_CELL_DIFFERENTIATION, VERHAAK_AML_WITH_NPM1_MUTATED_DN, MODULE_416, GOBP_NEGATIVE_REGULATION_OF_CELL_DEVELOPMENT, REACTOME_INNATE_IMMUNE_SYSTEM, GOBP_REGULATION_OF_OSTEOCLAST_DIFFERENTIATION, GOBP_ANTIMICROBIAL_HUMORAL_RESPONSE, GOBP_REGULATION_OF_PHOSPHORYLATION, GOBP_SKELETAL_SYSTEM_DEVELOPMENT, GOBP_MYELOID_CELL_DEVELOPMENT, GOBP_CELLULAR_RESPONSE_TO_LIPID, YAO_HOXA10_TARGETS_VIA_PROGESTERONE_UP, JAEGER_METASTASIS_DN, GOCC_SECRETORY_GRANULE, GOBP_TRANSITION_METAL_ION_TRANSPORT

GO Biological Process (33): ossification (GO:0001503), regulation of cytokine production (GO:0001817), innate immune response in mucosa (GO:0002227), proteolysis (GO:0006508), iron ion transport (GO:0006826), humoral immune response (GO:0006959), antibacterial humoral response (GO:0019731), antifungal humoral response (GO:0019732), killing of cells of another organism (GO:0031640), negative regulation of lipopolysaccharide-mediated signaling pathway (GO:0031665), regulation of tumor necrosis factor production (GO:0032680), negative regulation of ATP-dependent activity (GO:0032780), positive regulation of osteoblast proliferation (GO:0033690), positive regulation of toll-like receptor 4 signaling pathway (GO:0034145), negative regulation of apoptotic process (GO:0043066), positive regulation of canonical NF-kappaB signal transduction (GO:0043123), host-mediated suppression of viral proces (GO:0044793), negative regulation of viral genome replication (GO:0045071), positive regulation of osteoblast differentiation (GO:0045669), negative regulation of viral process (GO:0048525), defense response to Gram-negative bacterium (GO:0050829), obsolete positive regulation of NF-kappaB transcription factor activity (GO:0051092), bone morphogenesis (GO:0060349), antimicrobial humoral immune response mediated by antimicrobial peptide (GO:0061844), positive regulation of protein serine/threonine kinase activity (GO:0071902), positive regulation of bone mineralization involved in bone maturation (GO:1900159), negative regulation of single-species biofilm formation in or on host organism (GO:1900229), positive regulation of chondrocyte proliferation (GO:1902732), negative regulation of tumor necrosis factor (ligand) superfamily member 11 production (GO:2000308), negative regulation of osteoclast development (GO:2001205), immune system process (GO:0002376), monoatomic ion transport (GO:0006811), defense response to bacterium (GO:0042742)

GO Molecular Function (13): lipopolysaccharide binding (GO:0001530), DNA binding (GO:0003677), serine-type endopeptidase activity (GO:0004252), cysteine-type endopeptidase inhibitor activity (GO:0004869), iron ion binding (GO:0005506), heparin binding (GO:0008201), protein serine/threonine kinase activator activity (GO:0043539), membrane destabilizing activity (GO:0140912), protein binding (GO:0005515), peptidase activity (GO:0008233), serine-type peptidase activity (GO:0008236), hydrolase activity (GO:0016787), metal ion binding (GO:0046872)

GO Cellular Component (15): extracellular region (GO:0005576), obsolete extracellular space (GO:0005615), nucleus (GO:0005634), cytoplasm (GO:0005737), early endosome (GO:0005769), plasma membrane (GO:0005886), cell surface (GO:0009986), secretory granule (GO:0030141), protein-containing complex (GO:0032991), specific granule lumen (GO:0035580), specific granule (GO:0042581), recycling endosome (GO:0055037), extracellular exosome (GO:0070062), phagocytic vesicle lumen (GO:0097013), tertiary granule lumen (GO:1904724)

Reactome top-level categories

Rollup of top-4 pathways:

Category	Pathways
Innate Immune System	2
Latent infection - Other responses of Mtb to phagocytosis	1
Antimicrobial peptides	1
Metabolism of proteins	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
cellular anatomical structure	3
antimicrobial humoral response	2
endosome	2
multicellular organismal process	1
cytokine production	1
regulation of gene expression	1
regulation of multicellular organismal process	1
mucosal immune response	1
innate immune response	1
protein metabolic process	1
transition metal ion transport	1
immune response	1
defense response to bacterium	1
defense response to fungus	1
cell killing	1
disruption of cell in another organism	1
negative regulation of response to biotic stimulus	1
negative regulation of signal transduction	1
lipopolysaccharide-mediated signaling pathway	1
regulation of lipopolysaccharide-mediated signaling pathway	1
negative regulation of response to external stimulus	1
tumor necrosis factor production	1
regulation of tumor necrosis factor superfamily cytokine production	1
regulation of ATP-dependent activity	1
negative regulation of molecular function	1
ATP-dependent activity	1
positive regulation of cell population proliferation	1
osteoblast proliferation	1
regulation of osteoblast proliferation	1
toll-like receptor 4 signaling pathway	1
regulation of toll-like receptor 4 signaling pathway	1
positive regulation of pattern recognition receptor signaling pathway	1
apoptotic process	1
regulation of apoptotic process	1
negative regulation of programmed cell death	1
canonical NF-kappaB signal transduction	1
regulation of canonical NF-kappaB signal transduction	1
positive regulation of intracellular signal transduction	1
host-mediated perturbation of viral process	1
viral genome replication	1

Protein interactions and networks

STRING

3479 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
LTF	LALBA	P00709	999
LTF	MPO	P05164	997
LTF	CTSG	P08311	996
LTF	ALB	P02768	996
LTF	ELANE	P08246	996
LTF	LCN2	P30150	992
LTF	CLU	P10909	980
LTF	PRTN3	P15637	979
LTF	ITLN1	Q8WWA0	972
LTF	LRP2	P98164	968
LTF	CP	P00450	957
LTF	LPO	P22079	945
LTF	CAMP	P49913	937
LTF	BPI	P17213	933
LTF	LCN1	P31025	922

IntAct

178 interactions, top by confidence:

A	B	Type	Score
	LTF	psi-mi:“MI:0407”(direct interaction)	0.750
LTF		psi-mi:“MI:0915”(physical association)	0.750
LTF		psi-mi:“MI:0407”(direct interaction)	0.750
CFTR	ESYT2	psi-mi:“MI:0914”(association)	0.710
AEBP2	EED	psi-mi:“MI:0914”(association)	0.650
LTF	CALM	psi-mi:“MI:0407”(direct interaction)	0.560
LTF	IGDCC4	psi-mi:“MI:0915”(physical association)	0.540
IGDCC4	LTF	psi-mi:“MI:0407”(direct interaction)	0.540
	LTF	psi-mi:“MI:0407”(direct interaction)	0.540
	LTF	psi-mi:“MI:0915”(physical association)	0.540
FRMD1	A2ML1	psi-mi:“MI:0914”(association)	0.530
DDX31	IGLL5	psi-mi:“MI:0914”(association)	0.530
HBM	SCGB2A1	psi-mi:“MI:0914”(association)	0.530
ICE2	HP	psi-mi:“MI:0914”(association)	0.530
APCDD1	JCHAIN	psi-mi:“MI:0914”(association)	0.530

BioGRID (179): LTF (Affinity Capture-MS), LTF (Affinity Capture-MS), LTF (Affinity Capture-MS), LTF (Affinity Capture-MS), LTF (Affinity Capture-MS), LTF (Affinity Capture-MS), LTF (Affinity Capture-MS), LTF (Affinity Capture-MS), LTF (Co-fractionation), LTF (Affinity Capture-Western), LTF (Far Western), LTF (Affinity Capture-MS), LTF (Affinity Capture-MS), LTF (Affinity Capture-MS), LTF (Affinity Capture-MS)

ESM2 similar proteins: A2A863, A5A6I6, A5Z1X6, B0FYY4, E7E2N8, K9IMD0, O77698, O77811, O93429, O97490, P02787, P02788, P02789, P07228, P08071, P08582, P09571, P12346, P12606, P12607, P14632, P19134, P20233, P22297, P24627, P27425, P31226, P53712, P54996, P56410, P79815, P79819, P80426, P80429, Q02942, Q26643, Q27874, Q29443, Q29477, Q29492

Diamond homologs: A5A6I6, K9IMD0, O77698, O77811, O93429, O97490, P02787, P02788, P02789, P08071, P08582, P09571, P12346, P14632, P19134, P20233, P24627, P27425, P31226, P56410, P79815, P79819, P80426, P80429, Q02942, Q0VIL3, Q29443, Q29477, Q29545, Q501K5, Q6PGT3, Q92079, Q921I1, Q9DBD0, Q9IBF7, Q9R0R1, Q9TUM0, Q9VTZ5, P22297, Q26643

SIGNOR signaling

5 interactions.

A	Effect	B	Mechanism
CEBPE	“up-regulates quantity by expression”	LTF	“transcriptional regulation”
CEBPG	“up-regulates quantity by expression”	LTF	“transcriptional regulation”
LTF	“up-regulates quantity”	iron(3+)	relocalization
LTF	“up-regulates activity”	ITLN1	binding
PRKN	“down-regulates activity”	LTF	ubiquitination

Disease & clinical

Clinical variants and AI predictions

ClinVar

141 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	99
Likely benign	17
Benign	6

Top pathogenic / likely-pathogenic (0)

SpliceAI

2161 predictions. Top by Δscore:

Variant	Effect	Δscore
3:46436225:GAGGG:G	acceptor_gain	1.0000
3:46436226:AGGG:A	acceptor_gain	1.0000
3:46436227:GGG:G	acceptor_gain	1.0000
3:46436227:GGGC:G	acceptor_loss	1.0000
3:46436228:GG:G	acceptor_gain	1.0000
3:46436228:GGC:G	acceptor_loss	1.0000
3:46436229:GC:G	acceptor_loss	1.0000
3:46436230:C:CC	acceptor_gain	1.0000
3:46436231:T:G	acceptor_loss	1.0000
3:46437982:A:AC	donor_gain	1.0000
3:46437983:C:CC	donor_gain	1.0000
3:46439293:TACC:T	donor_loss	1.0000
3:46439294:A:AG	donor_loss	1.0000
3:46439295:C:A	donor_loss	1.0000
3:46439476:ATTTC:A	acceptor_gain	1.0000
3:46439477:TTTC:T	acceptor_gain	1.0000
3:46439478:TTC:T	acceptor_gain	1.0000
3:46439479:TC:T	acceptor_gain	1.0000
3:46439479:TCCT:T	acceptor_loss	1.0000
3:46439480:CC:C	acceptor_gain	1.0000
3:46439481:C:CC	acceptor_gain	1.0000
3:46439481:CT:C	acceptor_loss	1.0000
3:46439482:T:A	acceptor_loss	1.0000
3:46441410:ACCT:A	donor_loss	1.0000
3:46441411:CCTA:C	donor_loss	1.0000
3:46441412:CTACC:C	donor_loss	1.0000
3:46441413:TACC:T	donor_loss	1.0000
3:46441414:A:AC	donor_gain	1.0000
3:46441415:C:CC	donor_gain	1.0000
3:46445276:CTTA:C	donor_loss	1.0000

AlphaMissense

4647 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
3:46439461:C:A	W581C	0.998
3:46439461:C:G	W581C	0.998
3:46441481:C:G	C553S	0.996
3:46441482:A:T	C553S	0.996
3:46445330:C:A	W488C	0.996
3:46445330:C:G	W488C	0.996
3:46443561:C:G	C512S	0.995
3:46443562:A:T	C512S	0.995
3:46445361:C:G	C478S	0.995
3:46445362:A:T	C478S	0.995
3:46448945:C:G	C377S	0.995
3:46448946:A:T	C377S	0.995
3:46441451:A:C	F563C	0.994
3:46443441:C:G	R552P	0.994
3:46443489:C:G	C536S	0.994
3:46443490:A:T	C536S	0.994
3:46443560:A:C	C512W	0.994
3:46443561:C:T	C512Y	0.994
3:46443563:G:C	S511R	0.994
3:46443563:G:T	S511R	0.994
3:46443565:T:G	S511R	0.994
3:46445360:G:C	C478W	0.994
3:46448935:C:A	W380C	0.994
3:46448935:C:G	W380C	0.994
3:46448979:A:G	W366R	0.994
3:46448979:A:T	W366R	0.994
3:46445332:A:G	W488R	0.993
3:46445332:A:T	W488R	0.993
3:46455865:A:G	W144R	0.993
3:46455865:A:T	W144R	0.993

dbSNP variants (sampled 300 via entrez): RS1000017362 (3:46453976 C>T), RS1000032324 (3:46448408 A>T), RS1000032913 (3:46477189 C>G,T), RS1000090616 (3:46453711 T>C), RS1000101045 (3:46478282 G>A,T), RS1000213888 (3:46483099 C>T), RS1000244005 (3:46478231 C>A,T), RS1000267424 (3:46437830 T>C), RS1000342360 (3:46449142 G>GT), RS1000410138 (3:46441922 AGAGAGAGAGAGAGTGTGTGTGTGT>A), RS1000449134 (3:46455240 G>A,C,T), RS1000474153 (3:46481404 C>T), RS1000489315 (3:46477005 T>A), RS1000511349 (3:46443599 C>A,T), RS1000544892 (3:46483888 T>C)

Disease associations

OMIM: gene MIM:150210 | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

7 associations (top):

Study	Trait	p-value
GCST001060_1	AIDS progression	9.000000e-06
GCST002665_3	Cerebrospinal fluid levels of Alzheimer’s disease-related proteins	2.000000e-13
GCST003043_90	Inflammatory bowel disease	4.000000e-08
GCST003045_10	Ulcerative colitis	9.000000e-10
GCST003045_18	Ulcerative colitis	1.000000e-08
GCST006976_31	Macular thickness	4.000000e-19
GCST012368_2	Early-onset schizophrenia	2.000000e-09

EFO canonical traits (1, from GWAS)

EFO ID	Trait name
EFO:0006514	Alzheimer’s disease biomarker measurement

Drugs & pharmacology

Drug and pharmacology data

Is drug target: yes

ChEMBL targets (1): CHEMBL4523161 (SINGLE PROTEIN)

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

54 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
bisphenol A	affects cotreatment, increases expression, decreases methylation	2
tetrabromobisphenol A	increases expression	2
Fulvestrant	affects cotreatment, decreases methylation, decreases expression, decreases reaction, increases expression	2
Air Pollutants	increases abundance, increases expression	2
Estradiol	decreases reaction, affects cotreatment, increases expression, decreases expression	2
Smoke	increases abundance, increases expression	2
Tobacco Smoke Pollution	affects expression, decreases expression	2
triphenyl phosphate	affects expression	1
lead acetate	decreases expression	1
potassium persulfate	increases expression	1
2,5,2’,5’-tetrachlorobiphenyl	decreases expression	1
lipoteichoic acid	increases secretion, decreases reaction	1
terbufos	increases methylation	1
arsenite	decreases expression, decreases reaction	1
methylcholine	decreases reaction, increases secretion	1
sodium arsenite	decreases expression	1
cupric chloride	decreases expression	1
transplatin	decreases expression	1
4-nonylphenol	affects cotreatment, increases expression	1
di-n-butylphosphoric acid	affects expression	1
4-octylphenol	affects cotreatment, increases expression	1
corosolic acid	increases expression	1
hexabrominated diphenyl ether 153	increases expression	1
Irinotecan	decreases expression	1
Zoledronic Acid	increases expression	1
Allergens	increases expression	1
Arsenic	decreases expression	1
Atrazine	increases expression	1
Atropine	decreases reaction, increases secretion	1
Beclomethasone	decreases reaction, increases secretion, decreases secretion	1

ChEMBL screening assays

3 unique, capped per target: 3 binding

Representative assays (with source publication via chembl_document):

Assay ID	Type	Description	Source paper
CHEMBL4388733	Binding	Binding affinity to biotin-labeled lactoferrin (unknown origin) at 10 ug/ml in pH 7.4 Tris buffer by fluorescence microarray method	Synthetic glycopeptides reveal specific binding pattern and conformational change at O-mannosylated position of α-dystroglycan by POMGnT1 catalyzed GlcNAc modification. — Bioorg Med Chem

Cellosaurus cell lines

2 cell lines: 2 cancer cell line

First 10 cell lines (id-ordered, not curated):

Cellosaurus	Name	Category	Sex
CVCL_E2BQ	HAP1 LTF (-) 2	Cancer cell line	Male
CVCL_XQ24	HAP1 LTF (-) 1	Cancer cell line	Male

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.