MALL

Summary

MALL (mal, T cell differentiation protein like, HGNC:6818) is a protein-coding gene on chromosome 2q13, encoding MAL-like protein (Q13021).

This gene encodes an element of the machinery for raft-mediated trafficking in endothelial cells. The encoded protein, a member of the MAL proteolipid family, predominantly localizes in glycolipid- and cholesterol-enriched membrane (GEM) rafts. It interacts with caveolin-1.

Source: NCBI Gene 7851 — RefSeq curated summary.

At a glance

• Clinical variants (ClinVar): 87 total — 71 pathogenic
• Phenotypes (HPO): 1
• MANE Select transcript: NM_005434

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:6818
Approved symbol	MALL
Name	mal, T cell differentiation protein like
Location	2q13
Locus type	gene with protein product
Status	Approved
Aliases	BENE
Ensembl gene	ENSG00000144063
Ensembl biotype	protein_coding
OMIM	602022
Entrez	7851

Gene structure

Transcript identifiers

Ensembl transcripts: 6 — 5 protein_coding, 1 nonsense_mediated_decay

ENST00000272462, ENST00000424988, ENST00000427178, ENST00000864172, ENST00000864173, ENST00000962026

RefSeq mRNA: 4 — MANE Select: NM_005434 NM_001371559, NM_001371560, NM_001426600, NM_005434

CCDS: CCDS2085

Canonical transcript exons

ENST00000272462 — 4 exons

Exon	Start	End
ENSE00001129105	110083870	110085757
ENSE00001129113	110115688	110115822
ENSE00003460349	110087572	110087697
ENSE00003595165	110091603	110091770

Expression profiles

Bgee: expression breadth ubiquitous, 141 present calls, max score 99.58.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 26.2795 / max 954.4685, expressed in 915 samples.

FANTOM5 promoters (4 alternative TSS)

Promoter ID	TPM avg	Samples expressed
30113	23.2128	866
30114	2.7335	615
30115	0.1921	98
30116	0.1412	62

Top tissues by expression

153 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
lower esophagus mucosa	UBERON:0035834	99.58	gold quality
duodenum	UBERON:0002114	98.83	gold quality
esophagus mucosa	UBERON:0002469	98.61	gold quality
mucosa of transverse colon	UBERON:0004991	98.28	gold quality
epithelium of bronchus	UBERON:0002031	97.27	gold quality
rectum	UBERON:0001052	97.09	gold quality
vagina	UBERON:0000996	94.53	gold quality
small intestine Peyer’s patch	UBERON:0003454	94.09	gold quality
small intestine	UBERON:0002108	93.93	gold quality
transverse colon	UBERON:0001157	93.05	gold quality
skin of leg	UBERON:0001511	92.33	gold quality
zone of skin	UBERON:0000014	92.00	gold quality
upper lobe of left lung	UBERON:0008952	91.79	gold quality
skin of abdomen	UBERON:0001416	91.62	gold quality
islet of Langerhans	UBERON:0000006	91.40	gold quality
lung	UBERON:0002048	90.93	gold quality
esophagus	UBERON:0001043	89.61	gold quality
intestine	UBERON:0000160	88.79	gold quality
tonsil	UBERON:0002372	87.98	gold quality
apex of heart	UBERON:0002098	87.88	gold quality
olfactory segment of nasal mucosa	UBERON:0005386	87.17	gold quality
gall bladder	UBERON:0002110	87.16	gold quality
colon	UBERON:0001155	86.70	gold quality
right lobe of thyroid gland	UBERON:0001119	86.43	gold quality
left lobe of thyroid gland	UBERON:0001120	86.11	gold quality
thyroid gland	UBERON:0002046	85.84	gold quality
right lung	UBERON:0002167	85.71	gold quality
omental fat pad	UBERON:0010414	85.24	gold quality
vermiform appendix	UBERON:0001154	85.06	gold quality
adipose tissue	UBERON:0001013	84.78	gold quality

Single-cell (SCXA)

Detected in 11 experiment(s), a significant marker in 8.

Experiment	Marker?	Max mean expression
E-MTAB-7052	yes	337.55
E-MTAB-7249	yes	300.13
E-HCAD-11	yes	45.77
E-GEOD-125970	yes	27.58
E-ANND-3	yes	23.99
E-MTAB-6678	yes	13.18
E-GEOD-135922	yes	9.73
E-GEOD-130148	yes	9.06
E-CURD-10	no	389.38
E-GEOD-99795	no	85.97
E-GEOD-36552	no	13.87

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

68 targeting MALL, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-3613-3P	100.00	76.36	7965
HSA-MIR-548AW	99.99	72.57	3559
HSA-MIR-371B-5P	99.99	75.34	4759
HSA-MIR-616-5P	99.98	75.58	4775
HSA-MIR-373-5P	99.98	75.36	4753
HSA-MIR-495-3P	99.96	72.81	4197
HSA-MIR-5688	99.96	73.23	4504
HSA-MIR-498-3P	99.91	71.27	1114
HSA-MIR-605-3P	99.88	69.22	1833
HSA-MIR-4728-5P	99.85	69.39	4718
HSA-MIR-765	99.84	68.24	2442
HSA-MIR-6785-5P	99.82	68.68	4428
HSA-MIR-204-5P	99.79	71.62	2439
HSA-MIR-498-5P	99.76	69.64	1807
HSA-MIR-6764-5P	99.75	67.89	2304
HSA-MIR-2681-5P	99.75	67.64	1655
HSA-MIR-11181-3P	99.75	66.38	2205
HSA-MIR-10393-3P	99.72	66.56	961
HSA-MIR-6801-5P	99.72	66.50	981
HSA-MIR-4446-5P	99.72	69.19	2544
HSA-MIR-1296-3P	99.72	64.04	636
HSA-MIR-149-3P	99.72	68.22	3963
HSA-MIR-6883-5P	99.69	68.05	3785
HSA-MIR-4470	99.66	69.35	1767
HSA-MIR-3679-3P	99.64	69.88	1599
HSA-MIR-1827	99.63	68.57	3265
HSA-MIR-1915-3P	99.58	66.79	1988
HSA-MIR-136-5P	99.50	67.26	1153
HSA-MIR-766-3P	99.47	65.24	1811
HSA-MIR-3191-3P	99.45	63.94	356

Literature-anchored findings (GeneRIF, showing 2)

• in colonic serrated adenomas three genes (TNFRSF10A, BENE, RARA) with strongly significant expression intensities in the oligonucleotide microarray (PMID:18305945)
• We report the unexpectedly common retinal involvement of NPHP type 1 with an additional MALL deletion in a Korean cohort. (PMID:25401970)

Cross-species orthologs

4 orthologs

Organism	Symbol	Gene ID
mus_musculus	Mall	ENSMUSG00000027377
rattus_norvegicus	Mall	ENSRNOG00000015599
caenorhabditis_elegans	F28H1.4	WBGENE00017909
caenorhabditis_elegans	F47B3.3	WBGENE00018527

Paralogs (14): CMTM1 (ENSG00000089505), CMTM6 (ENSG00000091317), PLP2 (ENSG00000102007), PLLP (ENSG00000102934), CMTM3 (ENSG00000140931), CMTM2 (ENSG00000140932), MAL2 (ENSG00000147676), CMTM7 (ENSG00000153551), MARVELD1 (ENSG00000155254), CMTM5 (ENSG00000166091), CMTM8 (ENSG00000170293), MAL (ENSG00000172005), CMTM4 (ENSG00000183723), CKLF (ENSG00000217555)

Protein

Protein identifiers

MAL-like protein — Q13021 (reviewed: Q13021)

Alternative names: Protein BENE

All UniProt accessions (3): Q13021, C9IZ55, F8WE57

UniProt curated annotations — full annotation on UniProt →

Subcellular location. Membrane.

Similarity. Belongs to the MAL family.

RefSeq proteins (5): NP_001358488, NP_001358489, NP_001409097, NP_001413529, NP_005425* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR008253	Marvel	Domain
IPR013295	MAL	Family
IPR050578	MARVEL-CKLF_proteins	Family

Pfam: PF01284

UniProt features (6 total): transmembrane region 4, chain 1, domain 1

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q13021-F1	90.13	0.72

Function

Pathways and Gene Ontology

Reactome pathways

0 pathways

MSigDB gene sets: 136 (showing top): BROWNE_HCMV_INFECTION_30MIN_DN, BUYTAERT_PHOTODYNAMIC_THERAPY_STRESS_DN, GOBP_STEROL_HOMEOSTASIS, BILD_HRAS_ONCOGENIC_SIGNATURE, GOBP_LIPID_HOMEOSTASIS, TONKS_TARGETS_OF_RUNX1_RUNX1T1_FUSION_SUSTAINDED_IN_ERYTHROCYTE_UP, TONKS_TARGETS_OF_RUNX1_RUNX1T1_FUSION_ERYTHROCYTE_UP, WANG_ESOPHAGUS_CANCER_VS_NORMAL_DN, RICKMAN_METASTASIS_DN, SHEDDEN_LUNG_CANCER_GOOD_SURVIVAL_A4, GOBP_ENSHEATHMENT_OF_NEURONS, GOCC_COATED_VESICLE, HNF4_DR1_Q3, AAAGGGA_MIR204_MIR211, AACTTT_UNKNOWN

GO Biological Process (2): myelination (GO:0042552), cholesterol homeostasis (GO:0042632)

GO Molecular Function (2): structural constituent of myelin sheath (GO:0019911), protein binding (GO:0005515)

GO Cellular Component (6): Golgi membrane (GO:0000139), plasma membrane (GO:0005886), membrane (GO:0016020), clathrin-coated vesicle (GO:0030136), cytoplasmic vesicle (GO:0031410), membrane raft (GO:0045121)

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
axon ensheathment	1
sterol homeostasis	1
structural molecule activity	1
myelin sheath	1
binding	1
Golgi apparatus	1
bounding membrane of organelle	1
membrane	1
cell periphery	1
cellular anatomical structure	1
coated vesicle	1
cytoplasm	1
intracellular vesicle	1
membrane microdomain	1

Protein interactions and networks

STRING

614 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
MALL	NPHP1	O15259	877
MALL	TPD52L2	O43399	810
MALL	CD59	P13987	672
MALL	PLLP	Q9Y342	647
MALL	RGPD5	Q99666	582
MALL	CAV1	Q03135	571
MALL	TPD52	P55327	542
MALL	MYADML2	A6NDP7	520
MALL	MAL2	Q969L2	455
MALL	ARHGAP29	Q52LW3	425
MALL	NPHP4	O75161	411
MALL	ZNF514	Q96K75	376
MALL	H3BSS0	H3BSS0	375
MALL	NBPF26	B4DH59	371
MALL	A0A087WTG0	A0A087WTG0	370

IntAct

214 interactions, top by confidence:

A	B	Type	Score
MALL	LDLRAD1	psi-mi:“MI:0915”(physical association)	0.780
LDLRAD1	MALL	psi-mi:“MI:0915”(physical association)	0.780
MALL	MSR1	psi-mi:“MI:0915”(physical association)	0.720
MS4A12	MALL	psi-mi:“MI:0915”(physical association)	0.720
GGT7	MALL	psi-mi:“MI:0915”(physical association)	0.720
MSR1	MALL	psi-mi:“MI:0915”(physical association)	0.720
MALL	MS4A12	psi-mi:“MI:0915”(physical association)	0.720
MALL	GGT7	psi-mi:“MI:0915”(physical association)	0.720
SYNE4	MALL	psi-mi:“MI:0915”(physical association)	0.560
MALL	KASH5	psi-mi:“MI:0915”(physical association)	0.560
MALL	SYNE4	psi-mi:“MI:0915”(physical association)	0.560
KASH5	MALL	psi-mi:“MI:0915”(physical association)	0.560
MALL	TMX2	psi-mi:“MI:0915”(physical association)	0.560
MALL	DCBLD2	psi-mi:“MI:0915”(physical association)	0.560
MALL	BEST2	psi-mi:“MI:0915”(physical association)	0.560
MALL	AQP6	psi-mi:“MI:0915”(physical association)	0.560
MALL	UBE2I	psi-mi:“MI:0915”(physical association)	0.560

BioGRID (158): MALL (Two-hybrid), MALL (Two-hybrid), MS4A12 (Two-hybrid), CCDC155 (Two-hybrid), SYNE4 (Two-hybrid), LDLRAD1 (Two-hybrid), CREB3 (Two-hybrid), MALL (Two-hybrid), MALL (Two-hybrid), MALL (Two-hybrid), MALL (Two-hybrid), MALL (Two-hybrid), MALL (Two-hybrid), MALL (Two-hybrid), MALL (Two-hybrid)

ESM2 similar proteins: A2VE58, A3KQ86, A3LPS1, A6H7B0, A7E3W5, A8MWL6, A9SEY7, B2RZ87, O43759, O43760, O43761, O54980, O55100, O55101, O75508, O95473, P0DI72, P0DI73, P22831, P47987, Q08AU7, Q08DL4, Q13021, Q28597, Q2YDD6, Q3MHK4, Q4R3L1, Q5APC0, Q5BLB7, Q5R703, Q5REK8, Q5RFC1, Q5XGR0, Q60771, Q62876, Q63ZU3, Q6DFR5, Q7TQJ1, Q8BGN8, Q8R191

Diamond homologs: A2VE13, A3KQ86, O09198, P21145, Q13021, Q28296, Q3ZBY0, Q5RAI2, Q64349, Q6GPN9, Q8BI08, Q91X49, Q969L2, Q9CZR4, A6H7B0, P47987, Q1RMP9, Q8IZV2, Q9DCU2, Q9Y342, Q5BLB7

SIGNOR signaling

0 interactions.

Disease & clinical

Clinical variants and AI predictions

ClinVar

87 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	71
Likely pathogenic	0
Uncertain significance	10
Likely benign	2
Benign	2

Top pathogenic / likely-pathogenic (30)

Variant ID	HGVS	Classification
2652123	GRCh37/hg19 2q13(chr2:110873265-110970348)x0	Pathogenic
3024614	GRCh37/hg19 2q13(chr2:110814357-111177015)x0	Pathogenic
4755442	Single allele	Pathogenic
4755451	Single allele	Pathogenic
625547	GRCh37/hg19 2q13(chr2:110824957-110983703)	Pathogenic
625824	GRCh37/hg19 2q13(chr2:110862477-110983703)	Pathogenic
684897	GRCh37/hg19 2q13(chr2:110863827-110980919)x1	Pathogenic
684918	GRCh37/hg19 2q13(chr2:110871508-110980919)x1	Pathogenic
684957	GRCh37/hg19 2q13(chr2:110871508-110980919)x1	Pathogenic
684959	GRCh37/hg19 2q13(chr2:110873834-110988707)x1	Pathogenic
684979	GRCh37/hg19 2q13(chr2:110871508-110980919)x1	Pathogenic
684994	GRCh37/hg19 2q13(chr2:110863827-110980919)x1	Pathogenic
685019	GRCh37/hg19 2q13(chr2:110871508-110980919)x1	Pathogenic
685033	GRCh37/hg19 2q13(chr2:110871508-110980919)x1	Pathogenic
685081	GRCh37/hg19 2q13(chr2:110871508-110980919)x1	Pathogenic
685113	GRCh37/hg19 2q13(chr2:110871508-110980919)x1	Pathogenic
685227	GRCh37/hg19 2q13(chr2:110871508-110980919)x1	Pathogenic
685287	GRCh37/hg19 2q13(chr2:110873834-110982217)x1	Pathogenic
685293	GRCh37/hg19 2q13(chr2:110871508-110980919)x1	Pathogenic
685377	GRCh37/hg19 2q13(chr2:110863827-110986712)x1	Pathogenic
685385	GRCh37/hg19 2q13(chr2:110873834-110983418)x1	Pathogenic
685550	GRCh37/hg19 2q13(chr2:110871508-110980919)x1	Pathogenic
685660	GRCh37/hg19 2q13(chr2:110873834-110973315)x1	Pathogenic
685776	GRCh37/hg19 2q13(chr2:110871508-110980919)x1	Pathogenic
685780	GRCh37/hg19 2q13(chr2:110871508-110980919)x1	Pathogenic
686045	GRCh37/hg19 2q13(chr2:110871508-110980919)x1	Pathogenic
686159	GRCh37/hg19 2q13(chr2:110871508-110980919)x1	Pathogenic
686284	GRCh37/hg19 2q13(chr2:110871508-110980919)x1	Pathogenic
686286	GRCh37/hg19 2q13(chr2:110871508-110980919)x1	Pathogenic
686491	GRCh37/hg19 2q13(chr2:110873834-110980919)x1	Pathogenic

SpliceAI

638 predictions. Top by Δscore:

Variant	Effect	Δscore
2:110085758:C:CC	acceptor_gain	1.0000
2:110085754:AGAA:A	acceptor_gain	0.9900
2:110085755:GAA:G	acceptor_gain	0.9900
2:110085756:AA:A	acceptor_gain	0.9900
2:110085756:AACTG:A	acceptor_loss	0.9900
2:110085757:AC:A	acceptor_loss	0.9900
2:110085758:C:CA	acceptor_loss	0.9900
2:110085759:T:C	acceptor_loss	0.9900
2:110105370:C:A	donor_gain	0.9900
2:110105375:T:A	donor_gain	0.9900
2:110087566:ACTC:A	donor_loss	0.9800
2:110087567:CT:C	donor_loss	0.9800
2:110087568:T:TA	donor_loss	0.9800
2:110087569:CACCG:C	donor_loss	0.9800
2:110087570:A:AC	donor_gain	0.9800
2:110087570:ACC:A	donor_loss	0.9800
2:110087571:C:CC	donor_gain	0.9800
2:110087698:C:CC	acceptor_gain	0.9800
2:110091598:CT:C	donor_loss	0.9800
2:110091599:T:TC	donor_loss	0.9800
2:110091601:A:G	donor_loss	0.9800
2:110091602:C:A	donor_loss	0.9800
2:110105391:T:TA	donor_gain	0.9800
2:110115687:CCAG:C	donor_gain	0.9800
2:110085753:AAGAA:A	acceptor_gain	0.9700
2:110087565:CACT:C	donor_loss	0.9700
2:110087693:CTGTC:C	acceptor_gain	0.9700
2:110087698:CTGGA:C	acceptor_loss	0.9700
2:110087699:T:A	acceptor_loss	0.9700
2:110091595:GTTCT:G	donor_loss	0.9700

AlphaMissense

983 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
2:110087656:G:C	S105R	0.995
2:110087656:G:T	S105R	0.995
2:110087658:T:G	S105R	0.995
2:110091704:A:G	W58R	0.994
2:110091704:A:T	W58R	0.994
2:110091752:A:G	W42R	0.993
2:110091752:A:T	W42R	0.993
2:110087673:C:G	G100R	0.991
2:110091688:G:C	S63W	0.991
2:110091702:C:A	W58C	0.989
2:110091702:C:G	W58C	0.989
2:110087692:G:C	S93R	0.988
2:110087692:G:T	S93R	0.988
2:110087694:T:G	S93R	0.988
2:110091614:A:G	W88R	0.988
2:110091614:A:T	W88R	0.988
2:110087688:A:C	Y95D	0.987
2:110091763:C:T	G38E	0.986
2:110087652:C:G	A107P	0.985
2:110091691:A:T	V62D	0.985
2:110087654:G:T	A106D	0.984
2:110091764:C:G	G38R	0.982
2:110091764:C:T	G38R	0.982
2:110087634:C:G	A113P	0.981
2:110091764:C:A	G38W	0.981
2:110087584:A:C	N129K	0.980
2:110087584:A:T	N129K	0.980
2:110087651:G:T	A107D	0.980
2:110091612:C:A	W88C	0.980
2:110091612:C:G	W88C	0.980

dbSNP variants (sampled 300 via entrez): RS1000096266 (2:110092596 T>C), RS1000173500 (2:110112418 G>A), RS1000260220 (2:110098610 A>T), RS1000354149 (2:110105735 G>A), RS1000541704 (2:110117616 TGTGTGTGTGAGAGAGAGAGA>T), RS1000612913 (2:110111630 A>G), RS1000636722 (2:110117864 C>A), RS1000724127 (2:110105448 C>A,T), RS1000785106 (2:110118622 A>C), RS1000811708 (2:110112081 C>A), RS1001071855 (2:110118317 C>T), RS1001163126 (2:110113956 T>C), RS1001171314 (2:110104484 G>A), RS1001225753 (2:110107602 A>G), RS1001288170 (2:110101268 A>C)

Disease associations

OMIM: gene MIM:602022 | disease phenotypes: MIM:256100, MIM:609583, MIM:162500

GenCC curated gene-disease

Mondo (4): nephronophthisis (MONDO:0019005), Joubert syndrome with renal defect (MONDO:0012308), nephronophthisis 1 (MONDO:0009728), hereditary neuropathy with liability to pressure palsies (MONDO:0008087)

Orphanet (4): Nephronophthisis (Orphanet:655), Joubert syndrome with renal defect (Orphanet:220497), Juvenile nephronophthisis (Orphanet:93592), Hereditary neuropathy with liability to pressure palsies (Orphanet:640)

HPO phenotypes

1 total (1 of 1 shown, HPO-id order):

HPO	Term
HP:0000090	Nephronophthisis

GWAS associations

0 associations (top):

MeSH disease descriptors (3)

Descriptor	Name	Tree numbers
C536296	Joubert syndrome 4 (supp.)
C537699	Nephronophthisis, familial juvenile (supp.)
C536965	Tomaculous neuropathy (supp.)

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

43 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Estradiol	affects cotreatment, decreases expression, increases expression	3
bisphenol A	decreases methylation, increases expression, affects cotreatment	2
afimoxifene	decreases expression, increases expression	2
cobaltous chloride	decreases expression	2
Tetrachlorodibenzodioxin	affects cotreatment, decreases expression, increases expression	2
deoxynivalenol	decreases expression	1
terbufos	increases methylation	1
beta-lapachone	increases expression	1
arsenite	decreases methylation	1
tris(1,3-dichloro-2-propyl)phosphate	decreases expression	1
sodium arsenite	increases expression	1
butyraldehyde	decreases expression	1
ferrous chloride	increases expression	1
seocalcitol	increases expression	1
CGP 52608	affects binding, increases reaction	1
2-palmitoylglycerol	increases expression	1
erucylphospho-N,N,N-trimethylpropylammonium	increases expression	1
abrine	decreases expression	1
(+)-JQ1 compound	decreases expression	1
Dasatinib	decreases expression	1
Irinotecan	increases expression	1
Resveratrol	affects cotreatment, decreases expression	1
Arsenic Trioxide	decreases response to substance	1
Air Pollutants	increases abundance, increases expression	1
Benzo(a)pyrene	increases methylation	1
Cadmium	increases expression	1
Calcitriol	increases expression	1
Dexamethasone	decreases expression, affects cotreatment, increases expression	1
Diethylhexyl Phthalate	decreases expression	1
Fonofos	increases methylation	1

Clinical trials (associated diseases)

8 trials via MONDO — disease-level, not drug-specific.

Trial	Phase	Status	Title
NCT01401257	PHASE2	COMPLETED	Phase II, Randomized, Placebo-controlled Trial in Patients With Charcot-marie-tooth Disease Type 1A
NCT01022957	Not specified	COMPLETED	Nephronophthisis : Clinical and Genetic Study
NCT01401998	Not specified	RECRUITING	ARPKD Database Study
NCT04874909	Not specified	COMPLETED	Classification, Functional Stratification and Biomarkers in Ciliopathy (CILLICORIRCM)
NCT05286632	Not specified	COMPLETED	KidneYou - Innovative Digital Therapy
NCT06065852	Not specified	RECRUITING	National Registry of Rare Kidney Diseases
NCT06648044	Not specified	RECRUITING	Research of Therapeutic Targets in the Frame of Nephronophthisis and Renal Associated Ciliopathies
NCT05902351	Not specified	RECRUITING	Natural History Study for Charcot Marie Tooth Disease