MAN2A2

Summary

MAN2A2 (mannosidase alpha class 2A member 2, HGNC:6825) is a protein-coding gene on chromosome 15q25, encoding Alpha-mannosidase 2x (P49641). Catalyzes the first committed step in the biosynthesis of complex N-glycans.

Predicted to enable alpha-mannosidase activity. Predicted to be involved in N-glycan processing. Predicted to be located in Golgi apparatus and membrane. Predicted to be active in Golgi membrane.

Source: NCBI Gene 4122 — RefSeq curated summary.

At a glance

• Gene–disease (curated): congenital disorder of glycosylation (Limited, ClinGen) — +1 more curated relationship
• GWAS associations: 5
• Clinical variants (ClinVar): 219 total — 1 pathogenic, 2 likely-pathogenic
• MANE Select transcript: NM_006122

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:6825
Approved symbol	MAN2A2
Name	mannosidase alpha class 2A member 2
Location	15q25
Locus type	gene with protein product
Status	Approved
Aliases	MANA2X, HsT19662, alpha-MIIx
Ensembl gene	ENSG00000196547
Ensembl biotype	protein_coding
OMIM	600988
Entrez	4122

Gene structure

Transcript identifiers

Ensembl transcripts: 32 — 14 protein_coding, 8 retained_intron, 6 protein_coding_CDS_not_defined, 4 nonsense_mediated_decay

ENST00000360468, ENST00000557865, ENST00000557990, ENST00000558161, ENST00000558171, ENST00000558290, ENST00000558374, ENST00000558538, ENST00000558640, ENST00000558853, ENST00000559132, ENST00000559341, ENST00000559374, ENST00000559558, ENST00000559704, ENST00000559717, ENST00000559965, ENST00000559999, ENST00000560147, ENST00000560192, ENST00000560451, ENST00000560505, ENST00000560534, ENST00000560616, ENST00000560880, ENST00000560926, ENST00000561046, ENST00000561047, ENST00000561240, ENST00000561448, ENST00000855658, ENST00000855659

RefSeq mRNA: 2 — MANE Select: NM_006122 NM_001320977, NM_006122

CCDS: CCDS32332

Canonical transcript exons

ENST00000559717 — 23 exons

Exon	Start	End
ENSE00001293349	90912043	90912279
ENSE00001303987	90913273	90913406
ENSE00001310335	90911385	90911550
ENSE00001388952	90912542	90912664
ENSE00002538107	90903302	90903432
ENSE00002557540	90919635	90922579
ENSE00002663389	90904190	90904339
ENSE00003480303	90905845	90906016
ENSE00003481188	90905251	90905508
ENSE00003504072	90906370	90906497
ENSE00003517772	90913614	90913755
ENSE00003518254	90906740	90906913
ENSE00003523758	90918645	90918755
ENSE00003597245	90910501	90910683
ENSE00003599601	90916123	90916256
ENSE00003603008	90910847	90910961
ENSE00003607686	90918194	90918388
ENSE00003612597	90905579	90905723
ENSE00003617441	90907309	90907495
ENSE00003622777	90909327	90909504
ENSE00003643372	90910090	90910292
ENSE00003649897	90911171	90911238
ENSE00003667817	90912877	90912991

Expression profiles

Bgee: expression breadth ubiquitous, 293 present calls, max score 98.32.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 14.3454 / max 232.6871, expressed in 1709 samples.

FANTOM5 promoters (20 alternative TSS)

Promoter ID	TPM avg	Samples expressed
148508	6.2110	1423
148506	2.9977	1090
148517	1.1241	157
148507	1.0451	569
148524	0.8199	165
148509	0.3673	157
148525	0.3167	84
148513	0.1922	99
148518	0.1905	57
148523	0.1875	82

Top tissues by expression

294 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
right hemisphere of cerebellum	UBERON:0014890	98.32	gold quality
tibial nerve	UBERON:0001323	98.21	gold quality
sural nerve	UBERON:0015488	98.08	gold quality
cerebellar hemisphere	UBERON:0002245	98.02	gold quality
cerebellar cortex	UBERON:0002129	97.97	gold quality
body of pancreas	UBERON:0001150	97.86	gold quality
C1 segment of cervical spinal cord	UBERON:0006469	97.86	gold quality
apex of heart	UBERON:0002098	97.85	gold quality
inferior vagus X ganglion	UBERON:0005363	97.59	gold quality
spinal cord	UBERON:0002240	97.57	gold quality
corpus callosum	UBERON:0002336	97.41	gold quality
cerebellum	UBERON:0002037	97.37	gold quality
subthalamic nucleus	UBERON:0001906	97.33	gold quality
substantia nigra pars reticulata	UBERON:0001966	97.21	gold quality
olfactory bulb	UBERON:0002264	97.16	gold quality
gastrocnemius	UBERON:0001388	97.12	gold quality
right frontal lobe	UBERON:0002810	97.01	gold quality
right lobe of thyroid gland	UBERON:0001119	96.93	gold quality
adenohypophysis	UBERON:0002196	96.66	gold quality
pituitary gland	UBERON:0000007	96.64	gold quality
right lung	UBERON:0002167	96.57	gold quality
muscle of leg	UBERON:0001383	96.56	gold quality
dorsal plus ventral thalamus	UBERON:0001897	96.56	gold quality
left lobe of thyroid gland	UBERON:0001120	96.55	gold quality
hindlimb stylopod muscle	UBERON:0004252	96.49	gold quality
lateral nuclear group of thalamus	UBERON:0002736	96.45	gold quality
substantia nigra pars compacta	UBERON:0001965	96.44	gold quality
granulocyte	CL:0000094	96.40	gold quality
spleen	UBERON:0002106	96.40	gold quality
prefrontal cortex	UBERON:0000451	96.39	gold quality

Single-cell (SCXA)

Detected in 2 experiment(s), a significant marker in 1.

Experiment	Marker?	Max mean expression
E-ANND-3	yes	6.80
E-MTAB-7606	no	866.47

Regulation

Is transcription factor: no

Upstream regulators (CollecTRI, top): MYC

miRNA regulators (miRDB)

94 targeting MAN2A2, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-188-3P	100.00	68.76	1240
HSA-MIR-4500	99.99	72.72	2367
HSA-LET-7A-5P	99.98	72.29	1790
HSA-LET-7B-5P	99.98	72.31	1790
HSA-LET-7C-5P	99.98	72.29	1790
HSA-LET-7E-5P	99.98	72.29	1790
HSA-LET-7F-5P	99.98	72.56	1784
HSA-LET-7G-5P	99.98	72.37	1784
HSA-LET-7I-5P	99.98	72.37	1788
HSA-MIR-98-5P	99.98	72.33	1787
HSA-MIR-6778-3P	99.96	67.29	2693
HSA-LET-7D-5P	99.96	71.76	1632
HSA-MIR-4458	99.96	71.64	1650
HSA-MIR-559	99.95	72.28	3609
HSA-MIR-552-5P	99.93	68.56	1583
HSA-MIR-497-5P	99.92	71.83	2674
HSA-MIR-15A-5P	99.90	72.80	2787
HSA-MIR-15B-5P	99.90	72.78	2798
HSA-MIR-16-5P	99.90	72.80	2780
HSA-MIR-195-5P	99.90	72.81	2805
HSA-MIR-6838-5P	99.89	71.94	2690
HSA-MIR-424-5P	99.89	71.90	2641
HSA-MIR-202-3P	99.84	71.41	1290
HSA-MIR-6875-3P	99.82	70.26	2983
HSA-MIR-3180-5P	99.82	69.12	2422
HSA-MIR-4659A-3P	99.80	72.62	4248
HSA-MIR-4659B-3P	99.80	72.62	4248
HSA-MIR-449C-5P	99.78	67.63	1168
HSA-MIR-34B-5P	99.78	67.56	1175
HSA-MIR-2682-5P	99.73	67.38	1055

Literature-anchored findings (GeneRIF, showing 2)

• High glucose-ROS conditions enhance the progression in cholangiocarcinoma via upregulation of MAN2A2 and CHD8. (PMID:33141432)
• Homozygous truncating variant in MAN2A2 causes a novel congenital disorder of glycosylation with neurological involvement. (PMID:36357165)

Cross-species orthologs

6 orthologs

Organism	Symbol	Gene ID
danio_rerio	man2a2	ENSDARG00000063101
mus_musculus	Man2a2	ENSMUSG00000038886
rattus_norvegicus	Man2a2	ENSRNOG00000012055
drosophila_melanogaster	alpha-Man-IIa	FBGN0011740
caenorhabditis_elegans		WBGENE00010284
caenorhabditis_elegans	aman-3	WBGENE00018594

Paralogs (4): MAN2B2 (ENSG00000013288), MAN2B1 (ENSG00000104774), MAN2A1 (ENSG00000112893), MAN2C1 (ENSG00000140400)

Protein

Protein identifiers

Alpha-mannosidase 2x — P49641 (reviewed: P49641)

Alternative names: Alpha-mannosidase IIx, Mannosidase alpha class 2A member 2, Mannosyl-oligosaccharide 1,3-1,6-alpha-mannosidase

All UniProt accessions (15): P49641, A0A0C4DGL1, H0YK77, H0YKH9, H0YKM7, H0YKQ2, H0YKT0, H0YL67, H0YLB9, H0YLL4, H0YLU3, H0YML7, H0YMU0, H0YNC8, H0YNG5

UniProt curated annotations — full annotation on UniProt →

Function. Catalyzes the first committed step in the biosynthesis of complex N-glycans. It controls conversion of high mannose to complex N-glycans; the final hydrolytic step in the N-glycan maturation pathway.

Subunit / interactions. Homodimer; disulfide-linked. Interacts with MGAT4D.

Subcellular location. Golgi apparatus membrane.

Cofactor. Binds 1 zinc ion per subunit.

Pathway. Protein modification; protein glycosylation.

Miscellaneous. May be produced at very low levels due to a premature stop codon in the mRNA, leading to nonsense-mediated mRNA decay.

Similarity. Belongs to the glycosyl hydrolase 38 family.

Isoforms (3)

UniProt ID	Names	Canonical?
P49641-3	3	yes
P49641-1	1, Long
P49641-2	2, Short

RefSeq proteins (2): NP_001307906, NP_006113* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR000602	Glyco_hydro_38_N	Domain
IPR011013	Gal_mutarotase_sf_dom	Homologous_superfamily
IPR011330	Glyco_hydro/deAcase_b/a-brl	Homologous_superfamily
IPR011682	Glyco_hydro_38_C	Domain
IPR013780	Glyco_hydro_b	Homologous_superfamily
IPR015341	Glyco_hydro_38_cen	Domain
IPR027291	Glyco_hydro_38_N_sf	Homologous_superfamily
IPR028995	Glyco_hydro_57/38_cen_sf	Homologous_superfamily
IPR037094	Glyco_hydro_38_cen_sf	Homologous_superfamily
IPR050843	Glycosyl_Hydrlase_38	Family

Pfam: PF01074, PF07748, PF09261

Catalyzed reactions (Rhea), 1 shown:

• N(4)-{beta-D-GlcNAc-(1->2)-alpha-D-Man-(1->3)-[alpha-D-Man-(1->3)-[alpha-D-Man-(1->6)]-alpha-D-Man-(1->6)]-beta-D-Man-(1->4)-beta-D-GlcNAc-(1->4)-beta-D-GlcNAc}-L-asparaginyl-[protein] + 2 H2O = 2 alpha-D-mannopyranose + an N(4)-{beta-D-GlcNAc-(1->2)-alpha-D-Man-(1->3)-[alpha-D-Man-(1->6)]-beta-D-Man-(1->4)-beta-D-GlcNAc-(1->4)-beta-D-GlcNAc}-L-asparaginyl-[protein] (RHEA:56052)

UniProt features (18 total): glycosylation site 4, binding site 4, splice variant 3, topological domain 2, sequence variant 2, chain 1, transmembrane region 1, active site 1

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-P49641-F1	91.27	0.80

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Catalytic / active sites (1): 289 (nucleophile)

Ligand- & substrate-binding residues (4): 175; 177; 289; 569

Glycosylation sites (4): 305, 1093, 1131, 95

Function

Pathways and Gene Ontology

Reactome pathways

10 pathways

ID	Pathway
R-HSA-6811438	Intra-Golgi traffic
R-HSA-975578	Reactions specific to the complex N-glycan synthesis pathway
R-HSA-199991	Membrane Trafficking
R-HSA-392499	Metabolism of proteins
R-HSA-446203	Asparagine N-linked glycosylation
R-HSA-5653656	Vesicle-mediated transport
R-HSA-597592	Post-translational protein modification
R-HSA-6811442	Intra-Golgi and retrograde Golgi-to-ER traffic
R-HSA-948021	Transport to the Golgi and subsequent modification
R-HSA-975576	N-glycan antennae elongation in the medial/trans-Golgi

MSigDB gene sets: 249 (showing top): RNGTGGGC_UNKNOWN, GOBP_N_GLYCAN_PROCESSING, MULLIGHAN_NPM1_SIGNATURE_3_UP, DORSAM_HOXA9_TARGETS_UP, GOBP_PROTEIN_N_LINKED_GLYCOSYLATION, KEGG_N_GLYCAN_BIOSYNTHESIS, DARWICHE_SKIN_TUMOR_PROMOTER_UP, DARWICHE_PAPILLOMA_RISK_LOW_DN, DARWICHE_PAPILLOMA_RISK_HIGH_DN, DARWICHE_SQUAMOUS_CELL_CARCINOMA_UP, DARWICHE_PAPILLOMA_PROGRESSION_RISK, REACTOME_MEMBRANE_TRAFFICKING, GOBP_CARBOHYDRATE_DERIVATIVE_METABOLIC_PROCESS, ONKEN_UVEAL_MELANOMA_UP, BLALOCK_ALZHEIMERS_DISEASE_UP

GO Biological Process (4): mannose metabolic process (GO:0006013), N-glycan processing (GO:0006491), carbohydrate metabolic process (GO:0005975), obsolete protein glycosylation (GO:0006486)

GO Molecular Function (10): alpha-mannosidase activity (GO:0004559), mannosyl-oligosaccharide 1,3-1,6-alpha-mannosidase activity (GO:0004572), hydrolase activity, hydrolyzing N-glycosyl compounds (GO:0016799), carbohydrate binding (GO:0030246), metal ion binding (GO:0046872), catalytic activity (GO:0003824), protein binding (GO:0005515), mannosidase activity (GO:0015923), hydrolase activity (GO:0016787), hydrolase activity, acting on glycosyl bonds (GO:0016798)

GO Cellular Component (3): Golgi membrane (GO:0000139), Golgi apparatus (GO:0005794), membrane (GO:0016020)

Reactome top-level categories

Rollup of top-8 pathways:

Category	Pathways
Intra-Golgi and retrograde Golgi-to-ER traffic	1
N-glycan antennae elongation in the medial/trans-Golgi	1
Vesicle-mediated transport	1
Post-translational protein modification	1
Metabolism of proteins	1
Membrane Trafficking	1
Asparagine N-linked glycosylation	1
Transport to the Golgi and subsequent modification	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
binding	2
hexose metabolic process	1
protein N-linked glycosylation	1
glycoprotein biosynthetic process	1
primary metabolic process	1
mannosidase activity	1
mannosyl-oligosaccharide mannosidase activity	1
hydrolase activity, acting on glycosyl bonds	1
cation binding	1
molecular_function	1
hydrolase activity, hydrolyzing O-glycosyl compounds	1
catalytic activity	1
hydrolase activity	1
Golgi apparatus	1
bounding membrane of organelle	1
cytoplasm	1
endomembrane system	1
intracellular membrane-bounded organelle	1
cellular anatomical structure	1

Protein interactions and networks

STRING

976 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
MAN2A2	SLC35C1	Q96A29	856
MAN2A2	SLC35D2	Q76EJ3	824
MAN2A2	B4GALT1	P15291	822
MAN2A2	SLC35D1	Q9NTN3	810
MAN2A2	MGAT2	Q10469	726
MAN2A2	MGAT1	P26572	712
MAN2A2	MAN1A1	P33908	706
MAN2A2	MAN1C1	Q9NR34	666
MAN2A2	MAN1A2	O60476	634
MAN2A2	MGAT5	Q09328	629
MAN2A2	MAN1B1	Q9UKM7	626
MAN2A2	FUT8	Q9BYC5	609
MAN2A2	MGAT4B	Q9UQ53	581
MAN2A2	MGAT4A	Q9UM21	488
MAN2A2	POMGNT1	Q8WZA1	487

IntAct

100 interactions, top by confidence:

A	B	Type	Score
NIPAL1	ESYT2	psi-mi:“MI:0914”(association)	0.640
MGAT4C	GXYLT2	psi-mi:“MI:0914”(association)	0.530
SLC39A4	TMEM120B	psi-mi:“MI:0914”(association)	0.530
SLC9A6	MAP1LC3B2	psi-mi:“MI:0914”(association)	0.530
PBXIP1	GOLIM4	psi-mi:“MI:0914”(association)	0.530
CLGN	NPC1	psi-mi:“MI:0914”(association)	0.530
PLAUR	XRCC3	psi-mi:“MI:0914”(association)	0.530
C1orf54	EXTL3	psi-mi:“MI:0914”(association)	0.530
SLC9A6	IFNGR1	psi-mi:“MI:0914”(association)	0.530
B4GALT6	MAN2A2	psi-mi:“MI:0915”(physical association)	0.500
MAN2A2	H1-5	psi-mi:“MI:0915”(physical association)	0.400
TMEM106A	QSOX1	psi-mi:“MI:0914”(association)	0.350
HLA-DQA1	TMEM223	psi-mi:“MI:0914”(association)	0.350
PDGFRA	GXYLT2	psi-mi:“MI:0914”(association)	0.350
CLEC12B	GXYLT2	psi-mi:“MI:0914”(association)	0.350
TNFSF18	TMEM120B	psi-mi:“MI:0914”(association)	0.350
MCOLN2	POTEF	psi-mi:“MI:0914”(association)	0.350
LLCFC1	POTEF	psi-mi:“MI:0914”(association)	0.350
PSCA	METTL15	psi-mi:“MI:0914”(association)	0.350
KLRC1	METTL15	psi-mi:“MI:0914”(association)	0.350
CRLF2	METTL15	psi-mi:“MI:0914”(association)	0.350
SUSD4	CCDC85C	psi-mi:“MI:0914”(association)	0.350
SCGB2A2	RTL8C	psi-mi:“MI:0914”(association)	0.350
TMEM59	GPR89A	psi-mi:“MI:0914”(association)	0.350
SEC62	GPR89A	psi-mi:“MI:0914”(association)	0.350
CEACAM8	PRRT4	psi-mi:“MI:0914”(association)	0.350
CST9L	QSOX1	psi-mi:“MI:0914”(association)	0.350
TAFAZZIN	MANBA	psi-mi:“MI:0914”(association)	0.350
PTPRK	MANBA	psi-mi:“MI:0914”(association)	0.350

BioGRID (122): MAN2A2 (Affinity Capture-MS), MAN2A2 (Affinity Capture-MS), MAN2A2 (Affinity Capture-MS), MAN2A2 (Affinity Capture-MS), MAN2A2 (Affinity Capture-MS), MAN2A2 (Affinity Capture-MS), MAN2A2 (Affinity Capture-MS), MAN2A2 (Affinity Capture-MS), CAPN2 (Co-fractionation), MAN2A2 (Affinity Capture-MS), MAN2A2 (Affinity Capture-MS), MAN2A2 (Affinity Capture-MS), MAN2A2 (Affinity Capture-MS), MAN2A2 (Affinity Capture-MS), MAN2A2 (Affinity Capture-MS)

ESM2 similar proteins: A2AFS3, O35217, O54804, O75882, O94925, O95803, P35790, P49641, P52848, Q00961, Q01098, Q01134, Q02353, Q08DW9, Q0VCJ8, Q13635, Q14957, Q27HK4, Q3UHN9, Q4R3I0, Q4R4U1, Q4R766, Q5H8A4, Q5R5F8, Q5R890, Q5U4X8, Q5ZIN0, Q5ZJB7, Q5ZMH6, Q61115, Q6AYT7, Q6P988, Q6UXG2, Q76LW2, Q8BRK9, Q8CIW5, Q8N2K0, Q8NBT3, Q8NCR0, Q8R116

Diamond homologs: O18497, P27046, P28494, P49641, Q16706, Q24451, Q8BRK9, Q9LFR0, P94078, Q28949, Q54YF7, Q55ER0

SIGNOR signaling

0 interactions.

Enriched among interaction partners

Reactome pathways and GO biological processes over-represented among this gene’s 133 IntAct physical interaction partners (hypergeometric vs the genome-wide background, BH-FDR, gene-set size 15–500, ranked by fold). A functional readout of the neighbourhood — distinct from this gene’s own memberships above, and biased toward well-studied / hub proteins, so read it as themes rather than proof.

Reactome pathways:

Pathway	Partners	Fold	FDR
Interferon gamma signaling	8	11.4×	2e-04
Metabolism of carbohydrates and carbohydrate derivatives	6	8.2×	4e-03
Immunoregulatory interactions between a Lymphoid and a non-Lymphoid cell	7	6.9×	3e-03
Neutrophil degranulation	15	3.9×	6e-04

GO biological processes:

GO term	Partners	Fold	FDR
negative regulation of natural killer cell mediated cytotoxicity	5	38.2×	1e-04
positive regulation of T cell mediated cytotoxicity	5	22.0×	5e-04
intracellular zinc ion homeostasis	5	20.8×	6e-04
adaptive immune response	9	6.5×	1e-03
immune response	11	4.5×	3e-03

Disease & clinical

Clinical variants and AI predictions

ClinVar

219 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	1
Likely pathogenic	2
Uncertain significance	175
Likely benign	13
Benign	3

Top pathogenic / likely-pathogenic (3)

Variant ID	HGVS	Classification
2498630	GRCh37/hg19 15q22.33-26.1(chr15:67358491-91644328)x3	Pathogenic
3766447	NM_006122.4(MAN2A2):c.3292C>T (p.Gln1098Ter)	Likely pathogenic
3766448	NM_006122.4(MAN2A2):c.1679G>A (p.Arg560Gln)	Likely pathogenic

SpliceAI

4535 predictions. Top by Δscore:

Variant	Effect	Δscore
15:90904338:GG:G	donor_gain	1.0000
15:90904339:GG:G	donor_gain	1.0000
15:90904339:GGTG:G	donor_loss	1.0000
15:90904340:G:A	donor_loss	1.0000
15:90904340:G:GG	donor_gain	1.0000
15:90904341:T:G	donor_loss	1.0000
15:90904342:G:GG	donor_loss	1.0000
15:90905249:A:AG	acceptor_gain	1.0000
15:90905250:G:GG	acceptor_gain	1.0000
15:90905250:GA:G	acceptor_gain	1.0000
15:90905250:GAGCC:G	acceptor_gain	1.0000
15:90906493:TCTTG:T	donor_gain	1.0000
15:90906496:TG:T	donor_gain	1.0000
15:90906497:GG:G	donor_gain	1.0000
15:90906498:G:GG	donor_gain	1.0000
15:90906499:T:G	donor_loss	1.0000
15:90907491:GAGAG:G	donor_gain	1.0000
15:90907493:G:GT	donor_gain	1.0000
15:90907493:GAG:G	donor_gain	1.0000
15:90909325:A:AG	acceptor_gain	1.0000
15:90909325:AG:A	acceptor_gain	1.0000
15:90909326:G:A	acceptor_gain	1.0000
15:90909326:G:GA	acceptor_gain	1.0000
15:90909326:GGGC:G	acceptor_gain	1.0000
15:90909326:GGGCA:G	acceptor_gain	1.0000
15:90909486:GCC:G	donor_gain	1.0000
15:90910119:T:TA	acceptor_gain	1.0000
15:90910133:A:G	acceptor_gain	1.0000
15:90910202:A:AG	acceptor_gain	1.0000
15:90910202:ATGC:A	acceptor_gain	1.0000

AlphaMissense

7515 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
15:90905288:T:C	L57P	1.000
15:90905847:T:A	W180R	1.000
15:90905847:T:C	W180R	1.000
15:90905849:G:C	W180C	1.000
15:90905849:G:T	W180C	1.000
15:90910225:T:A	W504R	1.000
15:90910225:T:C	W504R	1.000
15:90916147:G:C	R962P	1.000
15:90916164:G:C	D968H	1.000
15:90916171:G:C	R970P	1.000
15:90904239:G:A	G11E	0.999
15:90904245:C:A	A13D	0.999
15:90904253:T:C	C16R	0.999
15:90904260:C:A	A18E	0.999
15:90905267:T:C	L50P	0.999
15:90905276:G:C	R53P	0.999
15:90905297:T:C	L60P	0.999
15:90905300:T:C	L61S	0.999
15:90905309:A:T	N64I	0.999
15:90905709:C:T	S174F	0.999
15:90905711:C:G	H175D	0.999
15:90905718:A:C	D177A	0.999
15:90905718:A:G	D177G	0.999
15:90905718:A:T	D177V	0.999
15:90905953:A:T	E215V	0.999
15:90906760:T:A	W286R	0.999
15:90906760:T:C	W286R	0.999
15:90906775:T:C	F291L	0.999
15:90906777:T:A	F291L	0.999
15:90906777:T:G	F291L	0.999

dbSNP variants (sampled 300 via entrez): RS1000081901 (15:90904819 T>A), RS1000270070 (15:90918932 A>G), RS1000356271 (15:90910405 A>G,T), RS1000765822 (15:90914249 G>A,C), RS1000818388 (15:90914084 A>G), RS1000916112 (15:90919986 C>A,T), RS1000958455 (15:90909002 G>A,C,T), RS1001076602 (15:90908670 G>A), RS1001083661 (15:90903684 A>G), RS1001084164 (15:90900545 T>A), RS1001128481 (15:90900691 TAAA>T,TAAAA), RS1001643609 (15:90914708 TG>T), RS1001767646 (15:90913048 C>T), RS1001777517 (15:90902788 CGGAGCGCGCCGGCGGCCCGGGGCCCAGCG>C), RS1001828274 (15:90912846 T>C)

Disease associations

OMIM: gene MIM:600988 | disease phenotypes: MIM:142623

GenCC curated gene-disease

Disease	Classification	Inheritance
congenital disorder of glycosylation	Limited	Autosomal recessive
disorder of glycosylation	Limited	Autosomal recessive

ClinGen Gene-Disease Validity (1)

Expert-panel classifications — Definitive > Strong > Moderate > Limited > Disputed > Refuted.

Disease	Classification	Inheritance
congenital disorder of glycosylation	Limited	AR

Mondo (3): Hirschsprung disease (MONDO:0018309), congenital disorder of glycosylation (MONDO:0015286), disorder of glycosylation (MONDO:0024322)

Orphanet (1): Hirschsprung disease (Orphanet:388)

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

5 associations (top):

Study	Trait	p-value
GCST000246_4	Attention deficit hyperactivity disorder	1.000000e-06
GCST002539_79	Schizophrenia	8.000000e-14
GCST006803_31	Schizophrenia	3.000000e-12
GCST010703_8	Brain morphology (MOSTest)	7.000000e-10
GCST011125_22	Caffeine consumption from coffee	2.000000e-09

EFO canonical traits (2, from GWAS)

EFO ID	Trait name
EFO:0004346	neuroimaging measurement
EFO:0006781	coffee consumption measurement

MeSH disease descriptors (2)

Descriptor	Name	Tree numbers
D018981	Congenital Disorders of Glycosylation	C16.320.565.202.125; C18.452.648.202.125
D006627	Hirschsprung Disease	C06.198.439; C06.405.469.158.701.439; C16.131.314.439

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

39 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Valproic Acid	affects cotreatment, decreases expression, affects expression, increases methylation	6
sodium arsenite	decreases expression, affects cotreatment, increases abundance, increases expression	3
entinostat	decreases expression, affects cotreatment	2
Air Pollutants	affects expression, increases abundance, increases expression	2
Cadmium Chloride	decreases expression, increases abundance	2
FR900359	increases phosphorylation	1
bisphenol F	affects cotreatment, increases expression	1
bisphenol A	affects cotreatment, increases expression	1
butyraldehyde	decreases expression	1
benzo(e)pyrene	increases methylation	1
potassium chromate(VI)	affects cotreatment, increases expression	1
epigallocatechin gallate	affects cotreatment, increases expression	1
di-n-butylphosphoric acid	affects expression	1
CGP 52608	affects binding, increases reaction	1
4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	affects cotreatment, decreases expression	1
dimethylarsinous acid	decreases expression	1
dorsomorphin	decreases expression, affects cotreatment	1
Sunitinib	increases expression	1
Vorinostat	decreases expression	1
Arsenic	affects cotreatment, increases abundance, increases expression	1
Cadmium	decreases expression, increases abundance	1
Cisplatin	decreases expression	1
Dichlorodiphenyl Dichloroethylene	decreases expression	1
Dexamethasone	affects cotreatment, increases expression	1
Diethylhexyl Phthalate	decreases expression	1
Indomethacin	affects cotreatment, increases expression	1
Lead	affects expression	1
Methapyrilene	increases methylation	1
Ozone	increases abundance, affects expression	1
Smoke	decreases expression	1

Clinical trials (associated diseases)

62 trials via MONDO — disease-level, not drug-specific.

Trial	Phase	Status	Title
NCT02343562	PHASE4	UNKNOWN	Probiotics for Prophylaxis of Postoperative Hirschsprungs Associated Enterocolitis
NCT07186647	PHASE4	COMPLETED	Laparoscopic-Assisted Transanal Pull-Through for Hirschsprung Disease in Pediatric:Short and Intermediate Outcomes of Two Different Techniques
NCT03660176	PHASE3	UNKNOWN	Effects of Butyrate Enemas on Postoperative Intestinal Mobility Disorders in Hirschsprung’s Disease
NCT04904081	PHASE3	UNKNOWN	Feasibility of Use of Indocyanine Green in Pediatric Colorectal Surgery
NCT00630838	PHASE2	COMPLETED	Probiotic Prophylaxis of Hirschprung’s Disease Associated Enterocolitis (HAEC)
NCT07572825	PHASE1	NOT_YET_RECRUITING	Assessing the Safety and Tolerability of NMN in DHDDS-CDG
NCT02089789	Not specified	RECRUITING	Clinical and Basic Investigations Into Known and Suspected Congenital Disorders of Glycosylation
NCT02503267	Not specified	UNKNOWN	Incidence and Consequences of Disorders of Glycosylation in Patients With Conotruncal and Septal Heart Defects
NCT02955264	Not specified	COMPLETED	Using D-Galactose as a Food Supplement in Congenital Disorders of Glycosylation
NCT03250728	Not specified	COMPLETED	Role of the Endothelium in Stroke-like Episode Among CDG Patients
NCT03560570	Not specified	COMPLETED	Study of Hemostasis in Patients With Congenital Disorder of Glycosylation
NCT04198987	Not specified	COMPLETED	Dietary Monosaccharide Supplementation in Patients With Congenital Disorders of Glycosylation
NCT04199000	Not specified	RECRUITING	Clinical and Basic Investigations Into Congenital Disorders of Glycosylation
NCT04201067	Not specified	COMPLETED	Large-Scale Metabolomic Profiling for the Diagnosis of Inborn Errors of Metabolism
NCT00671684	PHASE1/PHASE2	UNKNOWN	Endoscopic Mucosal Resection (EMR) for Diagnosis of Hirschsprung’s Disease
NCT01985646	EARLY_PHASE1	COMPLETED	A Trial on Conservative Treatment for Infants’ Hirschsprung Disease
NCT00478712	Not specified	RECRUITING	Hirschsprung Disease Genetic Study
NCT01515501	Not specified	COMPLETED	Endoscopic Mucosal Resection for the Diagnosis of a-Ganglionosis, a Controlled Prospective Trial (EDGE Trial)
NCT01793168	Not specified	RECRUITING	Rare Disease Patient Registry & Natural History Study - Coordination of Rare Diseases at Sanford
NCT01927809	Not specified	UNKNOWN	Genetic Mosaicism in Hirschsprung’s Disease
NCT02193685	Not specified	UNKNOWN	Identification Genetic, Immunologic and Microbial Markers of Hirschsprung Associated Enterocolitis in Children With Hirschsprung Disease
NCT02216994	Not specified	UNKNOWN	A New Scoring System Improves Diagnostic Accuracy of Intestinal Dysganglionosis –a Prospective Study
NCT02296008	Not specified	COMPLETED	3D High Resolution Anorectal Manometry in Children After Surgery for Anorectal Disorders
NCT02776176	Not specified	UNKNOWN	Enhanced Recovery After Surgery In Hirschsprung Disease
NCT02857205	Not specified	COMPLETED	MICROPRUNG : Intestinal Microbiota Analysis in Patients With or Without Hirschsprung’s Associated EnteroColitis
NCT03269812	Not specified	UNKNOWN	Laparoscopic Assisted Pull-through Versus Other Surgical Procedures for Treatment of Hirschsprung Disease
NCT03406741	Not specified	COMPLETED	Neuropsychological Development and Functional Outcome Sin Children With Hirschsprung Disease at School Age
NCT03626350	Not specified	ACTIVE_NOT_RECRUITING	Prospective Evaluation of the Efficacy and Safety of Submucosal Endoscopy
NCT03666767	Not specified	COMPLETED	Management and Outcomes of Congenital Anomalies in Low-, Middle- and High-Income Countries
NCT04020939	Not specified	COMPLETED	The Role of Indocyanine Green Angiography Fluorescence on Intestinal Resections in Pediatric Surgery.
NCT04106947	Not specified	UNKNOWN	Transition of Care for Patients With Hirschsprung Disease and Anorectal Malformations
NCT04149093	Not specified	UNKNOWN	The Association Between Calretinin and the Function of Ganglion Cells in Hirschsprung Disease
NCT04150120	Not specified	COMPLETED	eHealth as an Aid for Facilitating and Supporting Self-management in Families With Long-term Childhood Illness
NCT04213976	Not specified	UNKNOWN	Ostomy in Continuity or Conventional Ileostomy: a Retrospective Multicentric Analysis
NCT04476225	Not specified	COMPLETED	Induced Pluripotent Stem Cells for Disease Research
NCT04598841	Not specified	COMPLETED	Nutrition Support for Hirschsprung Disease
NCT04622410	Not specified	RECRUITING	Registry for Hirschsprung Disease of the BELAPS
NCT04624334	Not specified	TERMINATED	Non-invasive Assessment of Colonic Motility
NCT04713085	Not specified	COMPLETED	Sacral Neuromodulation in Children and Adolescents
NCT04730128	Not specified	COMPLETED	Translation and Validation of a Disease-specific Questionnaire for Hirschsprung’s Disease in Danish Patients