MAOB

Summary

MAOB (monoamine oxidase B, HGNC:6834) is a protein-coding gene on chromosome Xp11.3, encoding Amine oxidase [flavin-containing] B (P27338). Catalyzes the oxidative deamination of primary and some secondary amines such as neurotransmitters, and exogenous amines including the tertiary amine, neurotoxin 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP), with concomitant reduction of oxygen to hydrogen peroxide and pa….

The protein encoded by this gene belongs to the flavin monoamine oxidase family. It is a enzyme located in the mitochondrial outer membrane. It catalyzes the oxidative deamination of biogenic and xenobiotic amines and plays an important role in the metabolism of neuroactive and vasoactive amines in the central nervous sysytem and peripheral tissues. This protein preferentially degrades benzylamine and phenylethylamine.

Source: NCBI Gene 4129 — RefSeq curated summary.

At a glance

• Gene–disease (curated): cerebral palsy (Limited, GenCC)
• Clinical variants (ClinVar): 128 total — 1 pathogenic
• Phenotypes (HPO): 1
• Druggable target: yes — 52 molecules with ChEMBL bioactivity
• MANE Select transcript: NM_000898

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:6834
Approved symbol	MAOB
Name	monoamine oxidase B
Location	Xp11.3
Locus type	gene with protein product
Status	Approved
Ensembl gene	ENSG00000069535
Ensembl biotype	protein_coding
OMIM	309860
Entrez	4129

Gene structure

Transcript identifiers

Ensembl transcripts: 15 — 13 protein_coding, 2 protein_coding_CDS_not_defined

ENST00000378069, ENST00000468431, ENST00000487544, ENST00000890306, ENST00000890307, ENST00000890308, ENST00000890309, ENST00000890310, ENST00000890311, ENST00000890312, ENST00000890313, ENST00000962440, ENST00000962441, ENST00000962442, ENST00000962443

RefSeq mRNA: 1 — MANE Select: NM_000898 NM_000898

CCDS: CCDS14261

Canonical transcript exons

ENST00000378069 — 15 exons

Exon	Start	End
ENSE00001035764	43797125	43797266
ENSE00001035768	43780342	43780395
ENSE00001035772	43793419	43793578
ENSE00001035775	43781448	43781544
ENSE00001035777	43795739	43795888
ENSE00001035781	43778682	43778739
ENSE00001332403	43766610	43767618
ENSE00001476175	43882254	43882450
ENSE00001700569	43775175	43775272
ENSE00003470303	43769307	43769418
ENSE00003472484	43843670	43843764
ENSE00003504290	43768654	43768716
ENSE00003567619	43838868	43839005
ENSE00003583665	43802172	43802263
ENSE00003685886	43803300	43803404

Expression profiles

Bgee: expression breadth ubiquitous, 268 present calls, max score 98.24.

FANTOM5 (CAGE): breadth broad, TPM avg 10.2437 / max 500.6770, expressed in 568 samples.

FANTOM5 promoters (4 alternative TSS)

Promoter ID	TPM avg	Samples expressed
198986	9.8470	561
198987	0.2201	131
209663	0.0920	65
198988	0.0845	58

Top tissues by expression

291 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
saphenous vein	UBERON:0007318	98.24	gold quality
lateral globus pallidus	UBERON:0002476	98.14	gold quality
decidua	UBERON:0002450	98.13	gold quality
cauda epididymis	UBERON:0004360	97.86	gold quality
middle frontal gyrus	UBERON:0002702	97.72	gold quality
hypothalamus	UBERON:0001898	97.70	gold quality
left ovary	UBERON:0002119	97.56	gold quality
superior vestibular nucleus	UBERON:0007227	97.52	gold quality
liver	UBERON:0002107	97.48	gold quality
right lobe of liver	UBERON:0001114	97.46	gold quality
body of uterus	UBERON:0009853	97.36	gold quality
urethra	UBERON:0000057	97.30	gold quality
left uterine tube	UBERON:0001303	97.28	gold quality
right ovary	UBERON:0002118	97.26	gold quality
ileal mucosa	UBERON:0000331	97.23	gold quality
myometrium	UBERON:0001296	97.17	gold quality
left ventricle myocardium	UBERON:0006566	97.10	gold quality
right uterine tube	UBERON:0001302	96.91	gold quality
nucleus accumbens	UBERON:0001882	96.91	gold quality
seminal vesicle	UBERON:0000998	96.85	gold quality
right coronary artery	UBERON:0001625	96.75	gold quality
parotid gland	UBERON:0001831	96.68	gold quality
jejunal mucosa	UBERON:0000399	96.58	gold quality
hindlimb stylopod muscle	UBERON:0004252	96.58	gold quality
caudate nucleus	UBERON:0001873	96.56	gold quality
nipple	UBERON:0002030	96.56	gold quality
skeletal muscle tissue of rectus abdominis	UBERON:0004511	96.43	gold quality
duodenum	UBERON:0002114	96.40	gold quality
CA1 field of hippocampus	UBERON:0003881	96.36	gold quality
myocardium	UBERON:0002349	96.17	gold quality

Single-cell (SCXA)

Detected in 7 experiment(s), a significant marker in 7.

Experiment	Marker?	Max mean expression
E-MTAB-6701	yes	124.72
E-CURD-88	yes	31.41
E-MTAB-6678	yes	28.46
E-MTAB-8410	yes	13.59
E-ANND-3	yes	13.21
E-CURD-114	yes	11.67
E-CURD-122	yes	9.87

Regulation

Is transcription factor: no

Upstream regulators (CollecTRI, top): CDCA7L, EAPP, EGR1, ESR1, ESR2, ESRRA, JUN, KLF10, KLF11, KLF5, PAX3, RARA, RXRA, SP1, SP3, SP4, ZHX2

miRNA regulators (miRDB)

42 targeting MAOB, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-574-5P	100.00	66.01	989
HSA-MIR-3613-3P	100.00	76.36	7965
HSA-MIR-12118	100.00	65.88	1270
HSA-MIR-3185	99.99	68.12	1959
HSA-MIR-4282	99.99	75.36	6408
HSA-MIR-3173-3P	99.98	66.49	1217
HSA-MIR-6891-5P	99.98	66.53	1372
HSA-MIR-499A-5P	99.98	70.79	1323
HSA-MIR-2110	99.96	66.68	1930
HSA-MIR-144-3P	99.94	73.98	2698
HSA-MIR-101-3P	99.94	75.03	2230
HSA-MIR-8087	99.90	69.55	1351
HSA-MIR-3151-5P	99.86	63.83	1069
HSA-MIR-765	99.84	68.24	2442
HSA-MIR-26A-1-3P	99.64	66.81	788
HSA-MIR-26A-2-3P	99.64	66.82	786
HSA-MIR-3975	99.62	65.97	697
HSA-MIR-520F-5P	99.34	70.40	1632
HSA-MIR-361-3P	99.19	66.45	1381
HSA-MIR-10399-5P	99.17	69.87	2610
HSA-MIR-6504-3P	99.17	69.31	2891
HSA-MIR-4744	99.01	69.91	1581
HSA-MIR-1207-3P	98.99	66.22	1532
HSA-MIR-1843	98.97	66.07	838
HSA-MIR-4802-5P	98.97	66.26	833
HSA-MIR-3149	98.77	67.13	1639
HSA-MIR-5197-3P	98.71	67.05	1905
HSA-MIR-6894-5P	98.70	63.78	809
HSA-MIR-6830-3P	98.62	68.07	1760
HSA-MIR-4710	98.61	65.96	1048

Literature-anchored findings (GeneRIF, showing 40)

• X ray structure to 3 A resolution (PMID:11753429)
• Substrates but not inhibitors alter the redox potentials of monoamine oxidases. (PMID:11761322)
• Analysis of conserved active site residues in monoamine oxidase A and B and their three-dimensional molecular modeling (PMID:11861643)
• Activation of human monoamine oxidase B gene expression by a protein kinase C MAPK signal transduction pathway involves c-Jun and Egr-1. (PMID:11956220)
• a strong gender difference exists with respect to the modifying effect of MAO-B genotype on the smoking association with parkinson disease (PMID:12428723)
• MAO-B polymorphisms are associated with smoking behaviour (PMID:12563176)
• study shows that the monoamine oxidase A structure is “more flexible” than that of monoamine oxidase B and that clorgyline and pargyline inactivation increase structural stability of both enzymes (PMID:12777388)
• There was no interaction of smoking and the G allele and risk of Parkinson disease. (PMID:12815741)
• molecular models and binding sites of inhibitors (PMID:12825788)
• MAO B gene expression is selectively induced by a decreased Sp3/Sp1 ratio and reduced DNA methylation (PMID:12855685)
• The 1.7-A structure of the reversible isatin-MAO-B complex has been determined; it forms a basis for the interpretation of the enzyme’s structure when bound to either reversible or irreversible inhibitors. (PMID:12913124)
• MAO-B elevation was found to abolish the spare alpha-ketoglutarate dehydrogenase threshold capacity, which can normally be significantly inhibited before it affects maximal mitochondrial oxygen consumption rates. (PMID:12963742)
• Smoking is associated with low platelet MAO activity not only because of the direct inhibitory effect of tobacco constituents on the enzyme, but also because subjects with low platelet MAO activity are more likely to become smokers. (PMID:14659989)
• The structural details of the interactions of the covalent 8alpha-S-cysteinyl-FAD with the protein moiety in monoamine oxidase B (MAO B) based on the MAO B crystal structure are described in this review. (PMID:14697881)
• In the promoter region, a new polymorphism consisting of a C to T single base change was detected in position -1,114 from ATG, with an allelic frequency of 3.5%, but it was not associated with PD risK. (PMID:14743364)
• (TGF)-beta-inducible early gene (TIEG)2 increased MAO B gene expression at promoter, mRNA, protein, and catalytic activity levels in both SH-SY5Y and HepG2 cells. (PMID:15024015)
• Results show that I(2)-imidazoline receptor density and monoamine oxidase-B activity are only weakly correlated in platelets. (PMID:15028609)
• No mutations found in platelets of patients with Huntington disease. (PMID:15057517)
• There was no evidence of epistatic interaction between MAOA, MOAB, and COMT genes on Overt aggression scale scores. (PMID:15211623)
• This review addresses several factors contributing to a possible role for MAO-B in normal brain aging and neurological disease. (PMID:15247489)
• maoa and maob genes play important role in dopamine degradation. (PMID:15261699)
• Low MAOB, and consequently expectedly high phenylethylamine levels in neonates is consistent with phenylketonuria in newborns (review) (PMID:15461973)
• results are consistent with those of the hypothesis of MAO-B acting as a modifying gene in phenylketonuria (PMID:15589121)
• Examination of the regional distribution of MAO-B revealed lower [(3)H]lazabemide binding to MAO-B in the lateral and basal nuclei of the amygdala and higher binding in the medial nucleus (PMID:15862518)
• This longitudinal analysis provides preliminary evidence that changes in platelet MAO activity and cholesterol, which may reflect changes in central serotonergic activity are associated with attention deficit in adolescents. (PMID:15921854)
• important component of the active site structure of hMAO A is the loop conformation of residues 210-216, which differs from that of hMAO B and rat MAO A (PMID:16129825)
• ERs compete with ERRs for binding to the MAO-B promoter at selective AGGTCA motifs, thereby changing the chromatin status and cofactor recruitment to a repressed state. (PMID:16484337)
• This study found a relationship between the A/G polymorphism in intron 13 of the MAO-B gene and intensity of postoperative pain in males. Higher average intensity of postoperative pain was detected in males with the G allele. (PMID:16807522)
• Our results add to the evidence of involvement of MAOB in PD and suggest that the effect may be stronger in women. (PMID:17044053)
• MAOB allele A was an independent factor predisposing to early onset of Parkinson’s disease. (PMID:17270484)
• After controlling for smoking, veterans with psychotic PTSD had significantly higher platelet MAO-B activity than veterans with or without PTSD, or healthy subjects. (PMID:17289152)
• Results show that the two markers of lower serotonergic capacity, 5-HTTLPR S allele and low platelet MAO activity, have a similar and partly synergistic influence on self-reported as well as performance measures of impulsivity. (PMID:17628790)
• MAOB A644G single nucleotide polymorphism is involved in the outcome of treatment with mirtazapine or paroxetine in females with major depression (PMID:17640790)
• Analyzed the genotype distributions and allele frequencies for the MAO-A and MAO-B polymorphism of the MAO gene among the patients with fibromyalgia syndrome. (PMID:17885758)
• this study provides the strongest evidence for the involvement of MAOB gene in the etiology of ADHD to date, at least in Han Chinese population (PMID:17918234)
• The MAOB gene was found specifically associated in the adult ADHD sample (P=0.0029; OR=1.90). (PMID:17938636)
• These data suggest that the structural properties of the active site cavities in rat MAOs are significantly different from the two human enzymes, which correlates with the differences in the inhibitor specificities between human and rat MAOs. (PMID:18092818)
• Variants in FGF20 and MAOB show evidence of statistical interactions and potential patterns of biological interaction contributing to Parkinson disease risk. (PMID:18205889)
• an association in girls between low platelet MAO-B activity and symptoms of Oppositional Defiant Disorder. (PMID:18430257)
• Recent adaptive selection at MAOB and ancestral susceptibility to schizophrenia are reported. (PMID:18553363)

Cross-species orthologs

15 orthologs

Organism	Symbol	Gene ID
danio_rerio	mao	ENSDARG00000023712
danio_rerio	zgc:66484	ENSDARG00000030478
danio_rerio	si:ch211-127i16.2	ENSDARG00000092976
mus_musculus	Maob	ENSMUSG00000040147
rattus_norvegicus	Maob	ENSRNOG00000029778
drosophila_melanogaster	CG10561	FBGN0002036
drosophila_melanogaster	CG7737	FBGN0033584
drosophila_melanogaster	CG5653	FBGN0035943
drosophila_melanogaster	CG7460	FBGN0036749
drosophila_melanogaster	CG6034	FBGN0036750
drosophila_melanogaster	CG8032	FBGN0037606
drosophila_melanogaster	shps	FBGN0286199
caenorhabditis_elegans		WBGENE00000137
caenorhabditis_elegans	spr-5	WBGENE00005010
caenorhabditis_elegans		WBGENE00011615

Paralogs (7): KDM1A (ENSG00000004487), SMOX (ENSG00000088826), IL4I1 (ENSG00000104951), PPOX (ENSG00000143224), PAOX (ENSG00000148832), KDM1B (ENSG00000165097), MAOA (ENSG00000189221)

Protein

Protein identifiers

Amine oxidase [flavin-containing] B — P27338 (reviewed: P27338)

Alternative names: Monoamine oxidase type B

All UniProt accessions (1): P27338

UniProt curated annotations — full annotation on UniProt →

Function. Catalyzes the oxidative deamination of primary and some secondary amines such as neurotransmitters, and exogenous amines including the tertiary amine, neurotoxin 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP), with concomitant reduction of oxygen to hydrogen peroxide and participates in the metabolism of neuroactive and vasoactive amines in the central nervous system and peripheral tissues. Preferentially degrades benzylamine and phenylethylamine.

Subunit / interactions. Monomer, homo- or heterodimer (containing two subunits of similar size). Each subunit contains a covalently bound flavin. Enzymatically active as monomer.

Subcellular location. Mitochondrion outer membrane.

Activity regulation. Inhibited by deprenyl.

Similarity. Belongs to the flavin monoamine oxidase family.

Isoforms (2)

UniProt ID	Names	Canonical?
P27338-1	1	yes
P27338-2	2

RefSeq proteins (1): NP_000889* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR001613	Flavin_amine_oxidase	Family
IPR002937	Amino_oxidase	Domain
IPR036188	FAD/NAD-bd_sf	Homologous_superfamily
IPR050703	Flavin_MAO	Family

Pfam: PF01593

Enzyme classification (BRENDA):

• EC 1.4.3.4 — monoamine oxidase (BRENDA: 65 organisms, 330 substrates, 1539 inhibitors, 310 Km, 144 kcat entries)

Substrate kinetics (BRENDA)

66 substrates with measured Km, best-characterized 15. Km ranges are aggregated across organisms/conditions.

Substrate	Km (mM)	Measurements
BENZYLAMINE	0.0109–82	43
KYNURAMINE	0.0161–5.123	27
SEROTONIN	0.069–4.7	26
2-PHENYLETHYLAMINE	0.016–86	25
PHENYLETHYLAMINE	0.0004–6.34	18
TRYPTAMINE	0.0185–5.1	12
TYRAMINE	0.018–6.14	12
1-METHYL-4-PHENYL-1,2,3,6-TETRAHYDROPYRIDINE	0.033–0.797	8
4-TYRAMINE	0.83–5.5	6
4-[(1R)-2-AMINO-1-HYDROXYETHYL]BENZENE-1,2-DIOL	0.57–3.5	6
DOPAMINE	0.088–4.71	6
N-METHYLHISTAMINE	0.29–7.5	6
O2	0.0093–0.33	5
P-NITROPHENYLETHYLAMINE	0.005–0.22	5
(S)-1,2,3,4-TETRAHYDRO-1-METHYLISOQUINOLINE	1.12–1.96	4

Catalyzed reactions (Rhea), 9 shown:

• a primary methyl amine + O2 + H2O = an aldehyde + H2O2 + NH4(+) (RHEA:16153)
• 2-phenylethylamine + O2 + H2O = 2-phenylacetaldehyde + H2O2 + NH4(+) (RHEA:25265)
• a secondary aliphatic amine + O2 + H2O = a primary amine + an aldehyde + H2O2 (RHEA:26414)
• dopamine + O2 + H2O = 3,4-dihydroxyphenylacetaldehyde + H2O2 + NH4(+) (RHEA:27946)
• tyramine + O2 + H2O = (4-hydroxyphenyl)acetaldehyde + H2O2 + NH4(+) (RHEA:30591)
• (R)-adrenaline + O2 + H2O = (R)-3,4-dihydroxymandelaldehyde + methylamine + H2O2 (RHEA:51168)
• benzylamine + O2 + H2O = benzaldehyde + H2O2 + NH4(+) (RHEA:59424)
• (R)-noradrenaline + O2 + H2O = (R)-3,4-dihydroxymandelaldehyde + H2O2 + NH4(+) (RHEA:69076)
• N-acetylputrescine + O2 + H2O = 4-acetamidobutanal + H2O2 + NH4(+) (RHEA:70283)

UniProt features (84 total): strand 26, helix 25, mutagenesis site 15, turn 4, modified residue 3, splice variant 3, site 3, topological domain 2, initiator methionine 1, chain 1, transmembrane region 1

Structure

Experimental structures (PDB)

57 structures, top 30 by resolution.

PDB	Method	Resolution (Å)
9FJT	X-RAY DIFFRACTION	1.4
1S3E	X-RAY DIFFRACTION	1.6
28WL	X-RAY DIFFRACTION	1.6
2V5Z	X-RAY DIFFRACTION	1.6
2XFN	X-RAY DIFFRACTION	1.6
6FW0	X-RAY DIFFRACTION	1.6
9R3K	X-RAY DIFFRACTION	1.6
1S3B	X-RAY DIFFRACTION	1.65
2XFP	X-RAY DIFFRACTION	1.66
1OJA	X-RAY DIFFRACTION	1.7
2C65	X-RAY DIFFRACTION	1.7
2C67	X-RAY DIFFRACTION	1.7
2C75	X-RAY DIFFRACTION	1.7
2C76	X-RAY DIFFRACTION	1.7
2V61	X-RAY DIFFRACTION	1.7
4A7A	X-RAY DIFFRACTION	1.7
6FWC	X-RAY DIFFRACTION	1.7
6RKP	X-RAY DIFFRACTION	1.7
9R3J	X-RAY DIFFRACTION	1.7
2BK3	X-RAY DIFFRACTION	1.8
3PO7	X-RAY DIFFRACTION	1.8
4CRT	X-RAY DIFFRACTION	1.8
6FVZ	X-RAY DIFFRACTION	1.8
6YT2	X-RAY DIFFRACTION	1.8
9R2J	X-RAY DIFFRACTION	1.8
2BK5	X-RAY DIFFRACTION	1.83
4A79	X-RAY DIFFRACTION	1.89
2BK4	X-RAY DIFFRACTION	1.9
2XCG	X-RAY DIFFRACTION	1.9
2C72	X-RAY DIFFRACTION	2

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-P27338-F1	95.68	0.92

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Catalytic / active sites (3): 156 (important for catalytic activity); 365 (important for catalytic activity); 382 (important for catalytic activity)

Post-translational modifications (3): 397, 2, 52

Mutagenesis-validated functional residues (15):

Position	Phenotype
5	no loss of activity.
156	complete loss of activity.
158	dramatic loss of activity.
172	no loss of activity.
192	no loss of activity.
199	alters specificity towards synthetic inhibitors.
297	no loss of activity.
312	no loss of activity.
365	complete loss of activity.
382	significant loss of activity.
386	no loss of activity.
389	complete loss of activity.
389	no loss of activity.
394	no loss of activity.
397	complete loss of activity.

Function

Pathways and Gene Ontology

Reactome pathways

5 pathways

ID	Pathway
R-HSA-141333	Biogenic amines are oxidatively deaminated to aldehydes by MAOA and MAOB
R-HSA-140179	Amine Oxidase reactions
R-HSA-1430728	Metabolism
R-HSA-211859	Biological oxidations
R-HSA-211945	Phase I - Functionalization of compounds

MSigDB gene sets: 187 (showing top): GOBP_PHENOL_CONTAINING_COMPOUND_METABOLIC_PROCESS, MODULE_93, MODULE_52, REACTOME_BIOLOGICAL_OXIDATIONS, MODULE_66, GOBP_REACTIVE_OXYGEN_SPECIES_BIOSYNTHETIC_PROCESS, TURASHVILI_BREAST_CARCINOMA_DUCTAL_VS_LOBULAR_DN, OSWALD_HEMATOPOIETIC_STEM_CELL_IN_COLLAGEN_GEL_UP, GOBP_DOPAMINE_METABOLIC_PROCESS, SOX9_B1, KEGG_HISTIDINE_METABOLISM, GOBP_NEURAL_NUCLEUS_DEVELOPMENT, HOSHIDA_LIVER_CANCER_SUBCLASS_S3, TGCTGAY_UNKNOWN, GOBP_SUBSTANTIA_NIGRA_DEVELOPMENT

GO Biological Process (3): substantia nigra development (GO:0021762), dopamine catabolic process (GO:0042420), hydrogen peroxide biosynthetic process (GO:0050665)

GO Molecular Function (6): primary methylamine oxidase activity (GO:0008131), electron transfer activity (GO:0009055), flavin adenine dinucleotide binding (GO:0050660), monoamine oxidase activity (GO:0097621), protein binding (GO:0005515), oxidoreductase activity (GO:0016491)

GO Cellular Component (4): mitochondrion (GO:0005739), mitochondrial envelope (GO:0005740), mitochondrial outer membrane (GO:0005741), membrane (GO:0016020)

Reactome top-level categories

Rollup of top-4 pathways:

Category	Pathways
Amine Oxidase reactions	1
Phase I - Functionalization of compounds	1
Metabolism	1
Biological oxidations	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
oxidoreductase activity, acting on the CH-NH2 group of donors, oxygen as acceptor	2
midbrain development	1
neural nucleus development	1
dopamine metabolic process	1
catecholamine catabolic process	1
hydrogen peroxide metabolic process	1
reactive oxygen species biosynthetic process	1
molecular_function	1
nucleotide binding	1
anion binding	1
binding	1
catalytic activity	1
cytoplasm	1
intracellular membrane-bounded organelle	1
mitochondrion	1
organelle envelope	1
mitochondrial membrane	1
organelle outer membrane	1
cellular anatomical structure	1

Protein interactions and networks

STRING

3240 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
MAOB	COMT	P21964	967
MAOB	ACHE	P22303	902
MAOB	TOMT	Q8WZ04	897
MAOB	SLC6A3	Q01959	883
MAOB	DDC	P20711	873
MAOB	SLC6A4	P31645	866
MAOB	DBH	P09172	850
MAOB	SNCA	P37840	815
MAOB	HTR1B	P28222	803
MAOB	HTR2C	P28335	796
MAOB	AOC2	O75106	794
MAOB	TH	P07101	792
MAOB	SLC18A2	Q05940	792
MAOB	BCHE	P06276	791
MAOB	DRD4	P21917	786

IntAct

103 interactions, top by confidence:

A	B	Type	Score
MAOA	MAOB	psi-mi:“MI:0915”(physical association)	0.670
MAOA	MAOB	psi-mi:“MI:0914”(association)	0.670
MAOB	FGF14	psi-mi:“MI:0915”(physical association)	0.560
MAOB	RHBDD2	psi-mi:“MI:0915”(physical association)	0.560
MAOB	COX20	psi-mi:“MI:0915”(physical association)	0.560
MAOB	CASP6	psi-mi:“MI:0915”(physical association)	0.560
MAOB	CHAT	psi-mi:“MI:0915”(physical association)	0.560
MAOB	FGFR3	psi-mi:“MI:0915”(physical association)	0.560
MAOB	GLE1	psi-mi:“MI:0915”(physical association)	0.560
MAOB	GSN	psi-mi:“MI:0915”(physical association)	0.560
MAOB	HRAS	psi-mi:“MI:0915”(physical association)	0.560
MAOB	LAMP2	psi-mi:“MI:0915”(physical association)	0.560
MAOB	RAN	psi-mi:“MI:0915”(physical association)	0.560
MAOB		psi-mi:“MI:0915”(physical association)	0.560
KLF11	MAOB	psi-mi:“MI:0915”(physical association)	0.560
MAOB	NUP58	psi-mi:“MI:0915”(physical association)	0.560
MAOB	UBQLN1	psi-mi:“MI:0915”(physical association)	0.560
MAOB	SH3GLB1	psi-mi:“MI:0915”(physical association)	0.560
MAOB	PRPF40A	psi-mi:“MI:0915”(physical association)	0.560
MAOB	COQ8A	psi-mi:“MI:0915”(physical association)	0.560
MAOB	SPRED1	psi-mi:“MI:0915”(physical association)	0.560

BioGRID (40): MAOB (Affinity Capture-MS), MAOB (Affinity Capture-MS), MAOB (Two-hybrid), FGF14 (Two-hybrid), COX20 (Two-hybrid), MAOB (Proximity Label-MS), MAOB (Two-hybrid), MAOB (Affinity Capture-MS), MAOB (Affinity Capture-MS), MAOB (Affinity Capture-MS), MAOB (Affinity Capture-MS), MAOB (Affinity Capture-MS), MAOB (Affinity Capture-MS), MAOB (Affinity Capture-MS), MAOB (Affinity Capture-MS)

ESM2 similar proteins: A0A0P0XM10, A0A2U8QPE6, A6MFL0, A8QL51, A8QL52, A8QL58, B0VXW0, B5AR80, B5U6Y8, G8XQX1, J7H670, O64411, P0C2D5, P0DO52, P19643, P21396, P21397, P21398, P23623, P27338, P49253, P54982, P56560, P57681, P58027, P58028, P81382, P81383, P86810, Q0J290, Q4JHE1, Q4JHE2, Q4JHE3, Q5NU32, Q5R748, Q5RE60, Q5RE98, Q64133, Q6NSN2, Q6PLK3

Diamond homologs: A0A1B1PF34, B0VXW0, D6A5I3, F4JLS1, O24164, O60341, P0A3V2, P0A3V3, P19643, P25017, P27338, P40974, P56560, Q04564, Q4F867, Q5RE98, Q6Q2J0, Q6ZQ88, Q7YRB7, Q8BW75, Q8KHS0, Q8L3C7, Q8S9J1, Q94IG7, Q96RQ9, Q9VW97, S4S6Z0, A0A024BTN9, A0A2U8QPE6, A2XDA1, A6MFL0, A8QL51, A8QL52, A8QL58, B5AR80, B5U6Y8, C0HJE7, C3VEP9, C3VEQ0, F8S0Z5

SIGNOR signaling

14 interactions.

A	Effect	B	Mechanism
CDCA7L	“down-regulates quantity by repression”	MAOB	“transcriptional regulation”
EAPP	“down-regulates quantity by repression”	MAOB	“transcriptional regulation”
SP1	“up-regulates quantity by expression”	MAOB	“transcriptional regulation”
SP4	“up-regulates quantity by expression”	MAOB	“transcriptional regulation”
SP3	“down-regulates quantity by repression”	MAOB	“transcriptional regulation”
MAOB	“down-regulates quantity”	3-methoxytyramine	“chemical modification”
MAOB	“down-regulates quantity”	dopamine	“chemical modification”
MAOB	“up-regulates quantity”	3,4-dihydroxyphenylacetaldehyde	“chemical modification”
MAOB	“down-regulates quantity”	serotonin	“chemical modification”
MAOB	“up-regulates quantity”	(R)-adrenaline	“chemical modification”
MAOB	“up-regulates quantity”	(R)-noradrenaline	“chemical modification”
Phenelzine	“down-regulates activity”	MAOB	“chemical inhibition”
(-)-selegiline	“down-regulates activity”	MAOB	“chemical inhibition”
moclobemide	“down-regulates activity”	MAOB	“chemical inhibition”

Disease & clinical

Clinical variants and AI predictions

ClinVar

128 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	1
Likely pathogenic	0
Uncertain significance	44
Likely benign	7
Benign	5

Top pathogenic / likely-pathogenic (1)

Variant ID	HGVS	Classification
813719	GRCh37/hg19 Xp11.4-11.3(chrX:41150139-43976458)	Pathogenic

SpliceAI

2925 predictions. Top by Δscore:

Variant	Effect	Δscore
X:43778676:CCTTA:C	donor_loss	1.0000
X:43778679:TACCT:T	donor_loss	1.0000
X:43778680:AC:A	donor_loss	1.0000
X:43778681:C:CA	donor_loss	1.0000
X:43778738:ACCT:A	acceptor_loss	1.0000
X:43778739:CCT:C	acceptor_loss	1.0000
X:43778741:T:A	acceptor_loss	1.0000
X:43778746:A:AC	acceptor_gain	1.0000
X:43780336:TGTTA:T	donor_loss	1.0000
X:43780337:GTTAC:G	donor_loss	1.0000
X:43780338:TTACC:T	donor_loss	1.0000
X:43780339:TACCT:T	donor_loss	1.0000
X:43780340:A:T	donor_loss	1.0000
X:43780341:C:CT	donor_loss	1.0000
X:43780345:T:A	donor_gain	1.0000
X:43780391:TAAAT:T	acceptor_gain	1.0000
X:43780395:TCT:T	acceptor_loss	1.0000
X:43780396:C:CC	acceptor_gain	1.0000
X:43780397:T:A	acceptor_loss	1.0000
X:43780403:A:AC	acceptor_gain	1.0000
X:43780405:A:AC	acceptor_gain	1.0000
X:43780405:A:C	acceptor_gain	1.0000
X:43781442:CCTTA:C	donor_loss	1.0000
X:43781443:CTTA:C	donor_loss	1.0000
X:43781444:TTACC:T	donor_loss	1.0000
X:43781445:T:TG	donor_loss	1.0000
X:43781446:A:AC	donor_gain	1.0000
X:43781446:AC:A	donor_gain	1.0000
X:43781446:ACC:A	donor_gain	1.0000
X:43781447:C:CC	donor_gain	1.0000

AlphaMissense

3381 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
X:43775246:C:A	W388C	0.999
X:43775246:C:G	W388C	0.999
X:43775248:A:G	W388R	0.999
X:43775248:A:T	W388R	0.999
X:43793431:A:G	W306R	0.999
X:43793431:A:T	W306R	0.999
X:43797201:G:A	S181F	0.999
X:43769327:C:A	G443W	0.998
X:43769330:C:G	A442P	0.998
X:43769342:C:A	G438W	0.998
X:43793429:C:A	W306C	0.998
X:43793429:C:G	W306C	0.998
X:43793459:C:A	K296N	0.998
X:43793459:C:G	K296N	0.998
X:43797201:G:T	S181Y	0.998
X:43802218:C:G	D144H	0.998
X:43843685:C:A	R42S	0.998
X:43843685:C:G	R42S	0.998
X:43843686:C:G	R42T	0.998
X:43769342:C:G	G438R	0.997
X:43769342:C:T	G438R	0.997
X:43769353:C:T	G434D	0.997
X:43769360:A:G	W432R	0.997
X:43769360:A:T	W432R	0.997
X:43769383:G:T	A424E	0.997
X:43775219:G:C	C397W	0.997
X:43781535:C:T	G313E	0.997
X:43793461:T:C	K296E	0.997
X:43838962:C:T	G62E	0.997
X:43838977:C:T	G57E	0.997

dbSNP variants (sampled 300 via entrez): RS1000040857 (X:43840102 T>C), RS1000048335 (X:43857291 C>T), RS1000055494 (X:43801967 G>A), RS1000083105 (X:43824250 G>A), RS1000143476 (X:43848520 T>A), RS1000161191 (X:43771300 A>C,G), RS1000208817 (X:43771555 AGGAACCCTTCCTACAAGAGAAG>A), RS1000276438 (X:43825261 C>T), RS1000306754 (X:43819249 C>T), RS1000333168 (X:43816254 C>T), RS1000335093 (X:43865327 T>A), RS1000343650 (X:43873296 A>C), RS1000397651 (X:43873671 C>A,T), RS1000410946 (X:43809808 A>G), RS1000568244 (X:43822997 C>G,T)

Disease associations

OMIM: gene MIM:309860 | disease phenotypes:

GenCC curated gene-disease

Disease	Classification	Inheritance
cerebral palsy	Limited	Autosomal dominant

Mondo (2): microcephaly (MONDO:0001149), cerebral palsy (MONDO:0006497)

Orphanet (0):

HPO phenotypes

1 total (1 of 1 shown, HPO-id order):

HPO	Term
HP:0000252	Microcephaly

GWAS associations

0 associations (top):

MeSH disease descriptors (2)

Descriptor	Name	Tree numbers
D002547	Cerebral Palsy	C10.228.140.140.254
D008831	Microcephaly	C05.660.207.620; C10.500.507.400.500; C16.131.621.207.620; C16.131.666.507.400.500

Drugs & pharmacology

Drug and pharmacology data

Is drug target: yes

ChEMBL targets (2): CHEMBL2039 (SINGLE PROTEIN), CHEMBL2095205 (PROTEIN FAMILY)

Molecules with ChEMBL bioactivity

52 molecules (phase ≥1), by development phase (incl. off-target/promiscuous compounds). Patent mentions across the top 20 by phase: 388,308 (via chembl_molecule»patent_compound — counts attach to the compound, not the gene–compound relationship, so off-target/promiscuous molecules can dominate).

Molecule	Name	Phase	Patents
CHEMBL104	CLOTRIMAZOLE	4	56,325
CHEMBL1089	PHENELZINE	4	18,793
CHEMBL1200904	SELEGILINE HYDROCHLORIDE	4	5,084
CHEMBL1201142	RASAGILINE MESYLATE	4	716
CHEMBL121	ROSIGLITAZONE	4	58,849
CHEMBL1257051	TEDIZOLID	4	1,778
CHEMBL126	LINEZOLID	4	27,339
CHEMBL18116	TOLOXATONE	4	4,955
CHEMBL191083	METHYLENE BLUE CATION	4	7,622
CHEMBL396778	SAFINAMIDE	4	1,454
CHEMBL3989843	TRANYLCYPROMINE	4	70
CHEMBL408	TROGLITAZONE	4	38,856
CHEMBL431770	ISTRADEFYLLINE	4	1,769
CHEMBL502	DONEPEZIL	4	43,493
CHEMBL506	PRIMAQUINE	4	10,279
CHEMBL53418	DANTHRON	4	4,229
CHEMBL590	MENADIONE	4	21,034
CHEMBL595	PIOGLITAZONE	4	57,130
CHEMBL673	PARGYLINE	4	11,884
CHEMBL750	ZONISAMIDE	4	16,649
CHEMBL86304	MOCLOBEMIDE	4
CHEMBL887	RASAGILINE	4
CHEMBL91	MICONAZOLE	4
CHEMBL92401	IPRONIAZID	4
CHEMBL972	SELEGILINE	4
CHEMBL596	FENTANYL	4
CHEMBL10316	IDAZOXAN	3
CHEMBL140	CURCUMIN	3
CHEMBL165	RESVERATROL	3
CHEMBL50	QUERCETIN	3

PharmGKB: 1 entry (VIP=true, CPIC=false)

PharmGKB variants

1 variants.

Variant	Genes	Level	Score	#Clin annots	Drugs
rs1799836	MAOB		0.00	0

GtoPdb / IUPHAR curated pharmacology

(IUPHAR/BPS Guide to Pharmacology — expert-curated)

Target class: enzyme — Catecholamine turnover

Most potent curated ligand interactions (13 total), top 13:

Ligand	Action	Affinity	Parameter
mofegiline	Irreversible inhibition	8.44	pIC50
rasagiline	Inhibition	7.85	pIC50
phenelzine	Irreversible inhibition	7.82	pKi
acacetin	Inhibition	7.31	pKi
lazabemide	Inhibition	7.08	pKi
safinamide	Inhibition	6.35	pKi
salidroside	Inhibition	6.04	pKi
selegiline	Inhibition	6.0	pKi
moclobemide	Inhibition	5.97	pKi
pargyline	Inhibition	5.74	pIC50
linezolid	Inhibition	5.68	pIC50
tranylcypromine	Inhibition	4.72	pIC50
bifemelane	Inhibition	4.34	pKi

Binding affinities (BindingDB)

495 measured of 1301 human assays (1321 total across all organisms); most potent 50 below. Values come from heterogeneous assays and are not directly comparable.

Ligand	Measure	Value	Patent
1,4-Bis(2-pentanoylimino-5-(2-methoxy-2-oxoethylidene)-4-oxo-thiazolidin-3-yl)benzene (5a)	IC50	1 nM
6-Oxo-7,8,9,10-tetrahydrobenzo[c]chromen-3-yl benzoate	IC50	1 nM
3,4-dichloro-N-(1H-pyrrolo[3,2-b]pyridin-5-yl)benzamide	IC50	1.13 nM	US-9738640: Substituted benzamide derivatives as in vitro MAO-B inhibitors
tert-butyl N-[1-[3-[2-[3-[4-(methanesulfonamido)phenyl]-4-oxochromen-7-yl]ethynyl]azetidine-1-carbonyl]cyclopropyl]-N-methylcarbamate	IC50	2.3 nM	US-8673966: ALDH-2 inhibitors in the treatment of addiction
2-[4-[2-[5-(4-acetylpiperazin-1-yl)-2-pyridinyl]ethyl]phenyl]acetohydrazide	IC50	3.2 nM	US-9603833: Benzene or thiophene derivative and use thereof as VAP-1 inhibitor
N-[4-[7-[2-[1-(cyclobutanecarbonyl)azetidin-3-yl]ethynyl]-4-oxochromen-3-yl]phenyl]methanesulfonamide	IC50	4 nM	US-8673966: ALDH-2 inhibitors in the treatment of addiction
CLG	IC50	4.5 nM
N-[4-[7-[2-[1-(cyclopropanecarbonyl)azetidin-3-yl]ethynyl]-4-oxochromen-3-yl]phenyl]methanesulfonamide	IC50	5 nM	US-8673966: ALDH-2 inhibitors in the treatment of addiction
N-[4-[7-[2-[1-(3-hydroxy-3-methylcyclobutanecarbonyl)azetidin-3-yl]ethynyl]-4-oxochromen-3-yl]phenyl]methanesulfonamide	IC50	5 nM	US-8673966: ALDH-2 inhibitors in the treatment of addiction
N-[4-[7-[2-[1-(2,2-difluorocyclopropanecarbonyl)azetidin-3-yl]ethynyl]-4-oxochromen-3-yl]phenyl]methanesulfonamide	IC50	5 nM	US-8673966: ALDH-2 inhibitors in the treatment of addiction
tert-butyl N-[1-[3-[2-[3-[4-(methanesulfonamido)phenyl]-4-oxochromen-7-yl]ethynyl]azetidine-1-carbonyl]cyclopropyl]carbamate	IC50	5 nM	US-8673966: ALDH-2 inhibitors in the treatment of addiction
N-[4-[7-[2-[1-(3,3-difluorocyclobutanecarbonyl)azetidin-3-yl]ethynyl]-4-oxochromen-3-yl]phenyl]methanesulfonamide	IC50	6 nM	US-8673966: ALDH-2 inhibitors in the treatment of addiction
N-[4-[7-[2-[1-(3-methyloxetane-3-carbonyl)azetidin-3-yl]ethynyl]-4-oxochromen-3-yl]phenyl]methanesulfonamide	IC50	6 nM	US-8673966: ALDH-2 inhibitors in the treatment of addiction
N-[4-[7-[2-[1-(1-methylcyclopropanecarbonyl)azetidin-3-yl]ethynyl]-4-oxochromen-3-yl]phenyl]methanesulfonamide	IC50	6 nM	US-8673966: ALDH-2 inhibitors in the treatment of addiction
tert-butyl N-[1-[3-[2-[3-[4-(methanesulfonamido)phenyl]-4-oxochromen-7-yl]ethynyl]azetidine-1-carbonyl]cyclobutyl]carbamate	IC50	6 nM	US-8673966: ALDH-2 inhibitors in the treatment of addiction
N-[4-[7-[2-[1-(cyclopropanecarbonyl)piperidin-4-yl]ethynyl]-4-oxochromen-3-yl]phenyl]methanesulfonamide	IC50	6.5 nM	US-8673966: ALDH-2 inhibitors in the treatment of addiction
N-[4-[4-oxo-7-[2-(3-propan-2-ylimidazol-4-yl)ethynyl]chromen-3-yl]phenyl]methanesulfonamide	IC50	7 nM	US-8673966: ALDH-2 inhibitors in the treatment of addiction
2-[4-[2-(2-piperazin-1-yl-4-pyridinyl)ethyl]phenyl]acetohydrazide	IC50	7.3 nM	US-9603833: Benzene or thiophene derivative and use thereof as VAP-1 inhibitor
N-[4-[7-[2-[1-(3-methoxypropanoyl)azetidin-3-yl]ethynyl]-4-oxochromen-3-yl]phenyl]methanesulfonamide	IC50	8 nM	US-8673966: ALDH-2 inhibitors in the treatment of addiction
4,5-Dihydro-(1H)-pyrazole derivative, 1k	IC50	8.6 nM
4,5-Dihydro-(1H)-pyrazole derivative, 1g	IC50	8.8 nM
tert-butyl 3-[2-[3-[4-(methanesulfonamido)phenyl]-4-oxochromen-7-yl]ethynyl]azetidine-1-carboxylate	IC50	9 nM	US-8673966: ALDH-2 inhibitors in the treatment of addiction
N-[4-[4-oxo-7-[2-(2-oxo-1H-pyridin-4-yl)ethynyl]chromen-3-yl]phenyl]methanesulfonamide	IC50	9 nM	US-8673966: ALDH-2 inhibitors in the treatment of addiction
cyclopentyl 3-[2-[3-[4-(methanesulfonamido)phenyl]-4-oxochromen-7-yl]ethynyl]azetidine-1-carboxylate	IC50	9 nM	US-8673966: ALDH-2 inhibitors in the treatment of addiction
1,2-Bis(2-(2-chlorobenzoylimino)-5-(2-methoxy-2-oxoethylidene)-4-oxo-thiazolidin-3-yl)benzene (3e)	IC50	9 nM
4,5-Dihydro-(1H)-pyrazole derivative, 1a	IC50	9 nM
2-[4-[2-(6-piperazin-1-yl-2-pyridinyl)ethyl]phenyl]acetohydrazide	IC50	9.8 nM	US-9603833: Benzene or thiophene derivative and use thereof as VAP-1 inhibitor
7-[(4-Cyanobenzyl)oxy]-3,4-dihydronaphthalen-1(2H)-one (4m)	IC50	10 nM
4,5-Dihydro-(1H)-pyrazole derivative, 1m	IC50	10 nM
4,5-Dihydro-(1H)-pyrazole derivative, 1e	IC50	10 nM
4,5-Dihydro-(1H)-pyrazole derivative, 1j	IC50	10 nM
4,5-Dihydro-(1H)-pyrazole derivative, 3c	IC50	10 nM
4,5-Dihydro-(1H)-pyrazole derivative, 3d	IC50	10 nM
4-chloro-3-fluoro-N-(1H-pyrrolo[3,2-b]pyridin-5-yl)benzamide	IC50	10.9 nM	US-9738640: Substituted benzamide derivatives as in vitro MAO-B inhibitors
7-[(4-Fluorobenzyl)oxy]-3,4-dihydronaphthalen-1(2H)-one (4e)	IC50	12 nM
4,5-Dihydro-(1H)-pyrazole derivative, 2i	IC50	14 nM
N-[4-[7-[2-(2,3-dimethylimidazol-4-yl)ethynyl]-4-oxochromen-3-yl]phenyl]methanesulfonamide	IC50	15 nM	US-8673966: ALDH-2 inhibitors in the treatment of addiction
N-[4-[7-[2-[1-(2-hydroxyacetyl)azetidin-3-yl]ethynyl]-4-oxochromen-3-yl]phenyl]methanesulfonamide	IC50	15 nM	US-8673966: ALDH-2 inhibitors in the treatment of addiction
N-[4-[7-[2-[1-(2-hydroxypropanoyl)azetidin-3-yl]ethynyl]-4-oxochromen-3-yl]phenyl]methanesulfonamide	IC50	15 nM	US-8673966: ALDH-2 inhibitors in the treatment of addiction
N-[4-[7-[2-[1-(2-hydroxy-2-methylpropanoyl)azetidin-3-yl]ethynyl]-4-oxochromen-3-yl]phenyl]methanesulfonamide	IC50	16 nM	US-8673966: ALDH-2 inhibitors in the treatment of addiction
N-[4-[4-oxo-7-(2-pyridin-3-ylethynyl)chromen-3-yl]phenyl]methanesulfonamide	IC50	21 nM	US-8673966: ALDH-2 inhibitors in the treatment of addiction
(S)-2-[4-(3-Fluoro-benzyloxy)-benzylamino]-propionamide; compound with methanesulfonic acid	IC50	21 nM	US-20250382276: COMPOUND, METHOD OF PREPARATION, COMPOSITION, AND USES THEREOF
2-chloro-6-methyl-N-[[4-(2-oxo-1H-pyridin-4-yl)phenyl]methyl]benzamide	IC50	23 nM	US-9000015: Compounds for the treatment of addiction
2,6-dichloro-N-[[4-(5-fluoro-2-oxo-1H-pyridin-4-yl)phenyl]methyl]benzamide	IC50	25 nM	US-9000015: Compounds for the treatment of addiction
7-[(3-Cyanobenzyl)oxy]-3,4-dihydronaphthalen-1(2H)-one (4l)	IC50	26 nM
4,5-Dihydro-(1H)-pyrazole derivative, 1f	IC50	28 nM
7-[(4-Chlorobenzyl)oxy]-3,4-dihydronaphthalen-1(2H)-one (4g)	IC50	33 nM
7-[(4-Bromobenzyl)oxy]-3,4-dihydronaphthalen-1(2H)-one (4i)	IC50	34 nM
N-[4-[7-[2-[1-(1-methylpiperidine-4-carbonyl)azetidin-3-yl]ethynyl]-4-oxochromen-3-yl]phenyl]methanesulfonamide	IC50	35 nM	US-8673966: ALDH-2 inhibitors in the treatment of addiction
N-[4-[7-[2-(oxan-4-yl)ethynyl]-4-oxochromen-3-yl]phenyl]methanesulfonamide	IC50	43 nM	US-8673966: ALDH-2 inhibitors in the treatment of addiction

ChEMBL bioactivities

5033 potent at pChembl≥5 of 6100 total, top 50 by pChembl (potency: 10 = 0.1 nM, 6 = 1 µM).

pChembl	Type	Value	Unit	Molecule
10.85	IC50	0.014	nM	CHEMBL348961
10.77	IC50	0.017	nM	SELEGILINE
10.15	IC50	0.07	nM	CHEMBL6146594
9.89	Ki	0.129	nM	CHEMBL2333930
9.87	IC50	0.134	nM	CHEMBL4129303
9.77	Ki	0.17	nM	CHEMBL3319256
9.66	Ki	0.22	nM	CHEMBL3319256
9.64	IC50	0.227	nM	CHEMBL3319268
9.59	Ki	0.26	nM	CHEMBL3319244
9.57	Ki	0.27	nM	CHEMBL3319272
9.55	Ki	0.28	nM	CHEMBL1642678
9.54	Ki	0.29	nM	CHEMBL4061639
9.54	Ki	0.29	nM	CHEMBL3319247
9.52	Ki	0.3	nM	CHEMBL3317469
9.51	IC50	0.3085	nM	CHEMBL1835228
9.51	Ki	0.31	nM	CHEMBL4209203
9.51	IC50	0.308	nM	CHEMBL1835228
9.51	Ki	0.31	nM	CHEMBL1760721
9.51	IC50	0.31	nM	CHEMBL1835228
9.50	IC50	0.318	nM	CHEMBL414637
9.46	IC50	0.35	nM	CHEMBL4861804
9.43	IC50	0.37	nM	CHEMBL5407170
9.43	IC50	0.37	nM	CHEMBL3359944
9.41	IC50	0.386	nM	CHEMBL3319256
9.41	IC50	0.389	nM	CHEMBL3319256
9.40	IC50	0.4	nM	CHEMBL4206812
9.39	IC50	0.4074	nM	CHEMBL4206812
9.34	Ki	0.46	nM	CHEMBL2391742
9.34	Ki	0.46	nM	CHEMBL3319273
9.32	Ki	0.48	nM	CHEMBL4104691
9.30	IC50	0.5	nM	CHEMBL4068321
9.30	Ki	0.5	nM	CHEMBL4450595
9.25	Ki	0.557	nM	CHEMBL4450595
9.24	Ki	0.57	nM	CHEMBL4539722
9.24	Ki	0.57	nM	CHEMBL4466571
9.23	IC50	0.588	nM	CHEMBL3121793
9.23	IC50	0.586	nM	CHEMBL3319244
9.23	IC50	0.5888	nM	CHEMBL3319244
9.23	IC50	0.59	nM	CHEMBL6134271
9.22	Ki	0.6	nM	CHEMBL2391742
9.21	IC50	0.612	nM	CHEMBL3319272
9.21	IC50	0.6166	nM	CHEMBL3319272
9.20	Ki	0.63	nM	CHEMBL3319273
9.19	Ki	0.64	nM	CHEMBL3319257
9.18	IC50	0.668	nM	CHEMBL3319247
9.18	IC50	0.662	nM	CHEMBL4061639
9.18	IC50	0.6607	nM	CHEMBL3319247
9.18	IC50	0.66	nM	CHEMBL1642678
9.17	IC50	0.679	nM	CHEMBL3317469
9.17	IC50	0.6761	nM	CHEMBL3317469

PubChem BioAssay actives

2753 with measured affinity, of 6100 total; 50 most potent distinct compounds. Largely complementary to BindingDB; screening values are coarse (µM, 4 dp), so sub-nM hits tie at the floor.

Compound	Assay	Type	Value	Unit
3-methyl-8-(4,4,4-trifluorobutoxy)indeno[1,2-c]pyridazin-5-one	126365: Inhibitory concentration against Monoamine oxidase B was measured in baboon liver.	ic50	<0.0001	uM
Safinamide	1999575: Inhibition of human MAO-B using p-tyramine as substrate incubated for 15 mins by Amplex red and horseradish peroxidase based fluorescence assay	ic50	<0.0001	uM
4-oxochromene-3-carboxylic acid	551666: Inhibition of human recombinant MAOB expressed in baculovirus-infected BTI insect cells after 15 mins by fluorimetric assay	ic50	<0.0001	uM
Selegiline	1999575: Inhibition of human MAO-B using p-tyramine as substrate incubated for 15 mins by Amplex red and horseradish peroxidase based fluorescence assay	ic50	<0.0001	uM
Rasagiline	1999575: Inhibition of human MAO-B using p-tyramine as substrate incubated for 15 mins by Amplex red and horseradish peroxidase based fluorescence assay	ic50	0.0001	uM
5-(4,4,4-trifluorobutoxy)-2,3-dihydroinden-1-one	126364: Inhibitory concentration against Monoamine oxidase B was measured	ic50	0.0003	uM
N-(3,4-dimethylphenyl)-4-oxochromene-3-carboxamide	1369563: Mixed-type inhibition of recombinant human MAO-B expressed in Pichia pastoris using benzylamine as substrate by fluorimetric horseradish peroxidase-Amplex Red-coupled assay	ki	0.0003	uM
6-methyl-3-(4-methylphenyl)chromen-2-one	1871374: Inhibition of MAO-B (unknown origin)	ic50	0.0003	uM
4-[2-(3-methylphenyl)ethylsulfanyl]-N-prop-2-ynyl-2,3-dihydro-1H-inden-1-amine	1754140: Inhibition of human MAO-B	ic50	0.0003	uM
4-(2-chloroethyl)-7-[(3-chlorophenyl)methoxy]chromen-2-one	1999962: Inhibition of recombinant human MAO-B using p-tyramine as substrate incubated for 15 mins by Amplex Red reagent and horseradish peroxidase based fluorometric analysis	ic50	0.0004	uM
N-(3-chlorophenyl)-4-oxochromene-3-carboxamide	1635461: Inhibition of human microsomal MAO-B expressed in recombinant baculovirus infected insect BTI-TN-5B1-4 cells assessed as reduction in H2O2 production using p-tyramine as substrate after 15 mins by fluorescence assay	ic50	0.0004	uM
7-[(2-fluorophenyl)methoxy]-3,4-dihydrochromen-2-one	1999962: Inhibition of recombinant human MAO-B using p-tyramine as substrate incubated for 15 mins by Amplex Red reagent and horseradish peroxidase based fluorometric analysis	ic50	0.0004	uM
7-[(4-bromophenyl)methoxy]chromen-2-one	1459559: Inhibition of recombinant human MAO-B assessed as reduction in 4-hydroxyquinolone production using kynuramine as substrate after 20 mins by fluorescence assay	ic50	0.0005	uM
N-(3,4-dichlorophenyl)-1-[1-(2-methoxyethyl)indazol-5-yl]methanimine	1556701: Inhibition of human recombinant MAO-B expressed in baculovirus infected BTI-TN-5B1-4 insect cells assessed as decrease in H2O2 production using p-tyramine as substrate incubated for 20 mins by horse-radish peroxidase/amplex red-based fluorescence method	ki	0.0006	uM
1-[(3-methoxyphenyl)methyl]-4-(4-methoxypiperidin-1-yl)pyrrolo[3,2-c]quinoline	1907519: Inhibition of human recombinant MAO-B using p-tyramine as substrate preincubated for 30 mins followed by substrate addition and measured after 1 hr by fluorometric analysis	ic50	0.0007	uM
7-[(4-bromophenyl)methoxy]-3-chloro-4-methylchromen-2-one	1459559: Inhibition of recombinant human MAO-B assessed as reduction in 4-hydroxyquinolone production using kynuramine as substrate after 20 mins by fluorescence assay	ic50	0.0008	uM
1-[(3-chlorophenyl)methyl]-4-(4-methoxypiperidin-1-yl)pyrrolo[3,2-c]quinoline	1907519: Inhibition of human recombinant MAO-B using p-tyramine as substrate preincubated for 30 mins followed by substrate addition and measured after 1 hr by fluorometric analysis	ic50	0.0008	uM
2-(phenoxymethyl)-4,5-dihydro-1H-imidazole	223245: Displacement of [3H]idazoxan from imidazoline receptor I-2 binding sites in rabbit kidney membrane	ki	0.0009	uM
7-[(4-fluorophenyl)methoxy]-3,4-dihydro-2H-naphthalen-1-one	1801384: MAO Inhibition Assay from Article 10.1111/cbdd.12508: “The Synthesis and Evaluation of C7-Substituted a-Tetralone Derivatives as Inhibitors of Monoamine Oxidase.”	ic50	0.0009	uM
3,4-dimethyl-7-[(5-propan-2-yl-1,3,4-thiadiazol-2-yl)methoxy]chromen-2-one	1201735: Inhibition of MAO-B (unknown origin)	ic50	0.0009	uM
N-(2-bromophenyl)-4-oxochromene-3-carboxamide	1635461: Inhibition of human microsomal MAO-B expressed in recombinant baculovirus infected insect BTI-TN-5B1-4 cells assessed as reduction in H2O2 production using p-tyramine as substrate after 15 mins by fluorescence assay	ic50	0.0010	uM
6-chloro-3-(3-methoxyphenyl)chromen-2-one	1999962: Inhibition of recombinant human MAO-B using p-tyramine as substrate incubated for 15 mins by Amplex Red reagent and horseradish peroxidase based fluorometric analysis	ic50	0.0010	uM
(6-oxo-7,8,9,10-tetrahydrobenzo[c]chromen-3-yl) benzoate	1799410: MAO-B Enzymatic Assay from Article 10.1038/nchembio.307: “Rapid behavior-based identification of neuroactive small molecules in the zebrafish.”	ic50	0.0010	uM
7-[(3,4-difluorophenyl)methoxy]-3,4-dimethylchromen-2-one	744457: Inhibition of MAO-B (unknown origin)	ic50	0.0011	uM
N-(4-bromophenyl)-4-oxochromene-3-carboxamide	1635461: Inhibition of human microsomal MAO-B expressed in recombinant baculovirus infected insect BTI-TN-5B1-4 cells assessed as reduction in H2O2 production using p-tyramine as substrate after 15 mins by fluorescence assay	ic50	0.0011	uM
7-[(4-chlorophenyl)methoxy]-3,4-dihydro-2H-naphthalen-1-one	1882042: Inhibition of recombinant human MAO-B assessed as measuring amount of 4-hydroxyquinoline using kynuramine as substrate incubated for 20 mins by fluorescence spectrophotometry	ic50	0.0011	uM
3-phenylmethoxybenzo[c]chromen-6-one	273203: Inhibition of human supersomes MAOB	ic50	0.0011	uM
4-[(8-oxo-6,7-dihydro-5H-naphthalen-2-yl)oxymethyl]benzonitrile	1801384: MAO Inhibition Assay from Article 10.1111/cbdd.12508: “The Synthesis and Evaluation of C7-Substituted a-Tetralone Derivatives as Inhibitors of Monoamine Oxidase.”	ic50	0.0012	uM
7-phenylmethoxy-3,4-dihydro-2H-naphthalen-1-one	1882033: Inhibition of recombinant human MAO-B using kynuramine as substrate by fluorescence spectrophotometry	ic50	0.0012	uM
1-[(3-chlorophenyl)methyl]-4-piperazin-1-ylpyrrolo[3,2-c]quinoline;hydrochloride	2019358: Inhibition of human recombinant MAO-B using 10-acetyl-3,7-dihydroxyphenoxazine and p-tyramine as substrate incubated for 30 mins by fluorometric analysis	ic50	0.0012	uM
N-(3-chlorophenyl)-6-methyl-2-oxochromene-3-carboxamide	1458409: Noncompetitive inhibition of human recombinant microsomal MAOB expressed in baculovirus infected BTI-TN-5B1- 4 cells using p-tyramine as substrate assessed as decrease in H2O2 production by Lineweaver-Burk plot analysis	ki	0.0012	uM
7-(2-bromoprop-2-enoxy)-6-methyl-2,3-dihydro-1H-cyclopenta[c]chromen-4-one	409943: Inhibition of human recombinant MAOB by fluorimetric method	ic50	0.0012	uM
7-[(3-fluorophenyl)methoxy]-3,4-dihydro-2H-naphthalen-1-one	1801384: MAO Inhibition Assay from Article 10.1111/cbdd.12508: “The Synthesis and Evaluation of C7-Substituted a-Tetralone Derivatives as Inhibitors of Monoamine Oxidase.”	ic50	0.0013	uM
7-[(4-bromophenyl)methoxy]-4-methyl-2-oxochromene-3-carbonitrile	1459559: Inhibition of recombinant human MAO-B assessed as reduction in 4-hydroxyquinolone production using kynuramine as substrate after 20 mins by fluorescence assay	ic50	0.0013	uM
N-(3-bromophenyl)-4-oxochromene-3-carboxamide	1635461: Inhibition of human microsomal MAO-B expressed in recombinant baculovirus infected insect BTI-TN-5B1-4 cells assessed as reduction in H2O2 production using p-tyramine as substrate after 15 mins by fluorescence assay	ic50	0.0013	uM
7-(benzylamino)-3,4-dimethylchromen-2-one	273203: Inhibition of human supersomes MAOB	ic50	0.0014	uM
3-[(3,4-dimethyl-2-oxochromen-7-yl)oxymethyl]benzonitrile	273203: Inhibition of human supersomes MAOB	ic50	0.0014	uM
3-[(E)-2-(4-chlorophenyl)ethenyl]-7-methoxychromen-4-one	1754858: Mixed type inhibition of human recombinant MAO-B by Lineweaver-Burk plot analysis	ki	0.0015	uM
N-(3-chlorophenyl)-4-oxothiochromene-3-carboxamide	1751717: Inhibition of recombinant human MAO-B expressed in baculovirus infected BTI-TN- 5B1-4 insect cells using kynuramine as substrate preincubated for 10 mins in presence of substrate followed by enzyme addition and measured every minute for 30 mins by spectrophotometry analysis	ic50	0.0015	uM
3-(2-bromoprop-2-enoxy)-4-methylbenzo[c]chromen-6-one	409943: Inhibition of human recombinant MAOB by fluorimetric method	ic50	0.0015	uM
3,4-dimethyl-7-[(2,3,4,5,6-pentafluorophenyl)methoxy]chromen-2-one	273203: Inhibition of human supersomes MAOB	ic50	0.0016	uM
N-(3-hydroxyphenyl)-4-oxochromene-3-carboxamide	1635461: Inhibition of human microsomal MAO-B expressed in recombinant baculovirus infected insect BTI-TN-5B1-4 cells assessed as reduction in H2O2 production using p-tyramine as substrate after 15 mins by fluorescence assay	ic50	0.0017	uM
1-[1-[(3-chlorophenyl)methyl]pyrrolo[3,2-c]quinolin-4-yl]piperidin-4-ol	1907519: Inhibition of human recombinant MAO-B using p-tyramine as substrate preincubated for 30 mins followed by substrate addition and measured after 1 hr by fluorometric analysis	ic50	0.0018	uM
3-phenylmethoxy-7,8,9,10-tetrahydrobenzo[c]chromen-6-one	273203: Inhibition of human supersomes MAOB	ic50	0.0018	uM
1,1-dioxo-3-[3-[3-(trifluoromethyl)phenyl]-1,2-oxazol-5-yl]thiochromen-4-one	2096244: Inhibition of human recombinant MAO-B using tyramine as substrate incubated for 20 mins by fluorometric assay	ic50	0.0019	uM
(5R)-5-(3,4-dichlorophenyl)-3-(4-methylphenyl)-4,5-dihydro-1,2-oxazole	1928511: Inhibition of human MAO-B using tyramine as substrate by amplex red assay	ic50	0.0019	uM
4-methyl-2-oxo-7-phenylmethoxychromene-3-carbonitrile	1459559: Inhibition of recombinant human MAO-B assessed as reduction in 4-hydroxyquinolone production using kynuramine as substrate after 20 mins by fluorescence assay	ic50	0.0019	uM
2-[5-(4-phenylmethoxyphenyl)tetrazol-2-yl]ethanol	1940944: Inhibition of human MAO-B	ic50	0.0020	uM
2-[5-[4-[(3-chlorophenyl)methoxy]phenyl]tetrazol-2-yl]ethanol	1940944: Inhibition of human MAO-B	ic50	0.0020	uM
(E)-2-[(2S)-2,3-dihydro-1-benzofuran-2-yl]-3-fluoroprop-2-en-1-amine;hydrochloride	1851791: Inhibition of human recombinant MAO-B	ic50	0.0020	uM

CTD chemical–gene interactions

101 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Selegiline	decreases amination, decreases reaction, increases degradation, increases activity, decreases activity (+1 more)	10
lazabemide	affects binding, decreases activity	8
Valproic Acid	increases methylation, affects cotreatment, decreases expression, affects expression, decreases methylation (+1 more)	7
Cyclosporine	decreases expression	4
Benzo(a)pyrene	affects methylation, decreases expression, increases methylation	3
Estradiol	increases expression, decreases expression, affects cotreatment	3
Progesterone	affects cotreatment, increases expression	3
Acetaminophen	decreases expression	2
Carbamazepine	affects expression, increases expression	2
Dopamine	decreases reaction, increases degradation, decreases amination	2
Tetrachlorodibenzodioxin	increases expression	2
Aflatoxin B1	decreases methylation, increases methylation	2
Cadmium Chloride	decreases expression, increases expression	2
bisphenol F	affects cotreatment, increases expression	1
4-nitrochalcone	decreases activity	1
indole-3-acetaldehyde	decreases amination, increases chemical synthesis	1
methylmercuric chloride	decreases expression	1
lasiocarpine	decreases expression	1
benzyl benzoate	decreases activity	1
bisphenol A	affects cotreatment, affects methylation, decreases methylation	1
chlortoluron	decreases expression	1
senkirkine	decreases expression	1
heliotrine	decreases expression	1
norharman	decreases activity, decreases reaction, increases oxidation	1
ethyl-p-hydroxybenzoate	decreases expression	1
trichostatin A	decreases expression	1
1,2,3,4-tetrahydroisoquinoline	decreases activity	1
tris(1,3-dichloro-2-propyl)phosphate	decreases expression	1
butyraldehyde	decreases expression	1
tanshinone	increases expression	1

ChEMBL screening assays

1620 unique, capped per target: 1587 binding, 14 functional, 13 admet, 6 toxicity

Representative assays (with source publication via chembl_document):

Assay ID	Type	Description	Source paper
CHEMBL1003729	Binding	Inhibition of human recombinant MAO-B assessed as hydrogen peroxide production	Chalcones: a valid scaffold for monoamine oxidases inhibitors. — J Med Chem
CHEMBL2327761	ADMET	Inhibition of human MAO-B assessed as residual activity at 10 uM	Synthesis and antibacterial activities of new piperidine substituted (5R)-[1,2,3]triazolylmethyl and (5R)-[(4-F-[1,2,3]triazolyl)methyl] oxazolidinones. — Bioorg Med Chem Lett
CHEMBL5106140	Toxicity	Irreversible inhibition of human MAO-B assessed as enzyme residual activity using p-tyramine as substrate measured after dialysis by dialysis method	Synthesis and human monoamine oxidase inhibitory activity of novel C2-, C3- and C4-substituted phthalonitriles. — Bioorg Med Chem Lett

Clinical trials (associated diseases)

317 trials via MONDO — disease-level, not drug-specific.

Trial	Phase	Status	Title
NCT00154830	PHASE4	COMPLETED	Alterations of Functional Activities and Leg Stiffness After Hamstring Lengthening in Cerebral Palsy Children
NCT00432055	PHASE4	COMPLETED	Effects of Botulinum Toxin Type A in Adults With Cerebral Palsy
NCT00549471	PHASE4	TERMINATED	Improvement After Botulinum Toxin Injections to the Arms in Children With Cerebral Palsy
NCT00752934	PHASE4	TERMINATED	Does Oral Baclofen Improve Care and Comfort in Spastic Children in Nursing Homes?
NCT00964639	PHASE4	COMPLETED	Postoperative Pain in Children With Cerebral Palsy After Pelvic and Femoral Osteotomies
NCT01386255	PHASE4	WITHDRAWN	Placebo Controlled Study of Baclofen for GERD in Children With Cerebral Palsy
NCT02546999	PHASE4	COMPLETED	Does Botulinum Toxin A Make Walking Easier in Children With Cerebral Palsy?
NCT02633241	PHASE4	COMPLETED	A Pilot Study of Dexmedetomidine-Propofol in Children Undergoing Magnetic Resonance Imaging
NCT03117322	PHASE4	COMPLETED	Synbiotic, Prebiotics and Probiotics in Children With Cerebral Palsy and Constipation
NCT03648658	PHASE4	UNKNOWN	Paracetamol Study in Patients With Low Muscle Mass
NCT04074265	PHASE4	COMPLETED	Peri-operative Use of a Pain Injection in Pediatric Patients With Cerebral Palsy
NCT04273737	PHASE4	TERMINATED	Amantadine in Treating Cognitive & Motor Impairments in Adolescents and Adults With Cerebral Palsy
NCT04523935	PHASE4	COMPLETED	Excessive Crying in Children With Cerebral Palsy and Communication Deficits
NCT05887765	PHASE4	COMPLETED	Effect of Systematic Dexamethasone on the Duration of Popliteal Nerve Block for Anesthesia After Pediatric Ankle Surgery
NCT06176430	PHASE4	UNKNOWN	Comparison of Twice Weekly Versus Daily Iron Therapy in Treating Anemia in Children With Cerebral Palsy
NCT06189781	PHASE4	RECRUITING	Pain Injection Versus Epidural Anesthesia for Hip Surgery in Pediatric Patients With Cerebral Palsy
NCT00014989	PHASE3	COMPLETED	Beneficial Effects of Antenatal Magnesium Sulfate (BEAM Trial)
NCT00065949	PHASE3	UNKNOWN	Magnesium Sulfate to Prevent Brain Injury in Premature Infants
NCT00367068	PHASE3	COMPLETED	Dutch National ITB Study in Children With Cerebral Palsy
NCT00491894	PHASE3	COMPLETED	Safety and Efficacy Study of Oral Glycopyrrolate Liquid for the Treatment of Pathologic (Chronic Moderate to Severe) Drooling in Pediatric Patients 3 to 18 Years of Age With Cerebral Palsy or Other Neurologic Conditions
NCT00632528	PHASE3	COMPLETED	MEOPA to Improve Physical Therapy Results After Multilevel Surgery
NCT00822029	PHASE3	TERMINATED	Use of Oral Bisphosphonates in the Treatment of Osteoporosis of Non-walking Children With Cerebral Palsy
NCT00922077	PHASE3	COMPLETED	Individualized Neurodevelopmental Treatment
NCT01249417	PHASE3	COMPLETED	Dysport® Pediatric Lower Limb Spasticity Study
NCT01251380	PHASE3	COMPLETED	Dysport® Pediatric Lower Limb Spasticity Follow-on Study
NCT01437644	PHASE3	COMPLETED	The Post-Operative Pain in Cerebral Palsy (POPPIES) Trial
NCT01492608	PHASE3	COMPLETED	Magnesium Sulphate for Preterm Birth (MASP Study)
NCT01603602	PHASE3	COMPLETED	BOTOX® Treatment in Pediatric Upper Limb Spasticity
NCT01603615	PHASE3	COMPLETED	BOTOX® Open-Label Treatment in Pediatric Upper Limb Spasticity
NCT01603628	PHASE3	COMPLETED	BOTOX® Treatment in Pediatric Lower Limb Spasticity
NCT01603641	PHASE3	COMPLETED	BOTOX® Open-Label Treatment in Pediatric Lower Limb Spasticity
NCT01633736	PHASE3	UNKNOWN	Targeted Hip Strength Training in Children With Cerebral Palsy (CP)
NCT01898520	PHASE3	COMPLETED	A Safety, Efficacy and Tolerability Study of Sativex for the Treatment of Spasticity in Children Aged 8 to 18 Years
NCT01929434	PHASE3	COMPLETED	Efficacy of Stem Cell Transplantation Compared to Rehabilitation Treatment of Patients With Cerebral Paralysis
NCT02002884	PHASE3	COMPLETED	Dose-response Study of Efficacy and Safety of Botulinum Toxin Type A to Treat Spasticity of the Arm(s) or of Arm(s) and Leg(s) in Cerebral Palsy
NCT02270736	PHASE3	COMPLETED	Clinical Study to Investigate the Efficacy and Safety of NT 201 Compared to Placebo in the Treatment of Chronic Troublesome Drooling Associated With Neurological Disorders and/or Intellectual Disability
NCT02839785	PHASE3	TERMINATED	Analgesia and Physiotherapy in Children With Cerebral Palsy (ANTALKINECP)
NCT03110341	PHASE3	UNKNOWN	Effect of Erythropoietin in Premature Infants on White Matter Lesions and Neurodevelopmental Outcome
NCT03302871	PHASE3	COMPLETED	Integrated Management Enhances Functional Gains in Children With Cerebral Palsy Treated by BoNT-A
NCT03306212	PHASE3	COMPLETED	Efficacy of Intermittent Serial Casting on Spastic Wrist Flexion Deformity