MATCAP1

Summary

MATCAP1 (microtubule associated tyrosine carboxypeptidase 1, HGNC:34408) is a protein-coding gene on chromosome 16q22.1, encoding Microtubule-associated tyrosine carboxypeptidase 1 (Q68EN5). Tyrosine carboxypeptidase that removes the C-terminal tyrosine residue of alpha-tubulin, thereby regulating microtubule dynamics and function.

Enables tubulin-tyrosine carboxypeptidase activity. Predicted to be involved in brain development. Is active in microtubule.

Source: NCBI Gene 653319 — automated summary from GO annotations (Alliance of Genome Resources).

At a glance

• GWAS associations: 2
• Clinical variants (ClinVar): 81 total
• GTEx eGene: eQTL in 17 tissues, sQTL in 7 (q < 0.05)
• Constraint (gnomAD): pLI 0.00 (LoF-tolerant), LOEUF 0.97 (unconstrained)
• MANE Select transcript: NM_001040715
• Notable: 81 clinical variants but no curated precision-oncology (CIViC) evidence yet

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:34408
Approved symbol	MATCAP1
Name	microtubule associated tyrosine carboxypeptidase 1
Location	16q22.1
Locus type	gene with protein product
Status	Approved
Aliases	LOC653319, TMCP1
Ensembl gene	ENSG00000196123
Ensembl biotype	protein_coding
OMIM	619978
Entrez	653319

Gene structure

Transcript identifiers

Ensembl transcripts: 19 — 9 protein_coding, 5 protein_coding_CDS_not_defined, 3 retained_intron, 2 nonsense_mediated_decay

MANE Select: ENST00000563902

Transcript support level (Ensembl TSL; 1 = fully mRNA-supported): TSL 1: 3, TSL 2: 2, TSL 3: 1, TSL 4: 2, TSL 5: 4

ENST00000563902, ENST00000290881, ENST00000561621, ENST00000561679, ENST00000562514, ENST00000563831, ENST00000563918, ENST00000564423, ENST00000564835, ENST00000568165, ENST00000568563, ENST00000570009, ENST00000886314, ENST00000886315, ENST00000944219, ENST00000944220, ENST00001074660, ENST00001074661, ENST00001133323

RefSeq mRNA: 8 — MANE Select: NM_001040715 NM_001040715, NM_001369680, NM_001369681, NM_001369682, NM_001369684, NM_001369685, NM_001369686, NM_001369687

CCDS: CCDS42177, CCDS92174

Canonical transcript exons

ENST00000563902 — 7 exons

Exon	Start	End
ENSE00001674068	67180041	67180666
ENSE00002600108	67175599	67176975
ENSE00002625662	67183262	67183963
ENSE00003473008	67179815	67179958
ENSE00003577066	67178199	67178504
ENSE00003648148	67179430	67179562
ENSE00003702588	67178010	67178107

Expression profiles

Bgee: expression breadth ubiquitous, 196 present calls, max score 98.60.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 23.6843 / max 868.3864, expressed in 1789 samples.

Highest expression (Bgee): hemisphere of cerebellum, cerebellar hemisphere, cerebellar cortex, cerebellum, cortical plate.

Genetic regulation across tissues (GTEx eQTL / sQTL)

MATCAP1 is an eGene in GTEx v10 — its expression is genetically regulated (eQTL) in 17 tissues and its splicing (sQTL) in 7 (q < 0.05). Strongest associations first; slope = normalized effect of the lead variant’s alternative allele.

showing 20 of 24 significant tissue × QTL associations:

Tissue	QTL	q-value	Slope	Lead variant
Brain Cerebellar Hemisphere	eqtl	2.5e-25	+0.63	16:67178909:A:AC
Brain Cerebellum	eqtl	1.9e-22	+0.68	16:67178909:A:AC
Brain Cortex	eqtl	1.4e-11	+0.48	16:67185204:G:C
Brain Frontal Cortex BA9	eqtl	2.6e-10	+0.43	16:67178909:A:AC
Adipose Visceral Omentum	sqtl	1.6e-05	+0.56	16:67089338:C:G
Lung	sqtl	4.7e-05	+0.69	16:67178129:GAGCCCCGCCCCTCGCCCGA:G
Skin Not Sun Exposed Suprapubic	eqtl	1.0e-04	+0.30	16:67664019:C:T
Skin Sun Exposed Lower leg	eqtl	3.3e-04	+0.33	16:67290232:C:T
Esophagus Mucosa	sqtl	4.8e-04	+0.55	16:67184472:T:G
Nerve Tibial	eqtl	7.7e-04	-0.16	16:67220516:A:G
Brain Cerebellum	sqtl	9.7e-04	-0.65	16:67209542:T:C
Brain Hippocampus	eqtl	3.8e-03	+0.51	16:67480240:G:A
Adipose Subcutaneous	eqtl	4.1e-03	+0.37	16:66608081:A:C
Muscle Skeletal	eqtl	5.9e-03	+0.10	16:66362238:C:T
Brain Nucleus accumbens basal ganglia	eqtl	6.8e-03	+0.22	16:67200231:A:G
Heart Atrial Appendage	eqtl	9.6e-03	+0.19	16:66893016:C:T
Skin Sun Exposed Lower leg	sqtl	1.1e-02	+0.48	16:67178129:GAGCCCCGCCCCTCGCCCGA:G
Artery Tibial	sqtl	1.2e-02	-0.88	16:67176952:G:C
Whole Blood	eqtl	1.4e-02	+0.44	16:66325258:C:T
Cells Cultured fibroblasts	eqtl	1.8e-02	+0.16	16:67238474:T:C

FANTOM5 promoters

5 alternative TSS:

Promoter ID	TPM avg	Samples expressed
157747	19.2620	1774
157745	2.9066	1211
157744	1.0242	403
157743	0.4315	96
157746	0.0599	16

Top tissues by expression

showing 100 of 244 tissues by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
right hemisphere of cerebellum	UBERON:0014890	98.60	gold quality
cerebellar hemisphere	UBERON:0002245	98.45	gold quality
cerebellar cortex	UBERON:0002129	98.40	gold quality
cerebellum	UBERON:0002037	97.84	gold quality
cortical plate	UBERON:0005343	97.18	gold quality
adenohypophysis	UBERON:0002196	97.05	gold quality
right ovary	UBERON:0002118	96.40	gold quality
left ovary	UBERON:0002119	96.26	gold quality
pituitary gland	UBERON:0000007	96.25	gold quality
right adrenal gland	UBERON:0001233	95.35	gold quality
right uterine tube	UBERON:0001302	95.34	gold quality
right adrenal gland cortex	UBERON:0035827	95.29	gold quality
left uterine tube	UBERON:0001303	95.17	gold quality
left adrenal gland cortex	UBERON:0035825	94.83	gold quality
embryo	UBERON:0000922	94.49	gold quality
ganglionic eminence	UBERON:0004023	94.49	gold quality
right frontal lobe	UBERON:0002810	94.43	gold quality
left adrenal gland	UBERON:0001234	94.27	gold quality
right lobe of thyroid gland	UBERON:0001119	94.17	gold quality
adrenal cortex	UBERON:0001235	93.52	gold quality
left lobe of thyroid gland	UBERON:0001120	93.39	gold quality
right testis	UBERON:0004534	93.33	gold quality
left testis	UBERON:0004533	92.77	gold quality
anterior cingulate cortex	UBERON:0009835	92.75	gold quality
endocervix	UBERON:0000458	92.64	gold quality
esophagogastric junction muscularis propria	UBERON:0035841	92.57	gold quality
body of uterus	UBERON:0009853	92.51	gold quality
Brodmann (1909) area 9	UBERON:0013540	92.24	gold quality
mucosa of stomach	UBERON:0001199	92.21	gold quality
lower esophagus muscularis layer	UBERON:0035833	92.21	gold quality
lower esophagus	UBERON:0013473	92.20	gold quality
thyroid gland	UBERON:0002046	91.98	gold quality
metanephros cortex	UBERON:0010533	91.98	gold quality
lower esophagus mucosa	UBERON:0035834	91.60	gold quality
apex of heart	UBERON:0002098	91.53	gold quality
adrenal gland	UBERON:0002369	91.46	gold quality
ectocervix	UBERON:0012249	91.11	gold quality
hypothalamus	UBERON:0001898	90.79	gold quality
dorsolateral prefrontal cortex	UBERON:0009834	90.65	gold quality
ovary	UBERON:0000992	90.47	gold quality
body of stomach	UBERON:0001161	90.43	gold quality
amygdala	UBERON:0001876	90.26	gold quality
omental fat pad	UBERON:0010414	90.22	gold quality
testis	UBERON:0000473	90.21	gold quality
peritoneum	UBERON:0002358	90.16	gold quality
nucleus accumbens	UBERON:0001882	90.10	gold quality
caudate nucleus	UBERON:0001873	89.86	gold quality
neocortex	UBERON:0001950	89.83	gold quality
brain	UBERON:0000955	89.45	gold quality
prefrontal cortex	UBERON:0000451	89.38	gold quality
C1 segment of cervical spinal cord	UBERON:0006469	89.36	gold quality
esophagus	UBERON:0001043	89.24	gold quality
transverse colon	UBERON:0001157	89.22	gold quality
mucosa of transverse colon	UBERON:0004991	89.19	gold quality
right atrium auricular region	UBERON:0006631	89.07	gold quality
frontal cortex	UBERON:0001870	89.05	gold quality
forebrain	UBERON:0001890	88.85	gold quality
stromal cell of endometrium	CL:0002255	88.81	gold quality
putamen	UBERON:0001874	88.60	gold quality
cerebral cortex	UBERON:0000956	88.59	gold quality
primary visual cortex	UBERON:0002436	88.59	gold quality
adipose tissue of abdominal region	UBERON:0007808	88.50	gold quality
cardiac atrium	UBERON:0002081	88.45	gold quality
upper lobe of left lung	UBERON:0008952	88.43	gold quality
spleen	UBERON:0002106	88.27	gold quality
cortex of kidney	UBERON:0001225	88.23	gold quality
small intestine Peyer’s patch	UBERON:0003454	88.19	gold quality
smooth muscle tissue	UBERON:0001135	88.02	gold quality
uterine cervix	UBERON:0000002	87.93	gold quality
left coronary artery	UBERON:0001626	87.86	gold quality
stomach	UBERON:0000945	87.58	gold quality
minor salivary gland	UBERON:0001830	87.49	gold quality
cerebellar vermis	UBERON:0004720	87.48	silver quality
spinal cord	UBERON:0002240	87.47	gold quality
esophagus mucosa	UBERON:0002469	87.04	gold quality
male germ line stem cell (sensu Vertebrata) in testis	CL:0000089 ∩ UBERON:0000473	86.95	gold quality
muscle layer of sigmoid colon	UBERON:0035805	86.68	gold quality
coronary artery	UBERON:0001621	86.52	gold quality
fundus of stomach	UBERON:0001160	86.51	gold quality
upper lobe of lung	UBERON:0008948	86.50	gold quality
vagina	UBERON:0000996	86.44	gold quality
Ammon’s horn	UBERON:0001954	86.44	gold quality
gall bladder	UBERON:0002110	86.38	gold quality
body of pancreas	UBERON:0001150	86.18	gold quality
colonic epithelium	UBERON:0000397	86.07	gold quality
small intestine	UBERON:0002108	85.99	gold quality
prostate gland	UBERON:0002367	85.85	gold quality
right lobe of liver	UBERON:0001114	85.79	gold quality
right lung	UBERON:0002167	85.52	gold quality
right coronary artery	UBERON:0001625	85.49	gold quality
ventricular zone	UBERON:0003053	85.25	gold quality
skin of abdomen	UBERON:0001416	85.24	gold quality
descending thoracic aorta	UBERON:0002345	85.13	gold quality
ascending aorta	UBERON:0001496	85.11	gold quality
endothelial cell	CL:0000115	85.07	silver quality
temporal lobe	UBERON:0001871	85.04	gold quality
thoracic aorta	UBERON:0001515	85.02	gold quality
metanephros	UBERON:0000081	84.94	gold quality
heart left ventricle	UBERON:0002084	84.75	gold quality
fallopian tube	UBERON:0003889	84.61	gold quality

Single-cell (SCXA)

Detected in 1 experiment(s), a significant marker in 1.

Experiment	Marker?	Max mean expression
E-ANND-3	yes	4.18

HPA expression

RNA tissue specificity: Tissue enhanced

showing 60 of 80 HPA tissues / cells by nTPM:

Tissue / cell	Axis	nTPM	Protein (IHC)
Pituitary gland	tissue	42.4
Retina	tissue	27.1
Postcentral gyrus	tissue	24.2
Hippocampus	tissue	22.3	medium
Locus coeruleus	tissue	18.4
Nucleus accumbens	tissue	17.5
Frontal cortex	tissue	15.2
Cerebellum	tissue	13.8	low
Vagina	tissue	12.1	low
Adrenal gland	tissue	11.7	high
Prefrontal cortex	tissue	11.6
Cerebral cortex	tissue	11.6	high
Hippocampal formation	tissue	11.2
Entorhinal cortex	tissue	11.2
Olfactory bulb	tissue	11.1
Temporal cortex	tissue	11.1
Insular cortex	tissue	11.0
Retrosplenial and cingulate cortex	tissue	10.9
Motor cortex	tissue	10.8
Somatosensory cortex	tissue	10.6
Retrosplenial cortex	tissue	10.6
Amygdala	tissue	10.0
Occipital cortex	tissue	10.0
Choroid plexus	tissue	9.8
Ovary	tissue	9.4	medium
Endometrium 1	tissue	8.8	high
Caudate putamen	tissue	8.7
Fallopian tube	tissue	8.3	high
Basal ganglia	tissue	8.2	low
Corpus callosum	tissue	8.1
Ventral forebrain	tissue	8.1
Hypothalamus	tissue	7.9
Thalamus	tissue	7.7
Septum	tissue	7.7
Stomach 1	tissue	7.6	medium
Pons	tissue	7.6
Midbrain	tissue	7.5
Testis	tissue	7.4	high
Superior colliculi	tissue	7.3
Epididymis	tissue	7.1	medium
Periaqueductal gray	tissue	7.1
Spinal cord	tissue	7.0
Substantia nigra	tissue	6.8
Spleen	tissue	6.7	high
Smooth muscle	tissue	6.6	low
Medulla oblongata	tissue	6.5
Parathyroid gland	tissue	6.2	high
Putamen	tissue	6.2
Duodenum	tissue	6.2	high
Skin 1	tissue	5.9	medium
Prostate	tissue	5.7	medium
Gallbladder	tissue	5.6	high
Adipose tissue	tissue	5.5	low
Placenta	tissue	5.4	medium
Small intestine	tissue	5.3	medium
Salivary gland	tissue	4.9	medium
Rectum	tissue	4.9	high
Lung	tissue	4.9	low
Appendix	tissue	4.7	high
Thyroid gland	tissue	4.5	medium

Brain sub-regions (HPA Brain Atlas): detected in 192; highest nTPM — Vermis (36.6), Flocculonodular lobe (36.2), Cerebellar cortex (32.0), Precentral gyrus (30.3), Ventral periolivary nuclei (28.2).

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

Targeting MATCAP1 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific).

showing 30 of 51 miRNAs:

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-6867-5P	100.00	82.21	3464
HSA-MIR-5193	100.00	67.26	1744
HSA-MIR-3646	100.00	73.56	5283
HSA-MIR-4481	100.00	66.42	1669
HSA-MIR-4682	100.00	68.89	1258
HSA-MIR-29A-3P	100.00	73.11	1835
HSA-MIR-29B-3P	100.00	73.18	1833
HSA-MIR-29C-3P	100.00	73.15	1833
HSA-MIR-5692B	100.00	71.32	2622
HSA-MIR-5692C	100.00	71.32	2622
HSA-MIR-4745-5P	99.98	65.95	1028
HSA-MIR-374A-5P	99.90	71.34	2923
HSA-MIR-4302	99.89	67.94	1187
HSA-MIR-3663-3P	99.84	70.39	798
HSA-MIR-4668-5P	99.79	70.58	3782
HSA-MIR-8076	99.78	68.52	1170
HSA-MIR-4306	99.72	70.50	3630
HSA-MIR-1296-3P	99.72	64.04	636
HSA-MIR-1284	99.67	73.56	1353
HSA-MIR-452-5P	99.65	69.63	1762
HSA-MIR-4676-3P	99.65	69.31	1733
HSA-MIR-892C-3P	99.65	69.38	1745
HSA-MIR-4753-5P	99.54	68.51	1356
HSA-MIR-4696	99.48	67.48	1040
HSA-MIR-3612	99.45	66.02	1333
HSA-MIR-650	99.45	65.77	1309
HSA-MIR-190B-3P	99.33	68.29	1382
HSA-MIR-7515	99.31	68.22	1795
HSA-MIR-3164	99.02	68.39	1071
HSA-MIR-6820-3P	99.02	68.50	1035

Functional genomics

gnomAD constraint: pLI 2.31e-07, LOEUF 0.967, missense Z 1.23 — population loss-of-function intolerance (pLI ≥ 0.9 = LoF-intolerant; lower LOEUF = more constrained). gnomAD

Regional missense constraint (gnomAD)

ENST00000563902 splits into 3 regions with different missense tolerance; 0 are missense-constrained. Missense variants in a constrained region (low observed/expected) are more likely to be pathogenic. gnomAD

Region (GRCh38)	Missense obs / exp	o/e	Constrained
16:67,176,814–67,178,085	76 / 113.3	0.67	no
16:67,178,086–67,178,421	131 / 118.5	1.11	no
16:67,178,422–67,180,610	323 / 421.7	0.77	no

Cross-species orthologs

3 orthologs

Organism	Symbol	Gene ID
danio_rerio	kiaa0895l	ENSDARG00000059529
mus_musculus	Matcap1	ENSMUSG00000014837
rattus_norvegicus	Matcap1	ENSRNOG00000015625

Paralogs (1): MATCAP2 (ENSG00000164542)

Mouse-model phenotypes

Observed phenotypes of the mouse ortholog (MGI:1921606) from MGI (Alliance of Genome Resources) — knockout/mutant phenotypes, ranked by annotation count. 3 distinct phenotype terms.

Mouse phenotype (MP)	Records
decreased brain size	1
small cerebellum	1
small olfactory bulb	1

Genomic neighbors (locus context)

Genes flanking this one on the chromosome (NCBI/Entrez gene neighborhood). Positional context only — some neighbors share regulatory elements (bidirectional promoters, antisense/overlapping transcripts), but chromosomal adjacency is not itself a functional relationship (see Interactions for that).

Symbol	Type	Entrez
EXOC3L1	protein-coding	283849
HSF4	protein-coding	3299
FBXL8	protein-coding	55336
TRADD	protein-coding	8717
NOL3	protein-coding	8996
PHAF1	protein-coding	80262
B3GNT9	protein-coding	84752
CBFB	protein-coding	865
E2F4	protein-coding	1874
MIR328	ncRNA	442901
ELMO3	protein-coding	79767

Protein

Protein identifiers

Microtubule-associated tyrosine carboxypeptidase 1 — Q68EN5 (reviewed: Q68EN5)

Alternative names: Microtubule-associated tyrosine carboxypeptidase

All UniProt accessions (2): Q68EN5, I3L230

UniProt curated annotations — full annotation on UniProt →

Function. Tyrosine carboxypeptidase that removes the C-terminal tyrosine residue of alpha-tubulin, thereby regulating microtubule dynamics and function. Also able to remove the C-terminal phenylalanine residue of alpha-tubulin TUBA8. Recognizes adjacent tubulin dimers along the same protofilament.

Subcellular location. Cytoplasm. Cytoskeleton.

Cofactor. Binds 1 zinc ion per subunit.

Domain organisation. Metalloprotease with an atypical HExxxH zinc-binding motif instead of HExxH, which interrupts the active site-containing helix without affecting the integrity of the catalytic site arrangement. The N-terminal disordered region enhances its anchoring on microtubules, while dampening processivity on the polymerized substrate.

Similarity. Belongs to the peptidase MATCAP family.

Isoforms (3)

UniProt ID	Names	Canonical?
Q68EN5-1	1	yes
Q68EN5-2	2
Q68EN5-3	3

RefSeq proteins (8): NP_001035805, NP_001356609, NP_001356610, NP_001356611, NP_001356613, NP_001356614, NP_001356615, NP_001356616 (=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR012548	MATCAP	Family

Pfam: PF08014

Catalyzed reactions (Rhea)

• C-terminal L-alpha-aminoacyl-L-glutamyl-L-glutamyl-L-tyrosyl-[tubulin] + H2O = C-terminal L-alpha-aminoacyl-L-glutamyl-L-glutamyl-[tubulin] + L-tyrosine (RHEA:57444)
• C-terminal L-alpha-aminoacyl-L-glutamyl-L-glutamyl-L-phenylalanyl-[tubulin] + H2O = C-terminal L-alpha-aminoacyl-L-glutamyl-L-glutamyl-[tubulin] + L-phenylalanine (RHEA:72663)

UniProt features (52 total): helix 26, mutagenesis site 7, turn 5, strand 4, binding site 3, splice variant 3, region of interest 2, chain 1, active site 1

Structure

Experimental structures (PDB)

3 structures by resolution:

PDB	Title	Method	Resolution (Å)
7Z5G	human apo MATCAP	X-RAY DIFFRACTION	2.11
7Z5H	human Zn MATCAP	X-RAY DIFFRACTION	2.5
7Z6S	MATCAP bound to a human 14 protofilament microtubule	ELECTRON MICROSCOPY	2.9

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q68EN5-F1	77.94	0.65

Human Protein Atlas

Protein class: Enzymes, ENZYME proteins, Hydrolases, Peptidases, Threonine-type peptidases, Predicted intracellular proteins

Protein evidence: Evidence at protein level

Subcellular location (HPA, imaging): nucleoplasm; vesicles

Antibody reliability (HPA): IH approved · IF approved

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Catalytic / active sites (1)

Position	Role
281	nucleophile

Ligand- & substrate-binding residues (3)

Position	Role
280	Zn(2+)
285	Zn(2+)
316	Zn(2+)

Mutagenesis-validated functional residues (7)

Position	Phenotype
219	reduced binding to microtubules.
223	reduced binding to microtubules.
227	reduced binding to microtubules.
280	abolished tyrosine carboxypeptidase activity.
281	abolished tyrosine carboxypeptidase activity.
285	abolished tyrosine carboxypeptidase activity.
316	abolished tyrosine carboxypeptidase activity.

Function

Pathways and Gene Ontology

Reactome pathways

0 curated (TAS) of 0; 0 disease pathways. Curated-first; evidence = TAS (manually curated) vs IEA (electronic inference).

MSigDB gene sets: 67 (showing top): chr16q22, GOMF_METALLOPEPTIDASE_ACTIVITY, GOBP_HEAD_DEVELOPMENT, GOBP_PROTEOLYSIS, GOMF_CARBOXYPEPTIDASE_ACTIVITY, GOMF_METALLOEXOPEPTIDASE_ACTIVITY, GOMF_METALLOCARBOXYPEPTIDASE_ACTIVITY, GOMF_PEPTIDASE_ACTIVITY, GOMF_EXOPEPTIDASE_ACTIVITY, KAMMINGA_SENESCENCE, BRUINS_UVC_RESPONSE_VIA_TP53_GROUP_A, GOCC_SUPRAMOLECULAR_COMPLEX, GOCC_POLYMERIC_CYTOSKELETAL_FIBER, GOCC_SUPRAMOLECULAR_POLYMER, ASH1L_TARGET_GENES

GO Biological Process (2): proteolysis (GO:0006508), brain development (GO:0007420)

GO Molecular Function (7): metallocarboxypeptidase activity (GO:0004181), tubulin-tyrosine carboxypeptidase activity (GO:0106423), carboxypeptidase activity (GO:0004180), protein binding (GO:0005515), peptidase activity (GO:0008233), metallopeptidase activity (GO:0008237), hydrolase activity (GO:0016787)

GO Cellular Component (2): microtubule (GO:0005874), cytoskeleton (GO:0005856)

GO top-level categories

16 GO namespaces:

Category	Terms
protein metabolic process	1
central nervous system development	1
animal organ development	1
head development	1
carboxypeptidase activity	1
metalloexopeptidase activity	1
metallocarboxypeptidase activity	1
exopeptidase activity	1
binding	1
hydrolase activity	1
catalytic activity, acting on a protein	1
peptidase activity	1
catalytic activity	1
microtubule cytoskeleton	1
polymeric cytoskeletal fiber	1
intracellular membraneless organelle	1

Experimentally-supported GO annotations

GO terms backed by direct experimental evidence (ECO experimental codes) — 3 of 11 annotations. The rest are phylogenetic / computational / electronic (IEA).

3 experimentally-supported GO terms:

GO term	NS	Evidence
microtubule	CC	direct assay
metallocarboxypeptidase activity	MF	direct assay
tubulin-tyrosine carboxypeptidase activity	MF	direct assay

Protein interactions and networks

STRING

showing 15 of 176 interactions by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
MATCAP1	ESPNL	Q6ZVH7	566
MATCAP1	SVBP	Q8N300	529
MATCAP1	GABPB1	Q06547	461
MATCAP1	VASH2	Q86V25	432
MATCAP1	EXOC3L1	Q86VI1	418
MATCAP1	Q8WV35	Q8WV35	418
MATCAP1	ATG16L2	Q8NAA4	413
MATCAP1	VASH1	Q7L8A9	400
MATCAP1	ATG4D	Q86TL0	391
MATCAP1	PITHD1	Q9GZP4	390
MATCAP1	B3GNT9	Q6UX72	390
MATCAP1	RIMS2	Q9UQ26	368
MATCAP1	TMEM208	Q9BTX3	358
MATCAP1	FBXL8	Q96CD0	349
MATCAP1	TTLL2	Q9BWV7	348

IntAct

Human interaction partners of MATCAP1 in IntAct, one row per partner (best MIscore; records = supporting IntAct interaction records).

1 partners by confidence:

Partner	Interaction type	MIscore	Records
ZBTB8B	physical association	0.560	3

Disease & clinical

Genetic variants

Variant evidence for MATCAP1: 81 ClinVar records (0 pathogenic / likely pathogenic); 2 GWAS associations.

ClinVar

81 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	73
Likely benign	1
Benign	0

SpliceAI

Top 10 splice-impact sites by Δscore (adjacent positions with the same effect merged into one range; 26 predictions of 1,033):

Position(s)	Effect	Δscore	Sites
16:67176976	acceptor_loss	1.0000
16:67178008–67178009	donor_loss	1.0000	5
16:67178013	donor_gain	1.0000
16:67178108–67178109	acceptor_loss	1.0000	6
16:67178843	donor_gain	1.0000
16:67176976–67176977	acceptor_loss	0.9900	2
16:67176980	acceptor_gain	0.9900
16:67178180	donor_gain	0.9900
16:67178197–67178198	donor_loss	0.9900	3
16:67178505–67178506	acceptor_loss	0.9900	5

AlphaMissense

1,199 missense substitutions predicted likely pathogenic (of 3,027 scored), across 272 residues. Top 20 hotspot residues, ranked by the number of likely-pathogenic substitutions (of those reachable by a single-nucleotide change), then by mean score:

Residue	Likely-pathogenic substitutions	Mean am_pathogenicity	Max am_pathogenicity
M253	9	0.957	0.998
M277	9	0.889	0.991
H280	8	0.999	1.000
H285	8	0.999	1.000
D390	8	0.998	0.999
F440	8	0.983	0.999
F166	8	0.981	0.998
F350	8	0.979	0.996
N291	8	0.974	0.999
N458	8	0.974	0.999
H322	8	0.971	0.999
F387	8	0.968	0.997
F409	8	0.967	0.998
D422	8	0.963	0.985
F208	8	0.955	0.996
F155	8	0.953	0.997
S323	8	0.949	1.000
N312	8	0.947	0.997
S320	8	0.903	1.000
D395	8	0.745	0.892

HPA cancer prognostics

RNA cancer specificity: Low cancer specificity

Human Protein Atlas survival analysis — favorable = higher expression predicts better survival.

3 prognostic cancer types:

Cancer	Prognostic	p-value
Kidney Renal Papillary Cell Carcinoma (TCGA)	favorable	0.000185
Colon Adenocarcinoma (TCGA)	unfavorable	0.000428
Liver Hepatocellular Carcinoma (validation)	favorable	0.000681

Disease associations

OMIM: gene MIM:619978 | disease phenotypes:

GWAS associations

2 associations:

Study	Trait	p-value
GCST006979_877	Heel bone mineral density	1e-27
GCST004602_183	Mean corpuscular volume	2e-16

EFO canonical traits (from GWAS)

1 canonical traits:

EFO ID	Trait name
EFO:0009270	heel bone mineral density

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (CPIC guideline: no)

CTD chemical–gene interactions

13 total (human), top 13 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Tobacco Smoke Pollution	decreases expression	2
sulforaphane	decreases expression	1
tris(1,3-dichloro-2-propyl)phosphate	decreases expression	1
benzo(e)pyrene	decreases methylation	1
abrine	increases expression	1
Sunitinib	decreases expression	1
Benzo(a)pyrene	increases methylation	1
Doxorubicin	decreases expression	1
Methapyrilene	decreases methylation	1
Quercetin	increases expression	1
Valproic Acid	increases methylation	1
Okadaic Acid	increases expression	1
Acrylamide	decreases expression	1

Clinical trials (associated diseases)

Via MONDO — disease-level, not drug-specific.