MCM10

Summary

MCM10 (minichromosome maintenance 10 replication initiation factor, HGNC:18043) is a protein-coding gene on chromosome 10p13, encoding Protein MCM10 homolog (Q7L590). Acts as a replication initiation factor that brings together the MCM2-7 helicase and the DNA polymerase alpha/primase complex in order to initiate DNA replication. It is a selective cancer dependency (DepMap: 45.6% of cell lines).

The protein encoded by this gene is one of the highly conserved mini-chromosome maintenance proteins (MCM) that are involved in the initiation of eukaryotic genome replication. The hexameric protein complex formed by MCM proteins is a key component of the pre-replication complex (pre-RC) and it may be involved in the formation of replication forks and in the recruitment of other DNA replication related proteins. This protein can interact with MCM2 and MCM6, as well as with the origin recognition protein ORC2. It is regulated by proteolysis and phosphorylation in a cell cycle-dependent manner. Studies of a similar protein in Xenopus suggest that the chromatin binding of this protein at the onset of DNA replication is after pre-RC assembly and before origin unwinding. Alternatively spliced transcript variants encoding distinct isoforms have been identified.

Source: NCBI Gene 55388 — RefSeq curated summary.

At a glance

• Gene–disease (curated): immunodeficiency 80 with or without congenital cardiomyopathy (Moderate, ClinGen)
• GWAS associations: 3
• Clinical variants (ClinVar): 188 total — 4 pathogenic
• Phenotypes (HPO): 21
• Cancer dependency (DepMap): dependent in 45.6% of screened cell lines
• MANE Select transcript: NM_018518

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:18043
Approved symbol	MCM10
Name	minichromosome maintenance 10 replication initiation factor
Location	10p13
Locus type	gene with protein product
Status	Approved
Aliases	PRO2249, CNA43, DNA43
Ensembl gene	ENSG00000065328
Ensembl biotype	protein_coding
OMIM	609357
Entrez	55388

Gene structure

Transcript identifiers

Ensembl transcripts: 12 — 9 protein_coding, 3 retained_intron

ENST00000378694, ENST00000378714, ENST00000459751, ENST00000479669, ENST00000481292, ENST00000484800, ENST00000485659, ENST00000921432, ENST00000921433, ENST00000921434, ENST00000921435, ENST00000921436

RefSeq mRNA: 2 — MANE Select: NM_018518 NM_018518, NM_182751

CCDS: CCDS7095, CCDS7096

Canonical transcript exons

ENST00000378714 — 20 exons

Exon	Start	End
ENSE00000691333	13204219	13204364
ENSE00000691335	13209091	13209133
ENSE00000985225	13175510	13175681
ENSE00000985226	13180442	13180607
ENSE00000985227	13182933	13183100
ENSE00000985228	13186164	13186280
ENSE00000985229	13188881	13189080
ENSE00000985230	13191299	13191399
ENSE00000985232	13192451	13192568
ENSE00000985233	13195041	13195269
ENSE00000999780	13172376	13172480
ENSE00001280515	13192255	13192365
ENSE00001380036	13172628	13172765
ENSE00001407974	13164128	13164209
ENSE00001866302	13161558	13161606
ENSE00001910705	13209227	13211110
ENSE00003479514	13201421	13201534
ENSE00003519419	13170922	13171263
ENSE00003586024	13197623	13197767
ENSE00003660902	13198689	13198807

Expression profiles

Bgee: expression breadth ubiquitous, 163 present calls, max score 91.88.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 7.1409 / max 283.0321, expressed in 1076 samples.

FANTOM5 promoters (1 alternative TSS)

Promoter ID	TPM avg	Samples expressed
103940	7.1409	1076

Top tissues by expression

270 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
secondary oocyte	CL:0000655	91.88	gold quality
oocyte	CL:0000023	88.82	gold quality
ventricular zone	UBERON:0003053	86.85	gold quality
ganglionic eminence	UBERON:0004023	82.77	gold quality
embryo	UBERON:0000922	79.90	gold quality
primordial germ cell in gonad	CL:0000670 ∩ UBERON:0000991	77.93	gold quality
amniotic fluid	UBERON:0000173	77.72	gold quality
bone marrow	UBERON:0002371	77.39	gold quality
male germ line stem cell (sensu Vertebrata) in testis	CL:0000089 ∩ UBERON:0000473	76.46	gold quality
gingival epithelium	UBERON:0001949	75.26	silver quality
trabecular bone tissue	UBERON:0002483	73.97	gold quality
bone marrow cell	CL:0002092	73.06	silver quality
stromal cell of endometrium	CL:0002255	72.14	gold quality
gingiva	UBERON:0001828	70.57	silver quality
rectum	UBERON:0001052	69.59	gold quality
esophagus squamous epithelium	UBERON:0006920	68.78	silver quality
lymph node	UBERON:0000029	68.47	gold quality
vermiform appendix	UBERON:0001154	68.37	gold quality
mucosa of transverse colon	UBERON:0004991	68.24	gold quality
skeletal muscle tissue of rectus abdominis	UBERON:0004511	68.00	gold quality
caecum	UBERON:0001153	66.82	gold quality
squamous epithelium	UBERON:0006914	66.82	silver quality
epithelium of esophagus	UBERON:0001976	66.11	silver quality
esophagus mucosa	UBERON:0002469	66.07	gold quality
adrenal tissue	UBERON:0018303	65.91	gold quality
endometrium	UBERON:0001295	64.63	gold quality
omental fat pad	UBERON:0010414	64.02	gold quality
peritoneum	UBERON:0002358	64.00	gold quality
tonsil	UBERON:0002372	63.52	gold quality
thymus	UBERON:0002370	62.86	silver quality

Single-cell (SCXA)

Detected in 5 experiment(s), a significant marker in 3.

Experiment	Marker?	Max mean expression
E-GEOD-99795	yes	180.57
E-MTAB-6075	yes	162.25
E-ANND-3	yes	6.24
E-MTAB-6911	no	347.90
E-GEOD-110499	no	186.66

Regulation

Is transcription factor: no

Upstream regulators (CollecTRI, top): CTCF, E2F1, E2F2, E2F3, E2F4, MYCN

miRNA regulators (miRDB)

59 targeting MCM10, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-6873-3P	100.00	71.42	2626
HSA-LET-7A-3P	100.00	74.03	3932
HSA-LET-7B-3P	100.00	74.08	3913
HSA-LET-7F-1-3P	100.00	74.02	3928
HSA-MIR-98-3P	100.00	74.08	3907
HSA-MIR-5011-5P	100.00	83.46	5820
HSA-MIR-4768-5P	100.00	69.49	2861
HSA-MIR-190A-3P	100.00	80.35	5520
HSA-MIR-6833-3P	100.00	70.63	3197
HSA-MIR-186-5P	99.99	70.83	3707
HSA-MIR-485-3P	99.98	70.68	1585
HSA-MIR-539-3P	99.98	70.74	1616
HSA-MIR-551B-5P	99.96	71.28	3493
HSA-MIR-548AT-5P	99.96	70.83	2666
HSA-MIR-3910	99.95	71.13	2227
HSA-MIR-559	99.95	72.28	3609
HSA-MIR-3119	99.92	71.34	2390
HSA-MIR-338-5P	99.92	72.34	2951
HSA-MIR-627-3P	99.90	71.42	3316
HSA-MIR-153-5P	99.89	73.86	6317
HSA-MIR-4307	99.82	70.45	3374
HSA-MIR-6844	99.82	70.69	2423
HSA-MIR-6739-5P	99.80	67.87	2806
HSA-MIR-4668-5P	99.79	70.58	3782
HSA-MIR-3934-3P	99.76	65.51	1351
HSA-MIR-4517	99.76	69.19	1867
HSA-MIR-6733-5P	99.74	67.94	2759
HSA-MIR-1825	99.72	68.11	1089
HSA-MIR-1283	99.69	72.42	3009
HSA-MIR-6134	99.63	65.68	1537

Functional genomics

DepMap (CRISPR cell-line fitness): dependent in 45.6% of screened cell lines.

Literature-anchored findings (GeneRIF, showing 35)

• Functional studies of the Xenopus homolog (PMID:11864598)
• Functional studies of the Drosophila homolog (PMID:12808023)
• human Mcm10 is temporarily recruited to the replication sites 30-60 min before they replicate and dissociates from chromatin after the activation of the prereplication complex (PMID:15136575)
• transcription of human MCM10 and TopBP1 is activated by transcription factors E2F1-3, but not by factors E2F4-7 (PMID:15195143)
• These results argue that cells can tolerate low levels of p180 as long as Mcm10 is present to “recycle” it. (PMID:17699597)
• Mcm10 is required for chromatin loading of And-1. (PMID:17761813)
• Results show that MCM10 molecule is a ring-shaped hexamer with large central and smaller lateral channels and a system of inner chambers. (PMID:17823614)
• MCM10 is essential for the efficient elongation step of chromosome replication. (PMID:17997977)
• These results indicate that MCM10 protein is essential for maintaining genome integrity as well as cell cycle progression. (PMID:17997981)
• DNA and p180 binding to an Mcm10 construct that contains both the ID and CTD, provide the first mechanistic insight into how Mcm10 might use a handoff mechanism to load and stabilize pol alpha within the replication fork. (PMID:19608746)
• MCM10 interacts directly with RECQ4 and regulates its DNA unwinding activity. (PMID:19696745)
• Assembly of the Cdc45-Mcm2-7-GINS complex requires the Ctf4/And-1, RecQL4, and Mcm10 proteins. (PMID:19805216)
• High doses of ionizing gamma radiation and exposure to a combination of DNA-damaging chemicals do not decrease Mcm10 protein levels, demonstrating that Mcm10 down-regulation is triggered only by UV-specific damage (PMID:20064936)
• Mcm10 utilizes a modular architecture to act as a replisome scaffold, which helps to define possible roles in origin DNA melting, Pol alpha recruitment and coordination of enzymatic activities during elongation. (PMID:22918587)
• This report shows that human Mcm10 is an acetylated protein regulated by SIRT1, which binds and deacetylates Mcm10 both in vivo and in vitro, and modulates Mcm10 stability and ability to bind DNA. (PMID:23449222)
• Data suggest that CDC45 and MCM10 (minichromosome maintenance complex component 10) directly interact and establish a mutual co-operation in DNA binding; key domains appear to interact and then interact with DNA inside cells or in cell-free systems. (PMID:23750504)
• Loss of Mcm10 engages checkpoint, DNA repair and SUMO-dependent rescue pathways that collectively counteract replication stress and chromosome breakage. [Review] (PMID:24662891)
• RecQL4-dependent association of Mcm10 and Ctf4 with replication origins appears to be the first important step controlled by S phase promoting kinases and checkpoint pathways for the initiation of DNA replication in human cells. (PMID:25602958)
• MCM10 is the natural substrate of the Cul4-DDB1[VprBP] E3 ubiquitin ligase whose degradation is regulated by VprBP, but Vpr enhances the proteasomal degradation of MCM10 by interacting with VprBP. (PMID:26032416)
• Results show that MCM10 is significantly upregulated in urothelial carcinoma (UC), and associated with tumor aggressiveness. Its knockdown significantly suppressed cell proliferation in UC cell lines. (PMID:27780919)
• Data suggest that interaction of Mcm10 with Mcm2-7 multimer requires Mcm10 domain that contains amino acids 530-655, which overlaps with domain required for stable retention of Mcm10 on chromatin; Mcm10 conserved domain (amino acids 200-482) is essential for DNA replication; both conserved domain and Mcm2-7-binding domain are required for full activity of Mcm10. (PMID:28646110)
• MCM10 was significantly upregulated in prostate cancer (PCa). We found increased MCM10 expression was significantly associated with advanced clinical stage and high Gleason score PCa. higher MCM10 expression was associated with a poorer patient prognosis in PCa. Furthermore, loss of function assays showed that MCM10 knockdown inhibited cell proliferation and colony formation, but promoted cell apoptosis. (PMID:30095171)
• decreased expression of beta-catenin and cyclin Dl was detected in MCM10 short hairpin RNA cells, implying that MCM10 might induce breast cancer metastasis via the Wnt/beta-catenin pathway.MCM10 can be defined as a potential diagnostic tool and a promising target for breast carcinoma. (PMID:30990947)
• High MCM10 expression is associated with lung adenocarcinoma. (PMID:31545501)
• MCM10 is highly expressed in lung cancer (LC) clinical specimens and significantly associated with recurrence, pathological stage and worse overall survival. MCM10 knockdown in A549 and H661 cell lines significantly suppressed cell viability, clone formation and induced G1 phase arrest by regulating the expression of CCND1. Results indicated a combined effect of MCM10CCND1 in predicting the prognosis of LC patients. (PMID:31638210)
• Knockdown of MCM10 Gene Impairs Glioblastoma Cell Proliferation, Migration and Invasion and the Implications for the Regulation of Tumorigenesis. (PMID:32030558)
• MCM10 compensates for Myc-induced DNA replication stress in breast cancer stem-like cells. (PMID:33340428)
• Bi-allelic MCM10 variants associated with immune dysfunction and cardiomyopathy cause telomere shortening. (PMID:33712616)
• Aberrant MCM10 SUMOylation induces genomic instability mediated by a genetic variant associated with survival of esophageal squamous cell carcinoma. (PMID:34185429)
• Prognostic significance and function of MCM10 in human hepatocellular carcinoma. (PMID:34350781)
• BRCA2 associates with MCM10 to suppress PRIMPOL-mediated repriming and single-stranded gap formation after DNA damage. (PMID:34645815)
• Comprehensive analysis of DNA replication timing across 184 cell lines suggests a role for MCM10 in replication timing regulation. (PMID:35394024)
• Over-Activation of Minichromosome Maintenance Protein 10 Promotes Genomic Instability in Early Stages of Breast Cancer. (PMID:35813483)
• MCM10, a potential diagnostic, immunological, and prognostic biomarker in pan-cancer. (PMID:37848534)
• A critical threshold of MCM10 is required to maintain genome stability during differentiation of induced pluripotent stem cells into natural killer cells. (PMID:38262603)

Cross-species orthologs

5 orthologs

Organism	Symbol	Gene ID
danio_rerio	mcm10	ENSDARG00000045815
mus_musculus	Mcm10	ENSMUSG00000026669
rattus_norvegicus	Mcm10	ENSRNOG00000017981
drosophila_melanogaster	Mcm10	FBGN0032929
caenorhabditis_elegans		WBGENE00012935

Protein

Protein identifiers

Protein MCM10 homolog — Q7L590 (reviewed: Q7L590)

All UniProt accessions (3): Q7L590, C9J600, Q5T670

UniProt curated annotations — full annotation on UniProt →

Function. Acts as a replication initiation factor that brings together the MCM2-7 helicase and the DNA polymerase alpha/primase complex in order to initiate DNA replication. Additionally, plays a role in preventing DNA damage during replication. Key effector of the RBBP6 and ZBTB38-mediated regulation of DNA-replication and common fragile sites stability; acts as a direct target of transcriptional repression by ZBTB38.

Subunit / interactions. Self-associates. Interacts with ORC2. May interact with MCM2 and MCM6. Interacts with the DNA polymerase alpha subunit POLA1. Interacts with RECQL4; this interaction regulates RECQL4 unwinding activity. Interacts with WDHD1.

Subcellular location. Nucleus.

Disease relevance. Immunodeficiency 80 with or without congenital cardiomyopathy (IMD80) [MIM:619313] An autosomal recessive immunologic disorder with variable manifestations including decreased B and T cells, reduced effector and memory T cells, NK cell deficiency, chronic cytomegalovirus infection. Restrictive cardiomyopathy and hypoplasia of the spleen and thymus have also been reported in some patients. The disease is caused by variants affecting the gene represented in this entry.

Domain organisation. The N-terminal domain mediates homodimerization. Each ZnF binds a zinc ion and is involved in both ssDNA and dsDNA binding, as is the OB-fold domain. The ZnR also binds a zinc ion but is not involved in ssDNA or dsDNA binding.

Similarity. Belongs to the MCM10 family.

Isoforms (2)

UniProt ID	Names	Canonical?
Q7L590-1	1	yes
Q7L590-2	2

RefSeq proteins (2): NP_060988, NP_877428 (=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR012340	NA-bd_OB-fold	Homologous_superfamily
IPR015408	Znf_Mcm10/DnaG	Domain
IPR015411	Rep_factor_Mcm10_C	Domain
IPR040184	Mcm10	Family
IPR055065	OB_MCM10	Domain
IPR056791	Znf_Mcm10_C	Domain

Pfam: PF09329, PF09332, PF22379, PF24863

UniProt features (51 total): binding site 12, region of interest 10, compositionally biased region 7, sequence variant 7, cross-link 4, modified residue 3, domain 2, short sequence motif 2, chain 1, coiled-coil region 1, splice variant 1, sequence conflict 1

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q7L590-F1	67.11	0.24

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Ligand- & substrate-binding residues (12): 390; 400; 412; 415; 783; 786; 797; 802; 816; 818; 833; 836

Post-translational modifications (7): 85, 93, 644, 493, 627, 762, 763

Function

Pathways and Gene Ontology

Reactome pathways

10 pathways

ID	Pathway
R-HSA-176187	Activation of ATR in response to replication stress
R-HSA-68962	Activation of the pre-replicative complex
R-HSA-1640170	Cell Cycle
R-HSA-453279	Mitotic G1 phase and G1/S transition
R-HSA-69002	DNA Replication Pre-Initiation
R-HSA-69206	G1/S Transition
R-HSA-69278	Cell Cycle, Mitotic
R-HSA-69306	DNA Replication
R-HSA-69481	G2/M Checkpoints
R-HSA-69620	Cell Cycle Checkpoints

MSigDB gene sets: 304 (showing top): REACTOME_DNA_REPLICATION, BUYTAERT_PHOTODYNAMIC_THERAPY_STRESS_DN, GNF2_CENPF, FISCHER_G1_S_CELL_CYCLE, GEORGES_CELL_CYCLE_MIR192_TARGETS, REACTOME_ACTIVATION_OF_ATR_IN_RESPONSE_TO_REPLICATION_STRESS, LEE_LIVER_CANCER_CIPROFIBRATE_DN, GOLDRATH_ANTIGEN_RESPONSE, WEI_MYCN_TARGETS_WITH_E_BOX, GOCC_NUCLEAR_REPLICATION_FORK, MUELLER_PLURINET, chr10p13, UEDA_PERIFERAL_CLOCK, SHETH_LIVER_CANCER_VS_TXNIP_LOSS_PAM4, ICHIBA_GRAFT_VERSUS_HOST_DISEASE_35D_DN

GO Biological Process (4): DNA replication initiation (GO:0006270), DNA damage response (GO:0006974), cell population proliferation (GO:0008283), DNA replication (GO:0006260)

GO Molecular Function (9): DNA replication origin binding (GO:0003688), single-stranded DNA binding (GO:0003697), zinc ion binding (GO:0008270), enzyme binding (GO:0019899), identical protein binding (GO:0042802), DNA binding (GO:0003677), double-stranded DNA binding (GO:0003690), protein binding (GO:0005515), metal ion binding (GO:0046872)

GO Cellular Component (4): nucleus (GO:0005634), nucleoplasm (GO:0005654), nucleolus (GO:0005730), nuclear replication fork (GO:0043596)

Reactome top-level categories

Rollup of top-8 pathways:

Category	Pathways
Cell Cycle	2
G2/M Checkpoints	1
DNA Replication Pre-Initiation	1
G1/S Transition	1
Cell Cycle, Mitotic	1
DNA Replication	1
Mitotic G1 phase and G1/S transition	1
Cell Cycle Checkpoints	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
DNA metabolic process	2
DNA binding	2
protein binding	2
nuclear lumen	2
DNA-templated DNA replication	1
cellular response to stress	1
cellular process	1
DNA biosynthetic process	1
sequence-specific double-stranded DNA binding	1
transition metal ion binding	1
nucleic acid binding	1
binding	1
cation binding	1
intracellular membrane-bounded organelle	1
cellular anatomical structure	1
intracellular membraneless organelle	1
nuclear chromosome	1
nucleus	1
replication fork	1
CMG complex	1

Protein interactions and networks

STRING

1908 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
MCM10	CDC45	O75419	999
MCM10	WDHD1	O75717	995
MCM10	MCM6	Q14566	978
MCM10	MCM4	P33991	976
MCM10	TOPBP1	Q92547	965
MCM10	MRC1	P22897	964
MCM10	RECQL4	O94761	962
MCM10	CDT1	Q9H211	945
MCM10	TICRR	Q7Z2Z1	942
MCM10	MCM3	P25205	939
MCM10	MCM5	P33992	925
MCM10	CDC6	Q99741	922
MCM10	CLSPN	Q9HAW4	909
MCM10	ORC2	Q13416	908
MCM10	MCM7	P33993	873

IntAct

108 interactions, top by confidence:

A	B	Type	Score
RELL2	OXSR1	psi-mi:“MI:0914”(association)	0.830
IFT70B	IFT56	psi-mi:“MI:0914”(association)	0.790
MCM10	ORC2	psi-mi:“MI:0915”(physical association)	0.710
ORC2	MCM10	psi-mi:“MI:0915”(physical association)	0.710
ORC2	MCM10	psi-mi:“MI:0407”(direct interaction)	0.710
MCM10	MCM6	psi-mi:“MI:0407”(direct interaction)	0.690
MCM6	MCM10	psi-mi:“MI:0915”(physical association)	0.690
GINS1	CDC45	psi-mi:“MI:0915”(physical association)	0.620
MCM10	CEP72	psi-mi:“MI:0915”(physical association)	0.550
TRIM37	MCM10	psi-mi:“MI:0915”(physical association)	0.550
N	NOP56	psi-mi:“MI:0914”(association)	0.530
SLC31A1	C2orf72	psi-mi:“MI:0914”(association)	0.530
CACNG5	ZNF316	psi-mi:“MI:0914”(association)	0.530
DISC1	AP4M1	psi-mi:“MI:0914”(association)	0.530
KLHL40	CBX4	psi-mi:“MI:0914”(association)	0.530
TEX264	PER1	psi-mi:“MI:0914”(association)	0.530
TMEM171	THAP12	psi-mi:“MI:0914”(association)	0.530
TPH1	YEATS4	psi-mi:“MI:0914”(association)	0.530
ATG14	CETN2	psi-mi:“MI:0914”(association)	0.530
PNMA2	CCDC85C	psi-mi:“MI:0914”(association)	0.530
NINL	MCM10	psi-mi:“MI:0915”(physical association)	0.520
MCM10	MCM10	psi-mi:“MI:0407”(direct interaction)	0.520
DONSON	CDC45	psi-mi:“MI:0914”(association)	0.500
MCM10	DAPK1	psi-mi:“MI:0407”(direct interaction)	0.440

BioGRID (186): MCM10 (Two-hybrid), MCM10 (Two-hybrid), MCM10 (Affinity Capture-MS), MCM10 (Affinity Capture-MS), MCM7 (Affinity Capture-MS), MCM6 (Affinity Capture-MS), MCMBP (Affinity Capture-MS), MCM4 (Affinity Capture-MS), MCM10 (Two-hybrid), CEP70 (Two-hybrid), MCM10 (Two-hybrid), MCM10 (Two-hybrid), MCM10 (Two-hybrid), MCM10 (Two-hybrid), CEP72 (Two-hybrid)

ESM2 similar proteins: A0A0G2L7I0, A0A0R4IWG9, A0JMK9, A5D979, B0BLU1, D3ZVU1, F6UH96, G3X912, O70445, O88700, P54132, P59110, Q03111, Q0VBD2, Q1LVK9, Q22557, Q24558, Q24595, Q28E45, Q5EAW4, Q5I2W8, Q5R1T0, Q5SPR8, Q5XI59, Q6A037, Q6DJS0, Q6INS5, Q6P2L6, Q6XV80, Q6ZPI0, Q71M44, Q7KW09, Q7L590, Q7T308, Q7ZVP1, Q7ZXG4, Q801E2, Q803U7, Q80Z32, Q8AXF4

Diamond homologs: Q0VBD2, Q28E45, Q5EAW4, Q5RHY1, Q7L590, Q9VIE6

SIGNOR signaling

4 interactions.

A	Effect	B	Mechanism
MCM10	down-regulates	RECQL4	binding
Cullin4-RBX1-DDB1	“down-regulates quantity by destabilization”	MCM10	polyubiquitination
DCAF1	“down-regulates quantity by destabilization”	MCM10	binding
MCM10	“up-regulates quantity by stabilization”	POLA1	relocalization

Enriched among interaction partners

Reactome pathways and GO biological processes over-represented among this gene’s 138 IntAct physical interaction partners (hypergeometric vs the genome-wide background, BH-FDR, gene-set size 15–500, ranked by fold). A functional readout of the neighbourhood — distinct from this gene’s own memberships above, and biased toward well-studied / hub proteins, so read it as themes rather than proof.

Reactome pathways:

Pathway	Partners	Fold	FDR
Activation of the pre-replicative complex	11	42.7×	2e-13
Activation of ATR in response to replication stress	11	39.4×	4e-13
DNA Replication Pre-Initiation	9	34.0×	3e-10
Synthesis of DNA	8	28.6×	1e-08
Mitotic G1 phase and G1/S transition	13	28.5×	2e-13
G1/S Transition	10	27.8×	2e-10
DNA Replication	9	25.5×	3e-09
Switching of origins to a post-replicative state	7	25.0×	4e-07

GO biological processes:

GO term	Partners	Fold	FDR
DNA replication initiation	9	45.7×	1e-10
regulation of DNA-templated DNA replication initiation	5	42.8×	2e-05
DNA replication	9	12.1×	1e-05
cilium assembly	10	6.0×	8e-04
cell division	11	4.1×	7e-03

Disease & clinical

Clinical variants and AI predictions

ClinVar

188 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	4
Likely pathogenic	0
Uncertain significance	119
Likely benign	19
Benign	22

Top pathogenic / likely-pathogenic (4)

Variant ID	HGVS	Classification
1077164	NM_018518.5(MCM10):c.1276C>T (p.Arg426Cys)	Pathogenic
1077165	NM_018518.5(MCM10):c.1744C>T (p.Arg582Ter)	Pathogenic
1077166	NM_018518.5(MCM10):c.236del (p.Gly79fs)	Pathogenic
1077167	NM_018518.5(MCM10):c.764+5G>A	Pathogenic

SpliceAI

3239 predictions. Top by Δscore:

Variant	Effect	Δscore
10:13164125:C:G	acceptor_gain	1.0000
10:13170917:CCTA:C	acceptor_loss	1.0000
10:13170920:A:AG	acceptor_gain	1.0000
10:13170920:A:C	acceptor_loss	1.0000
10:13170921:G:GG	acceptor_gain	1.0000
10:13170921:GA:G	acceptor_gain	1.0000
10:13170921:GAGGA:G	acceptor_gain	1.0000
10:13171179:G:GT	donor_gain	1.0000
10:13171298:GA:G	donor_gain	1.0000
10:13180542:G:GT	donor_gain	1.0000
10:13180606:GT:G	donor_gain	1.0000
10:13180608:G:GG	donor_gain	1.0000
10:13183001:ATTT:A	acceptor_gain	1.0000
10:13183004:T:TA	acceptor_gain	1.0000
10:13183097:GGAG:G	donor_gain	1.0000
10:13183098:G:GT	donor_gain	1.0000
10:13183098:GAG:G	donor_gain	1.0000
10:13183099:AGGTA:A	donor_loss	1.0000
10:13183100:GGT:G	donor_loss	1.0000
10:13183101:G:GA	donor_loss	1.0000
10:13183101:G:GG	donor_gain	1.0000
10:13183102:T:A	donor_loss	1.0000
10:13186158:TTACA:T	acceptor_loss	1.0000
10:13186159:TACAG:T	acceptor_loss	1.0000
10:13186160:ACAGG:A	acceptor_loss	1.0000
10:13186161:CA:C	acceptor_loss	1.0000
10:13186163:G:GA	acceptor_loss	1.0000
10:13186268:GACT:G	donor_gain	1.0000
10:13188880:GC:G	acceptor_gain	1.0000
10:13188880:GCGT:G	acceptor_gain	1.0000

AlphaMissense

5696 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
10:13182951:T:A	W318R	0.999
10:13182951:T:C	W318R	0.999
10:13182945:A:C	S316R	0.998
10:13182947:C:A	S316R	0.998
10:13182947:C:G	S316R	0.998
10:13186230:T:C	C390R	0.998
10:13204309:T:C	C816R	0.998
10:13209110:T:A	W841R	0.998
10:13209110:T:C	W841R	0.998
10:13180489:G:C	R272P	0.997
10:13180554:T:A	W294R	0.997
10:13180554:T:C	W294R	0.997
10:13182942:T:C	F315L	0.997
10:13182944:C:A	F315L	0.997
10:13182944:C:G	F315L	0.997
10:13183002:T:C	F335L	0.997
10:13183004:T:A	F335L	0.997
10:13183004:T:G	F335L	0.997
10:13186206:G:C	G382R	0.997
10:13186230:T:A	C390S	0.997
10:13186231:G:C	C390S	0.997
10:13188896:T:C	C412R	0.997
10:13204300:T:C	F813L	0.997
10:13204302:T:A	F813L	0.997
10:13204302:T:G	F813L	0.997
10:13209112:G:C	W841C	0.997
10:13209112:G:T	W841C	0.997
10:13180561:C:A	T296K	0.996
10:13180567:G:A	G298E	0.996
10:13182958:T:C	L320P	0.996

dbSNP variants (sampled 300 via entrez): RS1000015218 (10:13167594 C>G,T), RS1000067999 (10:13173512 C>A), RS1000206029 (10:13199788 C>G,T), RS1000266932 (10:13173850 G>A), RS1000267250 (10:13191495 C>A,T), RS1000362874 (10:13162127 G>A), RS1000387702 (10:13209971 TATAG>T), RS1000416453 (10:13197312 C>G), RS1000472896 (10:13208398 A>T), RS1000520925 (10:13197645 G>A), RS1000575035 (10:13194255 CGGGAGGCTGAGGTGGGAGGATCACCTGAGCCT>C), RS1000598142 (10:13192885 C>T), RS1000656443 (10:13197200 A>C,G), RS1000774374 (10:13203574 T>C), RS1000809649 (10:13198430 C>T)

Disease associations

OMIM: gene MIM:609357 | disease phenotypes: MIM:619313

GenCC curated gene-disease

Disease	Classification	Inheritance
immunodeficiency 80 with or without congenital cardiomyopathy	Moderate	Autosomal recessive

ClinGen Gene-Disease Validity (1)

Expert-panel classifications — Definitive > Strong > Moderate > Limited > Disputed > Refuted.

Disease	Classification	Inheritance
immunodeficiency 80 with or without congenital cardiomyopathy	Moderate	AR

Mondo (1): immunodeficiency 80 with or without congenital cardiomyopathy (MONDO:0030266)

Orphanet (0):

HPO phenotypes

21 total (21 of 21 shown, HPO-id order):

HPO	Term
HP:0000007	Autosomal recessive inheritance
HP:0000778	Hypoplasia of the thymus
HP:0001698	Pericardial effusion
HP:0001706	Endocardial fibroelastosis
HP:0001723	Restrictive cardiomyopathy
HP:0001790	Nonimmune hydrops fetalis
HP:0001945	Fever
HP:0002014	Diarrhea
HP:0002155	Hypertriglyceridemia
HP:0002721	Immunodeficiency
HP:0003281	Increased circulating ferritin concentration
HP:0003347	Impaired lymphocyte transformation with phytohemagglutinin
HP:0005403	Decreased total T cell count
HP:0006270	Hypoplastic spleen
HP:0010976	Decreased total B cell count
HP:0011461	Fetal onset
HP:0011900	Hypofibrinogenemia
HP:0030718	Right atrial enlargement
HP:0031382	Decreased anti-CD3/28-induced T-cell proliferation
HP:0031692	Severe cytomegalovirus infection
HP:0040218	Reduced total natural killer cell count

GWAS associations

3 associations (top):

Study	Trait	p-value
GCST010105_127	Nicotine dependence symptom count	3.000000e-06
GCST010105_20	Nicotine dependence symptom count	3.000000e-06
GCST012356_1	Survival time in esophageal squamous cell carcinoma	1.000000e-07

EFO canonical traits (2, from GWAS)

EFO ID	Trait name
EFO:0009262	nicotine dependence symptom count
EFO:0000714	survival time

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

88 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Benzo(a)pyrene	decreases expression, increases expression, increases methylation	4
Cyclosporine	decreases expression	4
sodium arsenite	increases expression, decreases expression	3
Estradiol	increases expression	3
Tretinoin	decreases expression	3
Aflatoxin B1	affects expression, increases expression, increases methylation	3
bisphenol A	decreases expression, increases expression	2
(+)-JQ1 compound	decreases expression	2
Cisplatin	increases expression, decreases expression	2
Methyl Methanesulfonate	decreases expression, increases expression	2
Testosterone	decreases expression, affects cotreatment	2
Tobacco Smoke Pollution	decreases expression, increases expression	2
7,8-Dihydro-7,8-dihydroxybenzo(a)pyrene 9,10-oxide	decreases expression, increases expression	2
GSK-J4	decreases expression	1
afuresertib	decreases expression	1
FR900359	decreases phosphorylation	1
TAK-243	increases sumoylation	1
lasiocarpine	increases expression	1
2,2’-methylenebis(4-methyl-6-tert-butylphenol)	affects expression, affects response to substance	1
beta-lapachone	increases expression	1
perfluorooctanoic acid	decreases expression	1
zinc chromate	decreases expression, increases abundance	1
2,3-bis(3’-hydroxybenzyl)butyrolactone	increases expression, affects cotreatment	1
coumarin	increases phosphorylation	1
phenethyl isothiocyanate	decreases expression	1
chromium hexavalent ion	decreases expression, increases abundance	1
perfluorooctane sulfonic acid	decreases expression	1
CGP 52608	affects binding, increases reaction	1
monomethylarsonous acid	decreases expression	1
bazedoxifene	decreases expression	1

Cellosaurus cell lines

2 cell lines: 2 cancer cell line

First 10 cell lines (id-ordered, not curated):

Cellosaurus	Name	Category	Sex
CVCL_E0WU	Ubigene KYSE-150 MCM10 KO	Cancer cell line	Female
CVCL_E0X0	Ubigene KYSE-30 MCM10 KO	Cancer cell line	Male

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.