MED16

Summary

MED16 (mediator complex subunit 16, HGNC:17556) is a protein-coding gene on chromosome 19p13.3, encoding Mediator of RNA polymerase II transcription subunit 16 (Q9Y2X0). Component of the Mediator complex, a coactivator involved in the regulated transcription of nearly all RNA polymerase II-dependent genes. It is a selective cancer dependency (DepMap: 14.1% of cell lines).

Enables nuclear thyroid hormone receptor binding activity and transcription coactivator activity. Involved in positive regulation of transcription initiation by RNA polymerase II. Located in nucleus. Part of core mediator complex and mediator complex.

Source: NCBI Gene 10025 — RefSeq curated summary.

At a glance

• Gene–disease (curated): complex neurodevelopmental disorder (Strong, GenCC) — +1 more curated relationship
• GWAS associations: 5
• Clinical variants (ClinVar): 286 total — 17 pathogenic
• Phenotypes (HPO): 196
• Druggable target: yes — 1 molecules with ChEMBL bioactivity
• Cancer dependency (DepMap): dependent in 14.1% of screened cell lines
• MANE Select transcript: NM_005481

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:17556
Approved symbol	MED16
Name	mediator complex subunit 16
Location	19p13.3
Locus type	gene with protein product
Status	Approved
Aliases	DRIP92, TRAP95
Ensembl gene	ENSG00000175221
Ensembl biotype	protein_coding
OMIM	604062
Entrez	10025

Gene structure

Transcript identifiers

Ensembl transcripts: 15 — 13 protein_coding, 2 nonsense_mediated_decay

ENST00000312090, ENST00000325464, ENST00000395808, ENST00000586017, ENST00000586342, ENST00000592373, ENST00000592943, ENST00000606248, ENST00000606828, ENST00000607471, ENST00000621073, ENST00000946172, ENST00000946173, ENST00000946174, ENST00000946175

RefSeq mRNA: 1 — MANE Select: NM_005481 NM_005481

CCDS: CCDS12047

Canonical transcript exons

ENST00000325464 — 16 exons

Exon	Start	End
ENSE00000768849	871926	872118
ENSE00000892244	876974	877180
ENSE00001211238	890137	890244
ENSE00001228670	868416	868499
ENSE00001228752	889638	889807
ENSE00001228781	875244	875454
ENSE00001228795	879937	880148
ENSE00001228803	881559	881714
ENSE00001228808	884903	885008
ENSE00001329893	885770	886201
ENSE00001492621	890963	891149
ENSE00002693211	873449	873582
ENSE00002928502	867963	868251
ENSE00003566473	871037	871253
ENSE00003650621	868863	868946
ENSE00003846635	893086	893187

Expression profiles

Bgee: expression breadth ubiquitous, 167 present calls, max score 94.96.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 28.0936 / max 165.0067, expressed in 1811 samples.

FANTOM5 promoters (2 alternative TSS)

Promoter ID	TPM avg	Samples expressed
177948	22.6252	1804
177949	5.4684	1710

Top tissues by expression

285 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
lower esophagus mucosa	UBERON:0035834	94.96	gold quality
mucosa of transverse colon	UBERON:0004991	94.78	gold quality
right uterine tube	UBERON:0001302	94.14	gold quality
right lobe of liver	UBERON:0001114	93.45	gold quality
mucosa of stomach	UBERON:0001199	93.38	gold quality
endocervix	UBERON:0000458	93.14	gold quality
apex of heart	UBERON:0002098	92.99	gold quality
primordial germ cell in gonad	CL:0000670 ∩ UBERON:0000991	92.92	gold quality
granulocyte	CL:0000094	92.79	gold quality
adenohypophysis	UBERON:0002196	92.59	gold quality
hindlimb stylopod muscle	UBERON:0004252	92.46	gold quality
ectocervix	UBERON:0012249	92.42	gold quality
right lobe of thyroid gland	UBERON:0001119	92.39	gold quality
right ovary	UBERON:0002118	92.38	gold quality
ventricular zone	UBERON:0003053	92.04	gold quality
skin of leg	UBERON:0001511	91.88	gold quality
skin of abdomen	UBERON:0001416	91.79	gold quality
anterior cingulate cortex	UBERON:0009835	91.71	gold quality
left ovary	UBERON:0002119	91.69	gold quality
cingulate cortex	UBERON:0003027	91.62	gold quality
ganglionic eminence	UBERON:0004023	91.49	gold quality
metanephros cortex	UBERON:0010533	91.47	gold quality
left lobe of thyroid gland	UBERON:0001120	91.45	gold quality
right frontal lobe	UBERON:0002810	91.32	gold quality
body of stomach	UBERON:0001161	91.30	gold quality
muscle layer of sigmoid colon	UBERON:0035805	91.28	gold quality
right adrenal gland	UBERON:0001233	91.23	gold quality
transverse colon	UBERON:0001157	91.20	gold quality
body of pancreas	UBERON:0001150	91.10	gold quality
omental fat pad	UBERON:0010414	91.07	gold quality

Single-cell (SCXA)

Detected in 1 experiment(s), a significant marker in 1.

Experiment	Marker?	Max mean expression
E-ANND-3	yes	5.77

Regulation

Is transcription factor: no

Upstream regulators (CollecTRI, top): STAT1

miRNA regulators (miRDB)

1 targeting MED16, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-4316	99.37	65.75	1360

Functional genomics

DepMap (CRISPR cell-line fitness): dependent in 14.1% of screened cell lines.

Literature-anchored findings (GeneRIF, showing 1)

• Mediator complex subunit 16 is down-regulated in papillary thyroid cancer, leading to increased transforming growth factor-beta signaling and radioiodine resistance. (PMID:32532820)

Cross-species orthologs

4 orthologs

Organism	Symbol	Gene ID
danio_rerio	med16	ENSDARG00000040779
mus_musculus	Med16	ENSMUSG00000013833
rattus_norvegicus	Med16	ENSRNOG00000011315
drosophila_melanogaster	MED16	FBGN0034707

Protein

Protein identifiers

Mediator of RNA polymerase II transcription subunit 16 — Q9Y2X0 (reviewed: Q9Y2X0)

Alternative names: Mediator complex subunit 16, Thyroid hormone receptor-associated protein 5, Thyroid hormone receptor-associated protein complex 95 kDa component, Vitamin D3 receptor-interacting protein complex 92 kDa component

All UniProt accessions (9): A0A087WU12, B9TWZ6, B9TX03, Q9Y2X0, K7EKS6, K7EKX2, K7EKX6, U3KQ43, U3KQB4

UniProt curated annotations — full annotation on UniProt →

Function. Component of the Mediator complex, a coactivator involved in the regulated transcription of nearly all RNA polymerase II-dependent genes. Mediator functions as a bridge to convey information from gene-specific regulatory proteins to the basal RNA polymerase II transcription machinery. Mediator is recruited to promoters by direct interactions with regulatory proteins and serves as a scaffold for the assembly of a functional preinitiation complex with RNA polymerase II and the general transcription factors.

Subunit / interactions. Component of the Mediator complex, which is composed of MED1, MED4, MED6, MED7, MED8, MED9, MED10, MED11, MED12, MED13, MED13L, MED14, MED15, MED16, MED17, MED18, MED19, MED20, MED21, MED22, MED23, MED24, MED25, MED26, MED27, MED29, MED30, MED31, CCNC, CDK8 and CDC2L6/CDK11. The MED12, MED13, CCNC and CDK8 subunits form a distinct module termed the CDK8 module. Mediator containing the CDK8 module is less active than Mediator lacking this module in supporting transcriptional activation. Individual preparations of the Mediator complex lacking one or more distinct subunits have been variously termed ARC, CRSP, DRIP, PC2, SMCC and TRAP.

Subcellular location. Nucleus.

Disease relevance. Guillouet-Gordon syndrome (GGNS) [MIM:621220] An autosomal recessive disorder characterized by multiple congenital anomalies, including craniofacial defects, anomalies of the extremities and heart defects, in association with intellectual disability, speech delay, and/or motor delay of variable severity. Visual impairment and deafness are also frequent. The disease is caused by variants affecting the gene represented in this entry.

Similarity. Belongs to the Mediator complex subunit 16 family.

Isoforms (5)

UniProt ID	Names	Canonical?
Q9Y2X0-1	1	yes
Q9Y2X0-2	2
Q9Y2X0-3	3
Q9Y2X0-4	4
Q9Y2X0-5	5

RefSeq proteins (1): NP_005472* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR001680	WD40_rpt	Repeat
IPR011041	Quinoprot_gluc/sorb_DH_b-prop	Homologous_superfamily
IPR015943	WD40/YVTN_repeat-like_dom_sf	Homologous_superfamily
IPR021665	Mediator_Med16_N	Domain
IPR036322	WD40_repeat_dom_sf	Homologous_superfamily
IPR048338	Mediator_Med16	Family
IPR048339	Mediator_Med16_C	Domain
IPR048616	MED16_bridge	Domain

Pfam: PF00400, PF11635, PF20718, PF20719

UniProt features (110 total): strand 40, helix 23, sequence variant 21, repeat 9, splice variant 6, turn 5, sequence conflict 3, chain 1, region of interest 1, compositionally biased region 1

Structure

Experimental structures (PDB)

10 structures.

PDB	Method	Resolution (Å)
7EMF	ELECTRON MICROSCOPY	3.5
8TRH	ELECTRON MICROSCOPY	3.7
7ENA	ELECTRON MICROSCOPY	4.07
7ENC	ELECTRON MICROSCOPY	4.13
8GXS	ELECTRON MICROSCOPY	4.16
7ENJ	ELECTRON MICROSCOPY	4.4
8T9D	ELECTRON MICROSCOPY	4.66
7LBM	ELECTRON MICROSCOPY	4.8
8GXQ	ELECTRON MICROSCOPY	5.04
8TQW	ELECTRON MICROSCOPY	8.2

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q9Y2X0-F1	84.25	0.59

Function

Pathways and Gene Ontology

Reactome pathways

20 pathways

ID	Pathway
R-HSA-1989781	PPARA activates gene expression
R-HSA-212436	Generic Transcription Pathway
R-HSA-381340	Transcriptional regulation of white adipocyte differentiation
R-HSA-9833110	RSV-host interactions
R-HSA-9841922	MLL4 and MLL3 complexes regulate expression of PPARG target genes in adipogenesis and hepatic steatosis
R-HSA-1266738	Developmental Biology
R-HSA-1430728	Metabolism
R-HSA-1643685	Disease
R-HSA-212165	Epigenetic regulation of gene expression
R-HSA-400206	Regulation of lipid metabolism by PPARalpha
R-HSA-556833	Metabolism of lipids
R-HSA-5663205	Infectious disease
R-HSA-73857	RNA Polymerase II Transcription
R-HSA-74160	Gene expression (Transcription)
R-HSA-9818564	Epigenetic regulation of gene expression by MLL3 and MLL4 complexes
R-HSA-9820952	Respiratory Syncytial Virus Infection Pathway
R-HSA-9824446	Viral Infection Pathways
R-HSA-9843745	Adipogenesis
R-HSA-9851695	Epigenetic regulation of adipogenesis genes by MLL3 and MLL4 complexes
R-HSA-9917777	Epigenetic regulation by WDR5-containing histone modifying complexes

MSigDB gene sets: 137 (showing top): REACTOME_TRANSCRIPTIONAL_REGULATION_OF_WHITE_ADIPOCYTE_DIFFERENTIATION, GOBP_POSITIVE_REGULATION_OF_DNA_TEMPLATED_TRANSCRIPTION_INITIATION, GRAESSMANN_APOPTOSIS_BY_DOXORUBICIN_DN, GRAESSMANN_RESPONSE_TO_MC_AND_DOXORUBICIN_DN, GOBP_REGULATION_OF_DNA_TEMPLATED_TRANSCRIPTION_INITIATION, GOBP_DNA_TEMPLATED_TRANSCRIPTION_INITIATION, GOBP_TRANSCRIPTION_INITIATION_AT_RNA_POLYMERASE_II_PROMOTER, DOUGLAS_BMI1_TARGETS_DN, GOBP_PROTEIN_DNA_COMPLEX_ORGANIZATION, OCT1_B, GOBP_POSITIVE_REGULATION_OF_DNA_TEMPLATED_TRANSCRIPTION_ELONGATION, GOBP_REGULATION_OF_DNA_TEMPLATED_TRANSCRIPTION_ELONGATION, GOCC_RNA_POLYMERASE_II_TRANSCRIPTION_REGULATOR_COMPLEX, GOCC_TRANSCRIPTION_REGULATOR_COMPLEX, MARSON_BOUND_BY_FOXP3_UNSTIMULATED

GO Biological Process (6): regulation of transcription by RNA polymerase II (GO:0006357), transcription by RNA polymerase II (GO:0006366), positive regulation of transcription elongation by RNA polymerase II (GO:0032968), positive regulation of DNA-templated transcription (GO:0045893), RNA polymerase II preinitiation complex assembly (GO:0051123), positive regulation of transcription initiation by RNA polymerase II (GO:0060261)

GO Molecular Function (4): transcription coactivator activity (GO:0003713), nuclear vitamin D receptor binding (GO:0042809), nuclear thyroid hormone receptor binding (GO:0046966), protein binding (GO:0005515)

GO Cellular Component (5): nucleus (GO:0005634), nucleoplasm (GO:0005654), membrane (GO:0016020), mediator complex (GO:0016592), core mediator complex (GO:0070847)

Reactome top-level categories

Rollup of top-15 pathways:

Category	Pathways
Gene expression (Transcription)	2
Regulation of lipid metabolism by PPARalpha	1
RNA Polymerase II Transcription	1
Adipogenesis	1
Respiratory Syncytial Virus Infection Pathway	1
Epigenetic regulation of adipogenesis genes by MLL3 and MLL4 complexes	1
Metabolism of lipids	1
Metabolism	1
Disease	1
Epigenetic regulation by WDR5-containing histone modifying complexes	1
Viral Infection Pathways	1
Infectious disease	1
Developmental Biology	1
Epigenetic regulation of gene expression by MLL3 and MLL4 complexes	1
Epigenetic regulation of gene expression	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
regulation of DNA-templated transcription	2
DNA-templated transcription	2
positive regulation of transcription by RNA polymerase II	2
transcription initiation at RNA polymerase II promoter	2
nuclear receptor binding	2
cellular anatomical structure	2
transcription by RNA polymerase II	1
transcription elongation by RNA polymerase II	1
positive regulation of DNA-templated transcription, elongation	1
regulation of transcription elongation by RNA polymerase II	1
positive regulation of RNA biosynthetic process	1
transcription preinitiation complex assembly	1
regulation of transcription initiation by RNA polymerase II	1
positive regulation of DNA-templated transcription initiation	1
transcription coregulator activity	1
positive regulation of DNA-templated transcription	1
binding	1
intracellular membrane-bounded organelle	1
nuclear lumen	1
core mediator complex	1
nuclear protein-containing complex	1
RNA polymerase II transcription regulator complex	1

Protein interactions and networks

STRING

1256 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
MED16	MED23	Q9ULK4	961
MED16	MED15	Q96RN5	948
MED16	MED24	O75448	940
MED16	MED29	Q9NX70	932
MED16	MED14	O60244	918
MED16	MED27	Q6P2C8	908
MED16	MED18	Q9BUE0	888
MED16	MED10	Q9BTT4	868
MED16	MED22	Q15528	866
MED16	MED17	Q9NVC6	861
MED16	MED12	Q93074	848
MED16	MED31	Q9Y3C7	812
MED16	CDK8	P49336	799
MED16	MED6	O75586	774
MED16	MED21	Q13503	772

IntAct

134 interactions, top by confidence:

A	B	Type	Score
MED10	MED19	psi-mi:“MI:0914”(association)	0.910
MED10	MED19	psi-mi:“MI:0915”(physical association)	0.910
CDK8	MED14	psi-mi:“MI:0914”(association)	0.900
MED4	MED19	psi-mi:“MI:0914”(association)	0.900
MED29	MED19	psi-mi:“MI:0914”(association)	0.890
MED21	MED19	psi-mi:“MI:0914”(association)	0.880
CDK8	MED19	psi-mi:“MI:2364”(proximity)	0.850
CDK8	MED19	psi-mi:“MI:0914”(association)	0.850
MED20	MED19	psi-mi:“MI:0914”(association)	0.840
MED31	MED19	psi-mi:“MI:0914”(association)	0.840
MED7	MED19	psi-mi:“MI:0914”(association)	0.840
MED11	MED19	psi-mi:“MI:0914”(association)	0.840
MED18	MED19	psi-mi:“MI:0914”(association)	0.840

BioGRID (241): MED16 (Affinity Capture-MS), MED16 (Affinity Capture-MS), MED16 (Affinity Capture-MS), MED16 (Affinity Capture-MS), MED16 (Affinity Capture-MS), MED16 (Affinity Capture-MS), MED16 (Affinity Capture-MS), MED16 (Affinity Capture-MS), MED1 (Co-fractionation), MED12 (Co-fractionation), MED14 (Co-fractionation), MED16 (Co-fractionation), MED16 (Co-fractionation), MED16 (Co-fractionation), MED16 (Co-fractionation)

ESM2 similar proteins: A0A0R4IC37, A1A4K3, A2CEI4, B1WC10, E9PY46, F1QEB7, F4IDS7, O08658, O13046, O75694, O75717, O95876, P33194, P37199, P59328, Q08D69, Q10569, Q10570, Q16531, Q32NR9, Q3U1J4, Q4ADV7, Q566H4, Q5DQR4, Q5R649, Q5U1Z0, Q5ZLG9, Q6P6Z0, Q6PGF3, Q6PJI9, Q7XWP1, Q802U2, Q805F9, Q8BMG7, Q8C0M0, Q8C456, Q8CEC0, Q8CJF7, Q8K1X1, Q8NFP9

Diamond homologs: Q08D69, Q16K67, Q566H4, Q6PGF3, Q9Y2X0, Q9W278

SIGNOR signaling

1 interactions.

A	Effect	B	Mechanism
MED16	“form complex”	“Core mediator complex”	binding

Enriched among interaction partners

Reactome pathways and GO biological processes over-represented among this gene’s 77 IntAct physical interaction partners (hypergeometric vs the genome-wide background, BH-FDR, gene-set size 15–500, ranked by fold). A functional readout of the neighbourhood — distinct from this gene’s own memberships above, and biased toward well-studied / hub proteins, so read it as themes rather than proof.

Reactome pathways:

Pathway	Partners	Fold	FDR
Respiratory Syncytial Virus Infection Pathway	28	95.0×	2e-49
RSV-host interactions	28	75.5×	2e-46
Adipogenesis	28	75.5×	2e-46
Regulation of lipid metabolism by PPARalpha	28	68.1×	6e-45
Transcriptional regulation of white adipocyte differentiation	28	62.6×	8e-44
Epigenetic regulation of adipogenesis genes by MLL3 and MLL4 complexes	16	59.4×	8e-24
Epigenetic regulation of gene expression by MLL3 and MLL4 complexes	16	54.3×	3e-23
PPARA activates gene expression	28	45.6×	2e-39

GO biological processes:

GO term	Partners	Fold	FDR
positive regulation of transcription elongation by RNA polymerase II	24	101.7×	7e-42
RNA polymerase II preinitiation complex assembly	25	95.7×	1e-42
positive regulation of transcription initiation by RNA polymerase II	25	95.7×	1e-42
somatic stem cell population maintenance	12	41.9×	8e-15
transcription initiation at RNA polymerase II promoter	7	36.9×	6e-08
protein ubiquitination	12	7.0×	9e-06

Disease & clinical

Clinical variants and AI predictions

ClinVar

286 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	17
Likely pathogenic	0
Uncertain significance	214
Likely benign	19
Benign	4

Top pathogenic / likely-pathogenic (17)

Variant ID	HGVS	Classification
3385328	NM_005481.3(MED16):c.385dup (p.Asp129fs)	Pathogenic
3385329	NM_005481.3(MED16):c.932T>C (p.Leu311Pro)	Pathogenic
3900681	NM_005481.3(MED16):c.2399G>C (p.Arg800Thr)	Pathogenic
3900682	NM_005481.3(MED16):c.1141G>A (p.Gly381Arg)	Pathogenic
3900683	NM_005481.3(MED16):c.1151T>A (p.Leu384Gln)	Pathogenic
3900684	NM_005481.3(MED16):c.500C>G (p.Ser167Trp)	Pathogenic
3900685	NM_005481.3(MED16):c.205C>G (p.His69Asp)	Pathogenic
3900686	NM_005481.3(MED16):c.2457_2465dup (p.Arg822_Trp823insGluGlnArg)	Pathogenic
3900688	NM_005481.3(MED16):c.1052T>C (p.Val351Ala)	Pathogenic
3900689	MED16, 4,206-BP DEL, EX9-10	Pathogenic
3900690	NM_005481.3(MED16):c.1408_1413dup (p.Leu471_Arg472insAlaLeu)	Pathogenic
3900691	NM_005481.3(MED16):c.1967G>A (p.Arg656Gln)	Pathogenic
3900692	NM_005481.3(MED16):c.1883T>C (p.Leu628Pro)	Pathogenic
3900694	NM_005481.3(MED16):c.1906-2A>G	Pathogenic
3900695	NM_005481.3(MED16):c.481C>T (p.Arg161Ter)	Pathogenic
3900696	NM_005481.3(MED16):c.392T>C (p.Ile131Thr)	Pathogenic
3900697	NM_005481.3(MED16):c.2071del (p.Arg691fs)	Pathogenic

SpliceAI

2974 predictions. Top by Δscore:

Variant	Effect	Δscore
19:868857:CCTCA:C	donor_loss	1.0000
19:868858:CTCAC:C	donor_loss	1.0000
19:868859:TCACC:T	donor_loss	1.0000
19:868860:CACC:C	donor_loss	1.0000
19:868861:A:C	donor_loss	1.0000
19:868862:C:A	donor_loss	1.0000
19:868945:CC:C	acceptor_gain	1.0000
19:868946:CC:C	acceptor_gain	1.0000
19:868947:C:CC	acceptor_gain	1.0000
19:868948:T:C	acceptor_loss	1.0000
19:871033:GCAC:G	donor_loss	1.0000
19:871035:A:AC	donor_gain	1.0000
19:871035:A:C	donor_loss	1.0000
19:871036:C:CC	donor_gain	1.0000
19:871036:CCTGG:C	donor_gain	1.0000
19:871249:GCGAC:G	acceptor_gain	1.0000
19:871250:CGAC:C	acceptor_gain	1.0000
19:871250:CGACC:C	acceptor_gain	1.0000
19:871251:GAC:G	acceptor_gain	1.0000
19:871252:AC:A	acceptor_gain	1.0000
19:871253:CC:C	acceptor_gain	1.0000
19:871254:C:CC	acceptor_gain	1.0000
19:871254:C:CG	acceptor_loss	1.0000
19:871924:A:AC	donor_gain	1.0000
19:871925:C:CC	donor_gain	1.0000
19:871925:CAG:C	donor_gain	1.0000
19:871973:T:TA	donor_gain	1.0000
19:873444:CGCA:C	donor_loss	1.0000
19:873445:GCACC:G	donor_loss	1.0000
19:873446:CACCT:C	donor_loss	1.0000

AlphaMissense

5690 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
19:872031:A:G	W665R	1.000
19:872031:A:T	W665R	1.000
19:881683:C:A	W339C	1.000
19:881683:C:G	W339C	1.000
19:881684:C:G	W339S	1.000
19:881685:A:G	W339R	1.000
19:881685:A:T	W339R	1.000
19:884963:A:G	W309R	1.000
19:884963:A:T	W309R	1.000
19:886114:A:G	W179R	1.000
19:886114:A:T	W179R	1.000
19:886116:C:T	G178D	1.000
19:886117:C:G	G178R	1.000
19:886173:A:G	F159S	1.000
19:889666:C:T	G140D	1.000
19:889679:A:G	W136R	1.000
19:889679:A:T	W136R	1.000
19:889733:A:G	W118R	1.000
19:889733:A:T	W118R	1.000
19:889795:A:G	L97P	1.000
19:889798:A:G	L96P	1.000
19:890147:C:A	W89C	1.000
19:890147:C:G	W89C	1.000
19:890148:C:G	W89S	1.000
19:890149:A:G	W89R	1.000
19:890149:A:T	W89R	1.000
19:890995:G:T	A46D	1.000
19:868432:A:G	W823R	0.999
19:868432:A:T	W823R	0.999
19:868442:C:A	W819C	0.999

dbSNP variants (sampled 300 via entrez): RS1000020174 (19:876947 GGGGCCCCACCTGCCAC>G,GGGGCCCCACCTGCCACGGGCCCCACCTGCCAC), RS1000027356 (19:889620 C>T), RS1000035927 (19:871307 C>A,T), RS1000064151 (19:891381 G>C), RS1000134209 (19:894656 G>A,C), RS1000246535 (19:890817 C>T), RS1000302859 (19:873847 T>C), RS1000334900 (19:867934 C>A,T), RS1000391509 (19:887672 A>T), RS1000422611 (19:887791 T>C,G), RS1000463794 (19:876316 C>T), RS1000487089 (19:893592 T>C), RS1000539953 (19:872319 A>G), RS1000596405 (19:869727 G>A), RS1000770496 (19:887130 T>A,C,G)

Disease associations

OMIM: gene MIM:604062 | disease phenotypes: MIM:621220

GenCC curated gene-disease

Disease	Classification	Inheritance
complex neurodevelopmental disorder	Strong	Autosomal recessive
complex neurodevelopmental disorder with or without congenital anomalies	Moderate	Autosomal recessive

Mondo (4): Guillouet-Gordon syndrome (MONDO:0979227), syndromic intellectual disability (MONDO:0000508), complex neurodevelopmental disorder with or without congenital anomalies (MONDO:0100465), complex neurodevelopmental disorder (MONDO:0100038)

Orphanet (1): Rare genetic syndromic intellectual disability (Orphanet:183763)

HPO phenotypes

196 total (30 of 196 shown, HPO-id order):

HPO	Term
HP:0000007	Autosomal recessive inheritance
HP:0000023	Inguinal hernia
HP:0000028	Cryptorchidism
HP:0000081	Duplicated collecting system
HP:0000085	Horseshoe kidney
HP:0000110	Renal dysplasia
HP:0000122	Unilateral renal agenesis
HP:0000125	Pelvic kidney
HP:0000126	Hydronephrosis
HP:0000143	Rectovaginal fistula
HP:0000154	Wide mouth
HP:0000160	Narrow mouth
HP:0000162	Glossoptosis
HP:0000175	Cleft palate
HP:0000185	Cleft soft palate
HP:0000218	High palate
HP:0000248	Brachycephaly
HP:0000278	Retrognathia
HP:0000280	Coarse facial features
HP:0000303	Mandibular prognathia
HP:0000308	Microretrognathia
HP:0000325	Triangular face
HP:0000336	Prominent supraorbital ridges
HP:0000341	Narrow forehead
HP:0000347	Micrognathia
HP:0000349	Widow’s peak
HP:0000358	Posteriorly rotated ears
HP:0000365	Hearing impairment
HP:0000369	Low-set ears
HP:0000378	Cupped ear

GWAS associations

5 associations (top):

Study	Trait	p-value
GCST90002385_295	High light scatter reticulocyte count	1.000000e-44
GCST90002386_93	High light scatter reticulocyte percentage of red cells	6.000000e-28
GCST90002387_216	Immature fraction of reticulocytes	4.000000e-24
GCST90002405_570	Reticulocyte count	8.000000e-25
GCST90002406_519	Reticulocyte fraction of red cells	6.000000e-35

EFO canonical traits (1, from GWAS)

EFO ID	Trait name
EFO:0007986	reticulocyte count

Drugs & pharmacology

Drug and pharmacology data

Is drug target: yes

ChEMBL targets (1): CHEMBL5724625 (SINGLE PROTEIN)

Molecules with ChEMBL bioactivity

1 molecules (phase ≥1), by development phase (incl. off-target/promiscuous compounds). Patent mentions across the top 20 by phase: 1,538 (via chembl_molecule»patent_compound — counts attach to the compound, not the gene–compound relationship, so off-target/promiscuous molecules can dominate).

Molecule	Name	Phase	Patents
CHEMBL1232461	MOLIBRESIB	2	1,538

PharmGKB: 1 entry (VIP=true, CPIC=false)

ChEMBL bioactivities

1 potent at pChembl≥5 of 1 total, top 1 by pChembl (potency: 10 = 0.1 nM, 6 = 1 µM).

pChembl	Type	Value	Unit	Molecule
6.20	IC50	630	nM	MOLIBRESIB

PubChem BioAssay actives

1 with measured affinity, of 6 total; 1 most potent distinct compounds. Largely complementary to BindingDB; screening values are coarse (µM, 4 dp), so sub-nM hits tie at the floor.

Compound	Assay	Type	Value	Unit
2-[(4S)-6-(4-chlorophenyl)-8-methoxy-1-methyl-4H-[1,2,4]triazolo[4,3-a][1,4]benzodiazepin-4-yl]-N-ethylacetamide	2178640: Inhibition of MED16 (unknown origin) incubated for 1 hr by colloidal coomassie staining based LC-MS/MS analysis	ic50	0.6300	uM

CTD chemical–gene interactions

28 total (human), top 28 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
sodium arsenite	decreases expression, increases abundance, increases expression, affects cotreatment	3
Arsenic	decreases expression, increases abundance, affects methylation, affects cotreatment	2
Valproic Acid	decreases expression, increases methylation	2
dicrotophos	increases expression	1
triphenyl phosphate	affects expression	1
bisphenol A	decreases methylation	1
beta-lapachone	decreases expression	1
manganese chloride	increases abundance, affects cotreatment, decreases expression	1
beta-methylcholine	affects expression	1
CGP 52608	affects binding, increases reaction	1
4-(4-((5-(4,5-dimethyl-2-nitrophenyl)-2-furanyl)methylene)-4,5-dihydro-3-methyl-5-oxo-1H-pyrazol-1-yl)benzoic acid	increases expression	1
Vorinostat	decreases expression	1
Air Pollutants	affects expression, increases abundance	1
Hydrogen Peroxide	affects cotreatment, decreases expression	1
Ivermectin	decreases expression	1
Manganese	decreases expression, increases abundance, affects cotreatment	1
Mercury	increases expression	1
Methotrexate	affects response to substance	1
Ozone	affects expression, increases abundance	1
Smoke	decreases expression	1
Tetrachlorodibenzodioxin	increases expression	1
Dronabinol	increases expression	1
Theophylline	affects cotreatment, decreases expression	1
Thimerosal	decreases expression	1
Fenretinide	decreases expression	1
Copper Sulfate	decreases expression	1
Acrylamide	decreases expression	1
tert-Butylhydroperoxide	decreases expression	1

ChEMBL screening assays

6 unique, capped per target: 6 binding

Representative assays (with source publication via chembl_document):

Assay ID	Type	Description	Source paper
CHEMBL5697370	Binding	Inhibition of MED16 (unknown origin) assessed as fold change at 10 uM incubated for 1 hr by colloidal coomassie staining based LC-MS/MS analysis	Inhibition of BET recruitment to chromatin as an effective treatment for MLL-fusion leukaemia. — Nature

Clinical trials (associated diseases)

2 trials via MONDO — disease-level, not drug-specific.

Trial	Phase	Status	Title
NCT06310681	Not specified	COMPLETED	Pilot Testing of a Co-adapted Group Programme for Parents/Carers of Children With Complex Neurodisability
NCT07303049	Not specified	NOT_YET_RECRUITING	Cognitive Benefit of Intensive Rehabilitation Using Rhythmic Music Training in Children With Complex Neurodevelopmental Disorder