MINAR1

Summary

MINAR1 (membrane integral NOTCH2 associated receptor 1, HGNC:29172) is a protein-coding gene on chromosome 15q25.1, encoding Major intrinsically disordered Notch2-binding receptor 1 (Q9UPX6). Intrinsically disordered protein which may negatively regulate mTOR signaling pathway by stabilizing the mTOR complex component DEPTOR.

Involved in several processes, including negative regulation of TOR signaling; negative regulation of angiogenesis; and negative regulation of protein ubiquitination. Located in plasma membrane.

Source: NCBI Gene 23251 — RefSeq curated summary.

At a glance

• GWAS associations: 7
• Clinical variants (ClinVar): 184 total
• MANE Select transcript: NM_015206

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:29172
Approved symbol	MINAR1
Name	membrane integral NOTCH2 associated receptor 1
Location	15q25.1
Locus type	gene with protein product
Status	Approved
Aliases	UBTOR
Ensembl gene	ENSG00000169330
Ensembl biotype	protein_coding
OMIM	618054
Entrez	23251

Gene structure

Transcript identifiers

Ensembl transcripts: 3 — 2 protein_coding, 1 nonsense_mediated_decay

ENST00000305428, ENST00000559272, ENST00000919297

RefSeq mRNA: 1 — MANE Select: NM_015206 NM_015206

CCDS: CCDS32306

Canonical transcript exons

ENST00000305428 — 4 exons

Exon	Start	End
ENSE00001160893	79463067	79463321
ENSE00001255713	79468187	79472304
ENSE00001255719	79456098	79458445
ENSE00001292703	79432336	79432540

Expression profiles

Bgee: expression breadth ubiquitous, 157 present calls, max score 78.93.

FANTOM5 (CAGE): breadth tissue_specific, TPM avg 0.0415 / max 13.2807, expressed in 19 samples.

FANTOM5 promoters (1 alternative TSS)

Promoter ID	TPM avg	Samples expressed
147947	0.0415	19

Top tissues by expression

273 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
right adrenal gland cortex	UBERON:0035827	78.93	gold quality
left adrenal gland	UBERON:0001234	77.29	gold quality
adrenal cortex	UBERON:0001235	77.01	gold quality
right adrenal gland	UBERON:0001233	76.82	gold quality
left adrenal gland cortex	UBERON:0035825	76.67	gold quality
cerebellar cortex	UBERON:0002129	76.65	gold quality
cerebellar hemisphere	UBERON:0002245	76.58	gold quality
cerebellum	UBERON:0002037	76.32	gold quality
right hemisphere of cerebellum	UBERON:0014890	75.48	gold quality
adrenal gland	UBERON:0002369	75.32	gold quality
endothelial cell	CL:0000115	74.85	silver quality
male germ line stem cell (sensu Vertebrata) in testis	CL:0000089 ∩ UBERON:0000473	71.74	gold quality
cerebellar vermis	UBERON:0004720	71.20	gold quality
buccal mucosa cell	CL:0002336	69.72	silver quality
stromal cell of endometrium	CL:0002255	69.40	gold quality
paraflocculus	UBERON:0005351	68.76	gold quality
pigmented layer of retina	UBERON:0001782	68.66	gold quality
parotid gland	UBERON:0001831	68.01	silver quality
cortical plate	UBERON:0005343	67.61	gold quality
islet of Langerhans	UBERON:0000006	65.95	gold quality
ganglionic eminence	UBERON:0004023	64.66	gold quality
body of pancreas	UBERON:0001150	64.21	gold quality
pancreas	UBERON:0001264	64.19	gold quality
prefrontal cortex	UBERON:0000451	62.45	gold quality
bone marrow cell	CL:0002092	62.22	silver quality
C1 segment of cervical spinal cord	UBERON:0006469	62.01	gold quality
eye	UBERON:0000970	61.88	silver quality
ventricular zone	UBERON:0003053	61.70	gold quality
dorsal motor nucleus of vagus nerve	UBERON:0002870	61.64	gold quality
spinal cord	UBERON:0002240	60.89	gold quality

Single-cell (SCXA)

Detected in 1 experiment(s), a significant marker in 0.

Experiment	Marker?	Max mean expression
E-ANND-3	no	4.66

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

168 targeting MINAR1, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-4795-3P	100.00	74.62	4024
HSA-MIR-29A-3P	100.00	73.11	1835
HSA-MIR-29B-3P	100.00	73.18	1833
HSA-MIR-29C-3P	100.00	73.15	1833
HSA-MIR-3613-3P	100.00	76.36	7965
HSA-MIR-126-5P	100.00	72.71	3180
HSA-MIR-3163	100.00	77.23	8605
HSA-MIR-5692B	100.00	71.32	2622
HSA-MIR-5692C	100.00	71.32	2622
HSA-MIR-5011-5P	100.00	83.46	5820
HSA-MIR-1277-5P	100.00	73.95	5056
HSA-MIR-548C-3P	99.99	74.01	7587
HSA-MIR-196A-1-3P	99.99	72.15	2772
HSA-MIR-32-5P	99.98	75.21	1964
HSA-MIR-92A-3P	99.98	75.21	1960
HSA-MIR-92B-3P	99.98	75.25	1955
HSA-MIR-25-3P	99.98	74.60	1817
HSA-MIR-363-3P	99.98	74.72	1821
HSA-MIR-367-3P	99.98	74.83	1819
HSA-MIR-4803	99.98	71.99	3117
HSA-MIR-4482-3P	99.98	72.50	3147
HSA-MIR-3688-3P	99.97	72.02	2834
HSA-MIR-507	99.97	70.11	1915
HSA-MIR-3148	99.97	75.06	6478
HSA-MIR-3065-5P	99.97	71.56	3281
HSA-MIR-607	99.97	73.62	5593
HSA-MIR-9-3P	99.96	70.88	2068
HSA-MIR-5688	99.96	73.23	4504
HSA-MIR-495-3P	99.96	72.81	4197
HSA-MIR-1250-3P	99.96	70.04	4038

Literature-anchored findings (GeneRIF, showing 3)

• MINAR1 physically interacts with Notch2 and its binding to Notch2 increases its stability and function. While MINAR1 is highly expressed in the normal human breast, its expression is significantly downregulated in advanced human breast cancer and its re-expression in breast cancer cells inhibited tumor growth. (PMID:29329397)
• Ubtor inhibits mTOR signaling by stabilizing the mTOR complex component DEPTOR. Inhibiting Ubtor function promotes cell growth in neurons and cancer cells. Increasing Ubtor function reduces cancer cell growth. (PMID:30080879)
• Novel functional variants in the Notch pathway and survival of Chinese colorectal cancer. (PMID:33728681)

Cross-species orthologs

4 orthologs

Organism	Symbol	Gene ID
danio_rerio	si:dkey-88e18.8	ENSDARG00000100256
danio_rerio	minar1	ENSDARG00000105432
mus_musculus	Minar1	ENSMUSG00000039313
rattus_norvegicus	Minar1	ENSRNOG00000013399

Paralogs (1): MINAR2 (ENSG00000186367)

Protein

Protein identifiers

Major intrinsically disordered Notch2-binding receptor 1 — Q9UPX6 (reviewed: Q9UPX6)

Alternative names: Membrane integral NOTCH2-associated receptor 1, Ubiquitination and mTOR signaling protein

All UniProt accessions (2): H0YNN7, Q9UPX6

UniProt curated annotations — full annotation on UniProt →

Function. Intrinsically disordered protein which may negatively regulate mTOR signaling pathway by stabilizing the mTOR complex component DEPTOR. Negatively regulates angiogenesis. Negatively regulates cell growth. Negatively regulates neurite outgrowth in hippocampal neurons.

Subunit / interactions. Interacts with NOTCH2; this interaction increases MINAR1 stability. Interacts (via N-terminus) with DEPTOR (via PDZ domain); this interaction may stabilize DEPTOR protein by impairing its ubiquitination.

Subcellular location. Cell membrane.

Tissue specificity. Widely expressed, including in breast epithelial cells and endothelial cells (at protein level). Expression is down-regulated in advanced breast tumors (at protein level).

Similarity. Belongs to the MINAR family.

RefSeq proteins (1): NP_056021* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR009626	MINAR1-like_C	Domain
IPR039706	MINAR1-like	Family
IPR055117	MINAR1_N	Domain

Pfam: PF06789, PF22948

UniProt features (15 total): region of interest 5, compositionally biased region 3, topological domain 2, sequence variant 2, chain 1, modified residue 1, transmembrane region 1

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q9UPX6-F1	49.64	0.05

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Post-translational modifications (1): 711

Function

Pathways and Gene Ontology

Reactome pathways

0 pathways

MSigDB gene sets: 155 (showing top): GSE45365_NK_CELL_VS_BCELL_DN, TGGTGCT_MIR29A_MIR29B_MIR29C, AAGCAAT_MIR137, GOBP_NEGATIVE_REGULATION_OF_CELL_GROWTH, GOBP_GROWTH, GOBP_NEUROGENESIS, GOBP_NEGATIVE_REGULATION_OF_INTRACELLULAR_SIGNAL_TRANSDUCTION, GOBP_NEGATIVE_REGULATION_OF_CELLULAR_COMPONENT_ORGANIZATION, GTGCCTT_MIR506, GOBP_NEGATIVE_REGULATION_OF_MULTICELLULAR_ORGANISMAL_PROCESS, GOBP_REGULATION_OF_CELL_PROJECTION_ORGANIZATION, GOBP_NEGATIVE_REGULATION_OF_TOR_SIGNALING, TGTGTGA_MIR377, GOBP_BLOOD_VESSEL_MORPHOGENESIS, GOBP_NEGATIVE_REGULATION_OF_VASCULATURE_DEVELOPMENT

GO Biological Process (7): angiogenesis (GO:0001525), negative regulation of cell population proliferation (GO:0008285), negative regulation of neuron projection development (GO:0010977), negative regulation of angiogenesis (GO:0016525), negative regulation of cell growth (GO:0030308), negative regulation of protein ubiquitination (GO:0031397), negative regulation of TOR signaling (GO:0032007)

GO Molecular Function (1): protein binding (GO:0005515)

GO Cellular Component (3): plasma membrane (GO:0005886), endomembrane system (GO:0012505), membrane (GO:0016020)

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
negative regulation of cellular process	2
cellular anatomical structure	2
blood vessel morphogenesis	1
anatomical structure formation involved in morphogenesis	1
cell population proliferation	1
regulation of cell population proliferation	1
regulation of neuron projection development	1
neuron projection development	1
negative regulation of cell projection organization	1
angiogenesis	1
regulation of angiogenesis	1
negative regulation of blood vessel morphogenesis	1
regulation of cell growth	1
cell growth	1
negative regulation of growth	1
protein ubiquitination	1
regulation of protein ubiquitination	1
negative regulation of protein modification by small protein conjugation or removal	1
TOR signaling	1
regulation of TOR signaling	1
negative regulation of intracellular signal transduction	1
binding	1
membrane	1
cell periphery	1
vacuole	1
plasma membrane	1

Protein interactions and networks

STRING

378 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
MINAR1	KRTAP13-4	Q3LI77	515
MINAR1	DHX38	Q92620	461
MINAR1	PPIH	O43447	458
MINAR1	PPIC	P45877	457
MINAR1	TMEM41B	Q5BJD5	439
MINAR1	NOM1	Q5C9Z4	431
MINAR1	SLC8A2	Q9UPR5	400
MINAR1	PPP3R1	P06705	378
MINAR1	PPIG	Q13427	361
MINAR1	CACNB4	O00305	356
MINAR1	ELFN2	Q5R3F8	353
MINAR1	PRRC1	Q96M27	348
MINAR1	HEPACAM2	A8MVW5	344
MINAR1	MRPS24	P82668	336
MINAR1	TNIK	Q9UKE5	328

IntAct

27 interactions, top by confidence:

A	B	Type	Score
CINP	MINAR1	psi-mi:“MI:0915”(physical association)	0.560
TMEM201	MINAR1	psi-mi:“MI:0915”(physical association)	0.560
MINAR1	TRAF3IP3	psi-mi:“MI:0915”(physical association)	0.560
SEC23A	MINAR1	psi-mi:“MI:0915”(physical association)	0.560
PDCD10	MINAR1	psi-mi:“MI:0915”(physical association)	0.560
MINAR1	CERT1	psi-mi:“MI:0915”(physical association)	0.560
SEC22A	MINAR1	psi-mi:“MI:0915”(physical association)	0.560
DYRK1A	TEX13D	psi-mi:“MI:0914”(association)	0.350
CACNA1C	SYT5	psi-mi:“MI:0914”(association)	0.350
CACNA1C	IGLL5	psi-mi:“MI:0914”(association)	0.350
CACNA1C	CACNB4	psi-mi:“MI:0914”(association)	0.350
CACNA1C	DISP2	psi-mi:“MI:0914”(association)	0.350
CINP	MINAR1	psi-mi:“MI:0915”(physical association)	0.000
TMEM201	MINAR1	psi-mi:“MI:0915”(physical association)	0.000
TRAF3IP3	MINAR1	psi-mi:“MI:0915”(physical association)	0.000
SEC23A	MINAR1	psi-mi:“MI:0915”(physical association)	0.000
CERT1	MINAR1	psi-mi:“MI:0915”(physical association)	0.000
SEC22A	MINAR1	psi-mi:“MI:0915”(physical association)	0.000
PDCD10	MINAR1	psi-mi:“MI:0915”(physical association)	0.000

BioGRID (9): KIAA1024 (Affinity Capture-RNA), KIAA1024 (Two-hybrid), KIAA1024 (Two-hybrid), KIAA1024 (Two-hybrid), KIAA1024 (Two-hybrid), KIAA1024 (Two-hybrid), KIAA1024 (Two-hybrid), TMEM201 (Two-hybrid), KIAA1024 (Affinity Capture-MS)

ESM2 similar proteins: A0A087WRU1, A0JNH1, A2RUB1, A6QNQ6, B0S6S9, B1WC58, D3Z987, D3ZJ47, E1BC15, O60673, P28358, P28359, P56716, P70347, Q0P5X5, Q0VAV2, Q0VBV7, Q15468, Q2M2Z5, Q3UXL4, Q3V089, Q49A88, Q569L8, Q5BQN8, Q5CZC0, Q5QGS0, Q5T1N1, Q5VWN6, Q60988, Q61493, Q62924, Q6ZP01, Q6ZU52, Q6ZVD7, Q80U59, Q80WQ8, Q86WS4, Q86YC2, Q8CB14, Q8IUR6

Diamond homologs: A0A140LFM6, D3ZJ47, F1QEA1, P59773, Q8C4X7, Q8K3V7, Q9UPX6

SIGNOR signaling

0 interactions.

Disease & clinical

Clinical variants and AI predictions

ClinVar

184 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	166
Likely benign	9
Benign	3

Top pathogenic / likely-pathogenic (0)

SpliceAI

1451 predictions. Top by Δscore:

Variant	Effect	Δscore
15:79456082:A:AG	acceptor_gain	1.0000
15:79468386:C:G	donor_gain	1.0000
15:79432537:GGAG:G	donor_gain	0.9900
15:79432538:GAG:G	donor_gain	0.9900
15:79432538:GAGG:G	donor_gain	0.9900
15:79432539:AGG:A	donor_loss	0.9900
15:79432541:G:A	donor_loss	0.9900
15:79432541:G:GG	donor_gain	0.9900
15:79432542:T:G	donor_loss	0.9900
15:79456083:A:G	acceptor_gain	0.9900
15:79456085:A:AG	acceptor_gain	0.9900
15:79456085:ATT:A	acceptor_gain	0.9900
15:79456087:T:A	acceptor_gain	0.9900
15:79463319:CAG:C	donor_loss	0.9900
15:79463321:GGT:G	donor_loss	0.9900
15:79463322:GT:G	donor_loss	0.9900
15:79463323:T:G	donor_loss	0.9900
15:79456083:ATATT:A	acceptor_gain	0.9800
15:79456084:T:G	acceptor_gain	0.9800
15:79456086:T:G	acceptor_gain	0.9800
15:79465433:GGC:G	donor_gain	0.9800
15:79468185:A:AG	acceptor_gain	0.9800
15:79468186:G:GG	acceptor_gain	0.9800
15:79456096:A:AG	acceptor_gain	0.9700
15:79456097:G:GG	acceptor_gain	0.9700
15:79456097:GAAC:G	acceptor_gain	0.9700
15:79456097:GAACT:G	acceptor_gain	0.9700
15:79468186:GAC:G	acceptor_gain	0.9700
15:79468383:GAGC:G	donor_gain	0.9700
15:79456093:CACA:C	acceptor_loss	0.9600

AlphaMissense

6114 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
15:79456425:T:C	L93P	1.000
15:79456275:T:C	L43P	0.999
15:79456308:C:A	A54D	0.999
15:79456341:T:C	F65S	0.999
15:79457721:T:C	L525P	0.999
15:79457976:T:C	L610P	0.999
15:79468223:T:A	W864R	0.999
15:79468223:T:C	W864R	0.999
15:79456200:T:C	L18P	0.998
15:79456236:T:C	L30P	0.998
15:79456238:T:C	C31R	0.998
15:79456239:G:A	C31Y	0.998
15:79456240:C:G	C31W	0.998
15:79456248:T:C	L34P	0.998
15:79456296:T:A	L50H	0.998
15:79456296:T:C	L50P	0.998
15:79456326:T:C	F60S	0.998
15:79456340:T:C	F65L	0.998
15:79456342:C:A	F65L	0.998
15:79456342:C:G	F65L	0.998
15:79456398:C:A	A84E	0.998
15:79456400:G:C	A85P	0.998
15:79457148:T:C	L334P	0.998
15:79457702:A:C	S519R	0.998
15:79457704:T:A	S519R	0.998
15:79457704:T:G	S519R	0.998
15:79457711:T:C	F522L	0.998
15:79457712:T:C	F522S	0.998
15:79457713:C:A	F522L	0.998
15:79457713:C:G	F522L	0.998

dbSNP variants (sampled 300 via entrez): RS1000027629 (15:79420159 G>GA), RS1000043460 (15:79447201 T>C), RS1000081002 (15:79417058 G>T), RS1000138018 (15:79446866 A>G), RS1000179981 (15:79420784 T>C), RS1000233964 (15:79420536 C>G), RS1000243751 (15:79420136 A>G), RS1000286909 (15:79436482 A>C), RS1000351943 (15:79457902 C>A,G), RS1000465613 (15:79463634 T>C,G), RS1000531537 (15:79416777 C>A,T), RS1000626261 (15:79463407 G>A,T), RS1000692642 (15:79462250 AGGCAGTTATAGTTCAAAGGCGCAAATGCT>A), RS1000739885 (15:79433454 A>G), RS1000914612 (15:79469321 G>A)

Disease associations

OMIM: gene MIM:618054 | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

7 associations (top):

Study	Trait	p-value
GCST003486_6	Response to fenofibrate (LDL cholesterol levels)	5.000000e-06
GCST004070_8	Cerebrospinal P-tau181p levels	8.000000e-06
GCST009391_1453	Metabolite levels	5.000000e-06
GCST009391_1461	Metabolite levels	1.000000e-06
GCST009391_834	Metabolite levels	6.000000e-06
GCST009391_931	Metabolite levels	4.000000e-06
GCST009391_940	Metabolite levels	2.000000e-06

EFO canonical traits (7, from GWAS)

EFO ID	Trait name
EFO:0007804	LDL cholesterol change measurement
EFO:0004763	p-tau measurement
EFO:0010405	triacylglycerol 48:2 measurement
EFO:0010406	triacylglycerol 48:3 measurement
EFO:0010399	triacylglycerol 44:1 measurement
EFO:0010401	triacylglycerol 46:1 measurement
EFO:0010402	triacylglycerol 46:2 measurement

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

12 total (human), top 12 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Valproic Acid	increases methylation, affects expression	2
aristolochic acid I	decreases expression	1
FR900359	increases phosphorylation	1
2-methyl-4-isothiazolin-3-one	increases expression	1
butyraldehyde	decreases expression	1
Benzo(a)pyrene	affects methylation	1
Calcitriol	increases expression	1
Cisplatin	decreases expression	1
Hydrogen Peroxide	increases expression	1
Tobacco Smoke Pollution	increases expression	1
Cyclosporine	increases methylation	1
Aflatoxin B1	increases methylation	1

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.