MIR10396B
gene geneOn this page
Also known as hsa-mir-10396b
Summary
MIR10396B (microRNA 10396b, HGNC:54006) is a gene on chromosome 21p11.2.
microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop.
Source: NCBI Gene 113218488 — RefSeq curated summary.
Identifiers
Gene identifiers
| Field | Value |
|---|---|
| HGNC ID | HGNC:54006 |
| Approved symbol | MIR10396B |
| Name | microRNA 10396b |
| Location | 21p11.2 |
| Locus type | RNA, micro |
| Status | Approved |
| Aliases | hsa-mir-10396b |
| Entrez | 113218488 |
| RNAcentral | URS0000D53CCC — miRNA, 51 nt, 1 organism(s) |
Gene structure
Transcript identifiers
Ensembl transcripts: 0
RefSeq mRNA: 0 — MANE Select: None
Canonical transcript exons
None — 0 exons
Expression profiles
Top tissues by expression
0 total, by Bgee expression score (0-100, higher = more expressed):
Regulation
Is transcription factor: no
Cross-species orthologs
0 orthologs
Protein
Protein identifiers
Canonical reviewed UniProt: None (reviewed: )
All UniProt accessions (0):
RefSeq proteins (0): (*=MANE)
Domains & families (InterPro)
Structure
Experimental structures (PDB)
0 structures.
Predicted structure (AlphaFold)
Function
Pathways and Gene Ontology
Reactome pathways
0 pathways
MSigDB gene sets: 0 (showing top):
GO Biological Process (0):
GO Molecular Function (0):
GO Cellular Component (0):
Protein interactions and networks
STRING
0 interactions, top by confidence (×1000):
IntAct
0 interactions, top by confidence:
SIGNOR signaling
0 interactions.
Disease & clinical
Clinical variants and AI predictions
ClinVar
0 variants total. Per-class counts are floors (≥ shown; pagination cap):
| Classification | Count (floor) |
|---|---|
| Pathogenic | 0 |
| Likely pathogenic | 0 |
| Uncertain significance | 0 |
| Likely benign | 0 |
| Benign | 0 |
Top pathogenic / likely-pathogenic (0)
SpliceAI
0 predictions. Top by Δscore:
AlphaMissense
0 scored. Top likely-pathogenic:
dbSNP variants (sampled 21 via entrez): RS1555879187 (21:8435095 T>C), RS1555879191 (21:8435733 C>G), RS1555879192 (21:8436112 G>C), RS1555879194 (21:8436176 T>C), RS1555879196 (21:8436761 CGGCCCGTCCGTCCGT>C), RS1980374830 (21:8435165 C>G), RS1980374918 (21:8435166 G>T), RS1980374997 (21:8435195 TCCGGGGCCCCCGGTGGCGGGGCC>T), RS1980375090 (21:8435441 CCCGCCCG>C), RS1980375202 (21:8435559 A>G), RS1980375301 (21:8435609 TCGGTGGCGCCCCGCGTGGGGCC>T), RS1980375423 (21:8435665 C>G), RS1980375541 (21:8435671 C>CGCGT), RS1980376111 (21:8436428 C>A), RS1980376233 (21:8436521 CCG>C)
Disease associations
OMIM: gene `` | disease phenotypes:
GenCC curated gene-disease
Mondo (0):
Orphanet (0):
HPO phenotypes
0 total (0 of 0 shown, HPO-id order):
GWAS associations
0 associations (top):
Drugs & pharmacology
Drug and pharmacology data
Is drug target: no
PharmGKB: 0 entries
Clinical trials (associated diseases)
0 trials via MONDO — disease-level, not drug-specific.
Related Atlas pages
No linked Atlas pages yet — the cross-entity mesh grows as the corpus expands.