MLLT6

Summary

MLLT6 (MLLT6, PHD finger containing, HGNC:7138) is a protein-coding gene on chromosome 17q12, encoding Protein AF-17 (P55198).

Enables histone binding activity and nucleosome binding activity. Predicted to be involved in regulation of transcription by RNA polymerase II. Predicted to act upstream of or within several processes, including renal potassium excretion; renal sodium excretion; and renal water absorption. Predicted to be active in nucleus.

Source: NCBI Gene 4302 — RefSeq curated summary.

At a glance

• Clinical variants (ClinVar): 154 total
• Cancer driver (intOGen): activating (oncogene-like) across 2 cancer types
• MANE Select transcript: NM_005937

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:7138
Approved symbol	MLLT6
Name	MLLT6, PHD finger containing
Location	17q12
Locus type	gene with protein product
Status	Approved
Aliases	AF17, FLJ23480
Ensembl gene	ENSG00000275023
Ensembl biotype	protein_coding
OMIM	600328
Entrez	4302

Gene structure

Transcript identifiers

Ensembl transcripts: 12 — 6 retained_intron, 4 protein_coding, 2 protein_coding_CDS_not_defined

ENST00000611305, ENST00000612066, ENST00000614769, ENST00000615441, ENST00000615741, ENST00000615858, ENST00000618652, ENST00000619356, ENST00000620482, ENST00000620609, ENST00000621332, ENST00000878034

RefSeq mRNA: 1 — MANE Select: NM_005937 NM_005937

CCDS: CCDS11327

Canonical transcript exons

ENST00000618876 — 0 exons

Expression profiles

Bgee: expression breadth ubiquitous, 134 present calls, max score 99.05.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 21.8417 / max 359.4730, expressed in 1814 samples.

FANTOM5 promoters (6 alternative TSS)

Promoter ID	TPM avg	Samples expressed
160509	10.4441	1756
160508	6.5761	1521
160510	2.6754	943
160511	1.2909	553
160513	0.5770	322
160512	0.2780	134

Top tissues by expression

134 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
right uterine tube	UBERON:0001302	99.05	gold quality
pituitary gland	UBERON:0000007	98.40	gold quality
left ovary	UBERON:0002119	98.23	gold quality
right lobe of thyroid gland	UBERON:0001119	98.16	gold quality
right ovary	UBERON:0002118	98.14	gold quality
granulocyte	CL:0000094	98.08	gold quality
ovary	UBERON:0000992	98.06	gold quality
sural nerve	UBERON:0015488	98.06	gold quality
adenohypophysis	UBERON:0002196	97.98	gold quality
thyroid gland	UBERON:0002046	97.77	gold quality
left lobe of thyroid gland	UBERON:0001120	97.73	gold quality
colonic epithelium	UBERON:0000397	97.25	gold quality
vermiform appendix	UBERON:0001154	97.25	gold quality
endocervix	UBERON:0000458	97.24	gold quality
right hemisphere of cerebellum	UBERON:0014890	97.21	gold quality
body of uterus	UBERON:0009853	97.20	gold quality
metanephros cortex	UBERON:0010533	97.16	gold quality
fundus of stomach	UBERON:0001160	96.88	gold quality
cerebellar hemisphere	UBERON:0002245	96.88	gold quality
cerebellum	UBERON:0002037	96.85	gold quality
skeletal muscle tissue	UBERON:0001134	96.84	gold quality
cerebellar cortex	UBERON:0002129	96.84	gold quality
tonsil	UBERON:0002372	96.84	gold quality
apex of heart	UBERON:0002098	96.75	gold quality
uterine cervix	UBERON:0000002	96.70	gold quality
spleen	UBERON:0002106	96.65	gold quality
lymph node	UBERON:0000029	96.61	gold quality
body of pancreas	UBERON:0001150	96.55	gold quality
tibial nerve	UBERON:0001323	96.54	gold quality
fallopian tube	UBERON:0003889	96.50	gold quality

Single-cell (SCXA)

Detected in 2 experiment(s), a significant marker in 0.

Experiment	Marker?	Max mean expression
E-GEOD-150728	no	224.70
E-ANND-3	no	1.99

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

267 targeting MLLT6, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-8485	100.00	77.57	4731
HSA-LET-7A-3P	100.00	74.03	3932
HSA-LET-7B-3P	100.00	74.08	3913
HSA-LET-7F-1-3P	100.00	74.02	3928
HSA-MIR-98-3P	100.00	74.08	3907
HSA-MIR-4425	100.00	67.59	1049
HSA-MIR-4455	100.00	65.48	1587
HSA-MIR-4510	100.00	66.60	2050
HSA-MIR-6127	100.00	66.76	2188
HSA-MIR-6129	100.00	66.46	2080
HSA-MIR-6130	100.00	66.69	2012
HSA-MIR-6133	100.00	66.48	2064
HSA-MIR-4476	100.00	68.18	2030
HSA-MIR-6876-5P	100.00	67.68	2126
HSA-MIR-6851-5P	100.00	65.63	1294
HSA-MIR-4673	100.00	66.64	1490
HSA-MIR-4692	100.00	67.32	2066
HSA-MIR-4283	100.00	66.42	2097
HSA-MIR-656-3P	100.00	72.15	2788
HSA-MIR-4747-5P	100.00	67.90	2681
HSA-MIR-5196-5P	100.00	67.98	2761
HSA-MIR-3667-3P	99.99	67.17	1636
HSA-MIR-6870-5P	99.99	68.55	2115
HSA-MIR-4514	99.99	67.10	1870
HSA-MIR-4531	99.99	69.70	3181
HSA-MIR-520D-5P	99.98	73.34	4883
HSA-MIR-524-5P	99.98	73.43	4882
HSA-MIR-19A-3P	99.98	75.33	2762
HSA-MIR-19B-3P	99.98	75.44	2754
HSA-MIR-12136	99.98	72.81	5713

Literature-anchored findings (GeneRIF, showing 3)

• In the Acute Myeloid Leukemia patients, detected MLL rearrangements consisting of MLL/AF6, MLL/AF9, MLL/AF17 , MLL/ELL and MLL partial tandem duplication. MLL rearrangement include chromosome translocation and partial tandem duplication. (PMID:16086288)
• AF17 competes with AF9 to bind Dot1a, decreases Dot1a nuclear expression by possibly facilitating its nuclear export, and relieves Dot1a.AF9-mediated repression of alpha-ENaC and other target genes. (PMID:19864429)
• MLLT6 maintains PD-L1 expression and mediates tumor immune resistance. (PMID:33063451)

Cross-species orthologs

3 orthologs

Organism	Symbol	Gene ID
mus_musculus	Mllt6	ENSMUSG00000038437
rattus_norvegicus	Mllt6	ENSRNOG00000053285
caenorhabditis_elegans		WBGENE00021810

Paralogs (8): JADE2 (ENSG00000043143), JADE1 (ENSG00000077684), MLLT10 (ENSG00000078403), BRPF3 (ENSG00000096070), BRD1 (ENSG00000100425), JADE3 (ENSG00000102221), PHF14 (ENSG00000106443), BRPF1 (ENSG00000156983)

Protein

Protein identifiers

Protein AF-17 — P55198 (reviewed: P55198)

Alternative names: ALL1-fused gene from chromosome 17 protein

All UniProt accessions (3): P55198, A0A087WVY1, Q6P2C6

UniProt curated annotations — full annotation on UniProt →

Subunit / interactions. Interacts with histone H3; interaction is necessary for MLLT6 binding to nucleosomes; interaction is inhibited by histone H3 ‘Lys-27’ methylations (H3K27me1, H3K27me2 and H3K27me3).

Subcellular location. Nucleus.

Disease relevance. A chromosomal aberration involving MLLT6 is associated with acute leukemias. Translocation t(11;17)(q23;q21) with KMT2A/MLL1. The result is a rogue activator protein.

RefSeq proteins (1): NP_005928* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR001965	Znf_PHD	Domain
IPR011011	Znf_FYVE_PHD	Homologous_superfamily
IPR013083	Znf_RING/FYVE/PHD	Homologous_superfamily
IPR019786	Zinc_finger_PHD-type_CS	Conserved_site
IPR019787	Znf_PHD-finger	Domain
IPR034732	EPHD	Domain
IPR049781	AF10/AF17_PHD	Domain
IPR050701	Histone_Mod_Regulator	Family

Pfam: PF13831, PF13832

UniProt features (32 total): compositionally biased region 14, modified residue 4, region of interest 4, zinc finger region 3, sequence conflict 3, sequence variant 2, chain 1, site 1

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-P55198-F1	51.40	0.17

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Catalytic / active sites (1): 551 (kmt2a/mll1 fusion point (in acute myeloid leukemia patient))

Post-translational modifications (4): 258, 378, 423, 451

Function

Pathways and Gene Ontology

Reactome pathways

0 pathways

MSigDB gene sets: 296 (showing top): CREL_01, GOBP_EXCRETION, FREAC2_01, MIDORIKAWA_AMPLIFIED_IN_LIVER_CANCER, RORA1_01, GCANCTGNY_MYOD_Q6, STARK_PREFRONTAL_CORTEX_22Q11_DELETION_DN, TGACCTY_ERR1_Q2, GOBP_POSITIVE_REGULATION_OF_SODIUM_ION_TRANSPORT, CACCAGC_MIR138, GGGTGGRR_PAX4_03, GOBP_MONOATOMIC_CATION_TRANSPORT, MONNIER_POSTRADIATION_TUMOR_ESCAPE_UP, AACWWCAANK_UNKNOWN, GOBP_REGULATION_OF_SODIUM_ION_TRANSPORT

GO Biological Process (10): chromatin organization (GO:0006325), regulation of DNA-templated transcription (GO:0006355), regulation of transcription by RNA polymerase II (GO:0006357), positive regulation of sodium ion transport (GO:0010765), negative regulation of urine volume (GO:0035811), renal sodium excretion (GO:0035812), renal potassium excretion (GO:0036359), positive regulation of transcription by RNA polymerase II (GO:0045944), renal water absorption (GO:0070295), renal system process (GO:0003014)

GO Molecular Function (5): zinc ion binding (GO:0008270), nucleosome binding (GO:0031491), histone binding (GO:0042393), protein binding (GO:0005515), metal ion binding (GO:0046872)

GO Cellular Component (1): nucleus (GO:0005634)

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
transcription by RNA polymerase II	2
renal tubular secretion	2
cellular component organization	1
DNA-templated transcription	1
regulation of gene expression	1
regulation of RNA biosynthetic process	1
regulation of DNA-templated transcription	1
regulation of sodium ion transport	1
sodium ion transport	1
positive regulation of monoatomic ion transport	1
regulation of urine volume	1
sodium ion homeostasis	1
regulation of transcription by RNA polymerase II	1
positive regulation of DNA-templated transcription	1
renal water transport	1
renal absorption	1
system process	1
transition metal ion binding	1
chromatin binding	1
protein-containing complex binding	1
protein binding	1
binding	1
cation binding	1
intracellular membrane-bounded organelle	1

Protein interactions and networks

STRING

718 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
MLLT6	MLLT3	P42568	965
MLLT6	MLLT1	Q03111	949
MLLT6	MLLT10	P55197	936
MLLT6	AFF1	P51825	861
MLLT6	ELL	P55199	831
MLLT6	DOT1L	Q8TEK3	819
MLLT6	LASP1	Q14847	798
MLLT6	KMT2A	Q03164	781
MLLT6	AFDN	P55196	778
MLLT6	SEPTIN6	Q14141	742
MLLT6	TRAF4	Q9BUZ4	711
MLLT6	CLP1	Q92989	669
MLLT6	AFF4	Q9UHB7	655
MLLT6	MLLT11	Q13015	621
MLLT6	FNBP1	Q96RU3	615

IntAct

60 interactions, top by confidence:

A	B	Type	Score
DOT1L	MLLT3	psi-mi:“MI:0914”(association)	0.820
CEBPG	MLLT6	psi-mi:“MI:0915”(physical association)	0.660
MLLT6	UBQLN1	psi-mi:“MI:0915”(physical association)	0.560
UBQLN1	MLLT6	psi-mi:“MI:0915”(physical association)	0.560
MLLT6	ZMYND19	psi-mi:“MI:0915”(physical association)	0.560
MLLT6	TLE5	psi-mi:“MI:0915”(physical association)	0.560
MLLT6	GRIPAP1	psi-mi:“MI:0915”(physical association)	0.560
PHC2	MLLT6	psi-mi:“MI:0915”(physical association)	0.560
MLLT6	PIN1	psi-mi:“MI:0915”(physical association)	0.560
MLLT6	CREB5	psi-mi:“MI:0915”(physical association)	0.560
MLLT6	ATXN10	psi-mi:“MI:0915”(physical association)	0.560
MLLT6	RGPD8	psi-mi:“MI:0914”(association)	0.530
DAXX	TNRC18	psi-mi:“MI:0914”(association)	0.530
UBQLN4	MLLT6	psi-mi:“MI:0915”(physical association)	0.510
EPS15	MLLT6	psi-mi:“MI:0407”(direct interaction)	0.440
MLLT6	H2BC12L	psi-mi:“MI:0915”(physical association)	0.400
UBE2G2	MLLT6	psi-mi:“MI:0915”(physical association)	0.370
CASK	MLLT6	psi-mi:“MI:0915”(physical association)	0.370
MLLT6	MED15	psi-mi:“MI:0915”(physical association)	0.370
RPL10	RPS6	psi-mi:“MI:0914”(association)	0.350
DOT1L	IBTK	psi-mi:“MI:0914”(association)	0.350
NOP56	C12orf43	psi-mi:“MI:0914”(association)	0.350
Mllt1	ELL2	psi-mi:“MI:0914”(association)	0.350
YEATS4	ING3	psi-mi:“MI:0914”(association)	0.350
NCBP3	RSL1D1	psi-mi:“MI:0914”(association)	0.350

BioGRID (145): MLLT6 (Two-hybrid), MLLT6 (Two-hybrid), TCF4 (Two-hybrid), TCF12 (Two-hybrid), ZBTB22 (Two-hybrid), SPRY2 (Two-hybrid), ENOX2 (Two-hybrid), UBQLN1 (Two-hybrid), WHSC1L1 (Two-hybrid), CEP44 (Two-hybrid), KRTAP10-8 (Two-hybrid), MLLT6 (Two-hybrid), MED15 (Two-hybrid), MLLT6 (Affinity Capture-RNA), MLLT6 (Co-fractionation)

ESM2 similar proteins: A2A5E6, A5PK23, A6NKF2, A6PWV5, B0K011, E9Q6W4, O02786, O95402, P09086, P13297, P55198, Q00196, Q08DS3, Q0VDQ9, Q29013, Q2NKI2, Q2VL80, Q2VL82, Q2VL83, Q2VL85, Q2VL86, Q569K4, Q5XI28, Q62255, Q66K41, Q6AXX3, Q6PBT9, Q86V15, Q8BXJ8, Q8IVH2, Q8K4J6, Q8TAX0, Q8VD12, Q8VDL9, Q8WUU4, Q92766, Q969V6, Q96PM9, Q9BXA9, Q9BZE0

Diamond homologs: A0A286Y9D1, A1YVX4, A7E320, B2KF05, B2RRD7, B6CHA3, F4KBP5, F6UA42, G5E8P1, G5EBZ4, O54826, O75164, O94880, O94953, P0CB22, P29375, P34447, P41229, P41230, P47156, P55197, P55198, P55201, Q0P4S5, Q12311, Q20318, Q22516, Q29EQ3, Q30DN6, Q38JA7, Q3UXZ9, Q5E9T7, Q5RD88, Q5TKR9, Q62240, Q6GQJ2, Q6IE81, Q6IE82, Q6IQX0, Q6K431

SIGNOR signaling

0 interactions.

Disease & clinical

Cancer significance

From intOGen — cancer-driver classification: activating (oncogene-like) across 2 cancer types — PGNG, UTUC.

Clinical variants and AI predictions

ClinVar

154 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	125
Likely benign	2
Benign	2

Top pathogenic / likely-pathogenic (0)

SpliceAI

3941 predictions. Top by Δscore:

Variant	Effect	Δscore
17:38705738:CAAGG:C	donor_loss	1.0000
17:38705739:AAGG:A	donor_loss	1.0000
17:38705740:AGG:A	donor_loss	1.0000
17:38705742:GTAC:G	donor_loss	1.0000
17:38705743:T:A	donor_loss	1.0000
17:38709480:A:AG	acceptor_gain	1.0000
17:38709481:G:GG	acceptor_gain	1.0000
17:38709481:GT:G	acceptor_gain	1.0000
17:38709572:GATG:G	donor_gain	1.0000
17:38712689:A:AG	acceptor_gain	1.0000
17:38712690:G:GG	acceptor_gain	1.0000
17:38712690:G:GT	acceptor_loss	1.0000
17:38712690:GA:G	acceptor_gain	1.0000
17:38712690:GAGTC:G	acceptor_gain	1.0000
17:38712787:AAG:A	donor_loss	1.0000
17:38712788:AGGT:A	donor_loss	1.0000
17:38712791:T:G	donor_loss	1.0000
17:38715608:TCA:T	acceptor_loss	1.0000
17:38715610:A:T	acceptor_loss	1.0000
17:38715611:G:GA	acceptor_loss	1.0000
17:38715680:G:GT	donor_gain	1.0000
17:38715728:G:T	donor_gain	1.0000
17:38716365:A:AG	acceptor_gain	1.0000
17:38716366:G:GA	acceptor_gain	1.0000
17:38716366:GTCTC:G	acceptor_gain	1.0000
17:38716792:G:GT	donor_gain	1.0000
17:38719514:A:AG	acceptor_gain	1.0000
17:38719515:A:G	acceptor_gain	1.0000
17:38719590:G:T	donor_gain	1.0000
17:38719896:G:GG	donor_gain	1.0000

AlphaMissense

0 scored. Top likely-pathogenic:

dbSNP variants (sampled 300 via entrez): RS1000002940 (17:38703962 A>T), RS1000007336 (17:38722027 C>T), RS1000096086 (17:38714429 A>G), RS1000192790 (17:38703913 C>G,T), RS1000297533 (17:38726354 AGTGTGTGTGTGCGTGCATGTGTGT>A), RS1000456063 (17:38710650 A>G), RS1000480984 (17:38725813 C>T), RS1000748369 (17:38705205 G>A,C), RS1000788712 (17:38705055 G>A), RS1000921595 (17:38721673 C>G,T), RS1001059196 (17:38717138 C>T), RS1001087195 (17:38727050 G>C), RS1001344258 (17:38706136 G>A), RS1001359939 (17:38715330 A>G), RS1001450172 (17:38723158 T>C)

Disease associations

OMIM: gene MIM:600328 | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

0 associations (top):

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

35 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Valproic Acid	affects cotreatment, decreases expression	4
sodium arsenite	decreases expression	2
Acetaminophen	decreases expression, affects response to substance	2
FR900359	increases phosphorylation	1
dicrotophos	increases expression	1
triphenyl phosphate	affects expression	1
trichostatin A	affects expression	1
beta-lapachone	increases expression	1
tris(1,3-dichloro-2-propyl)phosphate	decreases expression	1
butyraldehyde	decreases expression	1
coumarin	decreases phosphorylation	1
S-(1,2-dichlorovinyl)cysteine	affects response to substance, increases expression	1
perfluorooctane sulfonic acid	increases expression	1
4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	affects cotreatment, decreases expression	1
ICG 001	increases expression	1
dorsomorphin	decreases expression, affects cotreatment	1
(+)-JQ1 compound	decreases expression	1
Resveratrol	decreases expression, affects cotreatment	1
Air Pollutants	increases abundance, increases expression	1
Arsenic	affects methylation	1
Atrazine	decreases expression	1
Benzo(a)pyrene	decreases methylation	1
Caffeine	affects phosphorylation	1
Cisplatin	decreases expression	1
Enzyme Inhibitors	decreases activity, increases O-linked glycosylation	1
Lipopolysaccharides	increases expression, affects response to substance	1
Methylcholanthrene	affects binding, increases reaction	1
Plant Extracts	affects cotreatment, decreases expression	1
Smoke	decreases expression	1
Thiram	decreases expression	1

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.