MPC2

Summary

MPC2 (mitochondrial pyruvate carrier 2, HGNC:24515) is a protein-coding gene on chromosome 1q24.2, encoding Mitochondrial pyruvate carrier 2 (O95563). Mediates the uptake of pyruvate into mitochondria to maintain the balance between glycolysis and oxidative phosphorylation.

Enables identical protein binding activity. Involved in pyruvate import into mitochondria. Located in mitochondrial inner membrane. Part of mitochondrial pyruvate carrier complex.

Source: NCBI Gene 25874 — automated summary from GO annotations (Alliance of Genome Resources).

At a glance

• Gene–disease (curated): mitochondrial pyruvate carrier deficiency (Moderate, GenCC) — +1 more curated relationship
• GWAS associations: 1
• GTEx eGene: eQTL in 38 tissues, sQTL in 1 (q < 0.05)
• ChEMBL bioactivity: 1 clinical-phase molecule tested; no curated mechanism-of-action drug
• Constraint (gnomAD): pLI 0.09 (LoF-tolerant), LOEUF 1.15 (unconstrained)
• MANE Select transcript: NM_001143674

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:24515
Approved symbol	MPC2
Name	mitochondrial pyruvate carrier 2
Location	1q24.2
Locus type	gene with protein product
Status	Approved
Aliases	DKFZP564B167, SLC54A2
Ensembl gene	ENSG00000143158
Ensembl biotype	protein_coding
OMIM	614737
Entrez	25874

Gene structure

Transcript identifiers

Ensembl transcripts: 21 — 19 protein_coding, 2 nonsense_mediated_decay

MANE Select: ENST00000271373

Transcript support level (Ensembl TSL; 1 = fully mRNA-supported): TSL 1: 2, TSL 5: 1

ENST00000271373, ENST00000367846, ENST00000458574, ENST00000856458, ENST00000856459, ENST00000856460, ENST00000856461, ENST00000856462, ENST00000856463, ENST00000936468, ENST00000936469, ENST00000936470, ENST00000936471, ENST00001000315, ENST00001000316, ENST00001000319, ENST00001000321, ENST00001045965, ENST00001093569, ENST00001093570, ENST00001141837

RefSeq mRNA: 2 — MANE Select: NM_001143674 NM_001143674, NM_015415

CCDS: CCDS1266

Canonical transcript exons

ENST00000271373 — 6 exons

Exon	Start	End
ENSE00000958426	167924497	167924537
ENSE00000958427	167920547	167920631
ENSE00000958428	167919979	167920090
ENSE00001445754	167935733	167935898
ENSE00001445755	167936939	167937072
ENSE00004799715	167916675	167918359

Expression profiles

Bgee: expression breadth ubiquitous, 298 present calls, max score 98.55.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 46.2289 / max 592.7257, expressed in 1825 samples.

Highest expression (Bgee): sperm, adult organism, male germ cell, diaphragm, testis.

Genetic regulation across tissues (GTEx eQTL / sQTL)

MPC2 is an eGene in GTEx v10 — its expression is genetically regulated (eQTL) in 38 tissues and its splicing (sQTL) in 1 (q < 0.05). Strongest associations first; slope = normalized effect of the lead variant’s alternative allele.

showing 20 of 39 significant tissue × QTL associations:

Tissue	QTL	q-value	Slope	Lead variant
Stomach	eqtl	6.8e-20	-0.26	1:167995478:A:G
Esophagus Muscularis	eqtl	1.8e-16	-0.27	1:167918178:C:T
Artery Tibial	eqtl	2.2e-13	-0.25	1:167916557:CAGAAA:C
Cells Cultured fibroblasts	eqtl	3.6e-13	+0.31	1:167792213:G:C
Thyroid	eqtl	4.3e-12	-0.31	1:167918178:C:T
Brain Hippocampus	eqtl	1.9e-11	-0.32	1:167974293:C:T
Esophagus Gastroesophageal Junction	eqtl	2.1e-10	-0.30	1:167980987:C:A
Lung	eqtl	1.9e-09	-0.34	1:168101081:C:T
Colon Transverse	eqtl	3.5e-09	-0.19	1:167951388:C:A
Brain Frontal Cortex BA9	eqtl	1.9e-08	-0.27	1:167953615:C:T
Artery Aorta	eqtl	1.0e-07	-0.28	1:167902981:A:G
Colon Sigmoid	eqtl	1.0e-07	-0.30	1:167973757:C:CCTT
Heart Left Ventricle	eqtl	3.3e-07	-0.19	1:167951388:C:A
Brain Nucleus accumbens basal ganglia	eqtl	6.4e-07	-0.28	1:167942231:ATGT:A
Adipose Visceral Omentum	eqtl	7.0e-07	-0.21	1:167908455:C:A
Brain Cerebellar Hemisphere	eqtl	7.5e-07	-0.25	1:167909383:C:T
Brain Caudate basal ganglia	eqtl	8.2e-07	-0.23	1:167990213:A:T
Muscle Skeletal	eqtl	9.3e-07	-0.17	1:168009843:T:TTTTTTTCACTTTTGATTGATTGTTTATAACA
Brain Putamen basal ganglia	eqtl	1.0e-06	-0.28	1:167990213:A:T
Spleen	eqtl	2.2e-06	-0.41	1:168101081:C:T

FANTOM5 promoters

showing 10 of 15 alternative TSS:

Promoter ID	TPM avg	Samples expressed
15797	41.7698	1823
15798	1.0820	677
15796	0.6704	392
15810	0.5977	210
15802	0.4227	232
15808	0.3950	49
15799	0.2596	104
15806	0.2085	48
15800	0.2063	79
15803	0.1764	74

Top tissues by expression

showing 100 of 299 tissues by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
sperm	CL:0000019	98.55	gold quality
adult organism	UBERON:0007023	98.47	gold quality
male germ cell	CL:0000015	98.37	gold quality
diaphragm	UBERON:0001103	97.97	gold quality
left testis	UBERON:0004533	97.72	gold quality
right testis	UBERON:0004534	97.52	gold quality
heart right ventricle	UBERON:0002080	97.48	gold quality
renal medulla	UBERON:0000362	97.46	gold quality
mucosa of sigmoid colon	UBERON:0004993	97.03	gold quality
skeletal muscle tissue of rectus abdominis	UBERON:0004511	97.01	gold quality
left ventricle myocardium	UBERON:0006566	96.87	gold quality
liver	UBERON:0002107	96.78	gold quality
colonic mucosa	UBERON:0000317	96.75	gold quality
jejunal mucosa	UBERON:0000399	96.58	gold quality
right lobe of liver	UBERON:0001114	96.53	gold quality
adult mammalian kidney	UBERON:0000082	96.45	gold quality
testis	UBERON:0000473	96.43	gold quality
body of tongue	UBERON:0011876	96.37	gold quality
triceps brachii	UBERON:0001509	96.31	gold quality
jejunum	UBERON:0002115	96.21	gold quality
cardiac ventricle	UBERON:0002082	96.18	gold quality
heart left ventricle	UBERON:0002084	96.16	gold quality
biceps brachii	UBERON:0001507	95.98	gold quality
skeletal muscle tissue	UBERON:0001134	95.92	gold quality
vastus lateralis	UBERON:0001379	95.92	gold quality
hindlimb stylopod muscle	UBERON:0004252	95.88	gold quality
nephron tubule	UBERON:0001231	95.81	gold quality
skeletal muscle tissue of biceps brachii	UBERON:0004502	95.67	gold quality
vena cava	UBERON:0004087	95.64	gold quality
quadriceps femoris	UBERON:0001377	95.61	gold quality
duodenum	UBERON:0002114	95.57	gold quality
mucosa of transverse colon	UBERON:0004991	95.52	gold quality
myocardium	UBERON:0002349	95.44	gold quality
cardia of stomach	UBERON:0001162	95.40	gold quality
kidney	UBERON:0002113	95.33	gold quality
deltoid	UBERON:0001476	95.30	gold quality
palpebral conjunctiva	UBERON:0001812	95.27	gold quality
muscle tissue	UBERON:0002385	95.27	gold quality
muscle organ	UBERON:0001630	95.20	gold quality
heart	UBERON:0000948	95.16	gold quality
gastrocnemius	UBERON:0001388	95.10	gold quality
upper leg skin	UBERON:0004262	95.08	gold quality
body of stomach	UBERON:0001161	94.99	gold quality
pylorus	UBERON:0001166	94.96	gold quality
right atrium auricular region	UBERON:0006631	94.94	gold quality
muscle of leg	UBERON:0001383	94.92	gold quality
parotid gland	UBERON:0001831	94.92	gold quality
cardiac atrium	UBERON:0002081	94.87	gold quality
prefrontal cortex	UBERON:0000451	94.81	gold quality
bronchial epithelial cell	CL:0002328	94.62	gold quality
tongue	UBERON:0001723	94.55	gold quality
primordial germ cell in gonad	CL:0000670 ∩ UBERON:0000991	94.45	gold quality
gluteal muscle	UBERON:0002000	94.42	gold quality
lateral nuclear group of thalamus	UBERON:0002736	94.41	gold quality
epithelium of bronchus	UBERON:0002031	94.32	gold quality
metanephros cortex	UBERON:0010533	94.32	gold quality
medial globus pallidus	UBERON:0002477	94.25	gold quality
dorsolateral prefrontal cortex	UBERON:0009834	94.23	gold quality
bronchus	UBERON:0002185	94.22	gold quality
Brodmann (1909) area 9	UBERON:0013540	94.14	gold quality
olfactory segment of nasal mucosa	UBERON:0005386	93.98	gold quality
eye	UBERON:0000970	93.94	gold quality
superior surface of tongue	UBERON:0007371	93.93	gold quality
right adrenal gland	UBERON:0001233	93.87	gold quality
apex of heart	UBERON:0002098	93.79	gold quality
right adrenal gland cortex	UBERON:0035827	93.74	gold quality
kidney epithelium	UBERON:0004819	93.64	gold quality
trabecular bone tissue	UBERON:0002483	93.63	gold quality
globus pallidus	UBERON:0001875	93.61	gold quality
frontal cortex	UBERON:0001870	93.53	gold quality
cingulate cortex	UBERON:0003027	93.53	gold quality
frontal lobe	UBERON:0016525	93.53	gold quality
bone marrow	UBERON:0002371	93.52	gold quality
cardiac muscle of right atrium	UBERON:0003379	93.52	gold quality
tibialis anterior	UBERON:0001385	93.50	gold quality
stomach	UBERON:0000945	93.47	gold quality
left adrenal gland	UBERON:0001234	93.45	gold quality
bone element	UBERON:0001474	93.45	gold quality
anterior cingulate cortex	UBERON:0009835	93.42	gold quality
mammalian vulva	UBERON:0000997	93.40	gold quality
metanephros	UBERON:0000081	93.38	gold quality
neocortex	UBERON:0001950	93.31	gold quality
nucleus accumbens	UBERON:0001882	93.30	gold quality
amygdala	UBERON:0001876	93.29	gold quality
prostate gland	UBERON:0002367	93.23	gold quality
trachea	UBERON:0003126	93.19	gold quality
adrenal cortex	UBERON:0001235	93.13	gold quality
left adrenal gland cortex	UBERON:0035825	93.11	gold quality
adrenal tissue	UBERON:0018303	93.10	gold quality
cortex of kidney	UBERON:0001225	93.07	gold quality
putamen	UBERON:0001874	93.05	gold quality
caudate nucleus	UBERON:0001873	93.03	gold quality
right frontal lobe	UBERON:0002810	93.00	gold quality
cerebral cortex	UBERON:0000956	92.93	gold quality
synovial joint	UBERON:0002217	92.93	gold quality
telencephalon	UBERON:0001893	92.86	gold quality
parietal pleura	UBERON:0002400	92.84	gold quality
rectum	UBERON:0001052	92.83	gold quality
penis	UBERON:0000989	92.80	gold quality
forebrain	UBERON:0001890	92.77	gold quality

Single-cell (SCXA)

Detected in 17 experiment(s), a significant marker in 16.

Experiment	Marker?	Max mean expression
E-GEOD-114530	yes	1351.37
E-HCAD-10	yes	1071.58
E-GEOD-124472	yes	838.18
E-HCAD-4	yes	159.71
E-MTAB-6701	yes	114.12
E-HCAD-6	yes	67.16
E-GEOD-134144	yes	30.88
E-HCAD-31	yes	28.46
E-MTAB-5061	yes	27.36
E-CURD-122	yes	19.41
E-MTAB-10553	yes	18.58
E-MTAB-9388	yes	12.66
E-HCAD-1	yes	9.46
E-HCAD-9	yes	9.21
E-HCAD-13	yes	7.01

HPA expression

RNA tissue specificity: Low tissue specificity

showing 60 of 79 HPA tissues / cells by nTPM:

Tissue / cell	Axis	nTPM	Protein (IHC)
Liver	tissue	142.4	medium
Skeletal muscle	tissue	96.3	not detected
Kidney	tissue	74.4	medium
Testis	tissue	69.8	medium
Frontal cortex	tissue	67.6
Heart muscle	tissue	62.4	medium
Tongue	tissue	62.1
Bone marrow	tissue	59.6	not detected
Prostate	tissue	51.5	low
Caudate putamen	tissue	47.8
Cerebellum	tissue	45.3	medium
Duodenum	tissue	45.0	medium
Postcentral gyrus	tissue	44.7
Cerebral cortex	tissue	42.4	medium
Occipital cortex	tissue	42.4
Choroid plexus	tissue	41.7
Putamen	tissue	41.5
Olfactory bulb	tissue	41.3
Retrosplenial cortex	tissue	41.1
Somatosensory cortex	tissue	40.9
Retrosplenial and cingulate cortex	tissue	40.8
Small intestine	tissue	40.7	medium
Colon	tissue	40.6	medium
Corpus callosum	tissue	40.2
Motor cortex	tissue	39.8
Insular cortex	tissue	39.5
Temporal cortex	tissue	39.4
Hippocampal formation	tissue	38.9
Entorhinal cortex	tissue	38.9
Ventral forebrain	tissue	38.3
Prefrontal cortex	tissue	38.1
Superior colliculi	tissue	38.1
Thalamus	tissue	37.8
Basal ganglia	tissue	37.6	medium
Midbrain	tissue	37.6
Nucleus accumbens	tissue	37.4
Amygdala	tissue	37.0
Septum	tissue	35.8
Pons	tissue	35.3
Medulla oblongata	tissue	35.2
Locus coeruleus	tissue	35.1
Stomach 1	tissue	35.0	medium
Periaqueductal gray	tissue	34.7
Pituitary gland	tissue	34.4
Hippocampus	tissue	33.9	medium
Parathyroid gland	tissue	33.4	medium
Substantia nigra	tissue	33.1
Hypothalamus	tissue	31.7
Rectum	tissue	31.6	medium
Spinal cord	tissue	30.8
Breast	tissue	30.3	low
Adrenal gland	tissue	28.7	medium
Salivary gland	tissue	27.6	low
Retina	tissue	26.3
Adipose tissue	tissue	24.1	not detected
Pancreas	tissue	21.0	medium
Ovary	tissue	19.8	low
Thymus	tissue	18.7
Gallbladder	tissue	18.4	medium
Vagina	tissue	17.1	not detected

Brain sub-regions (HPA Brain Atlas): detected in 192; highest nTPM — Temporal pole (47.8), Precentral gyrus, middle (47.7), Nucleus of the diagonal band (45.1), Perirhinal gyrus (44.6), Paracentral lobule, anterior (43.9).

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

Targeting MPC2 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific).

showing 30 of 56 miRNAs:

miRNA	Max score	Avg score	miRNA target_count
HSA-LET-7A-3P	100.00	74.03	3932
HSA-LET-7B-3P	100.00	74.08	3913
HSA-LET-7F-1-3P	100.00	74.02	3928
HSA-MIR-98-3P	100.00	74.08	3907
HSA-MIR-3120-5P	100.00	65.56	965
HSA-MIR-3613-3P	100.00	76.36	7965
HSA-MIR-8485	100.00	77.57	4731
HSA-MIR-4455	100.00	65.48	1587
HSA-MIR-3924	100.00	72.09	2394
HSA-MIR-371B-5P	99.99	75.34	4759
HSA-MIR-373-5P	99.98	75.36	4753
HSA-MIR-616-5P	99.98	75.58	4775
HSA-MIR-4482-3P	99.98	72.50	3147
HSA-MIR-302C-5P	99.97	72.56	3642
HSA-MIR-545-3P	99.95	70.74	2783
HSA-MIR-4496	99.88	68.89	2236
HSA-MIR-5010-3P	99.83	70.60	2357
HSA-MIR-4307	99.82	70.45	3374
HSA-MIR-370-5P	99.78	66.81	706
HSA-MIR-33A-3P	99.70	70.27	3362
HSA-MIR-5580-3P	99.70	69.41	2052
HSA-MIR-4729	99.69	72.18	4233
HSA-MIR-1283	99.69	72.42	3009
HSA-MIR-3934-5P	99.67	64.04	846
HSA-MIR-4804-3P	99.65	67.78	866
HSA-MIR-1251-3P	99.64	67.21	1408
HSA-MIR-5003-5P	99.61	69.13	1624
HSA-MIR-548AV-5P	99.60	70.84	2107
HSA-MIR-548K	99.60	70.84	2107
HSA-MIR-4261	99.59	70.30	3415

Functional genomics

gnomAD constraint: pLI 0.0866, LOEUF 1.15, missense Z 0.465 — population loss-of-function intolerance (pLI ≥ 0.9 = LoF-intolerant; lower LOEUF = more constrained). gnomAD

Regional missense constraint (gnomAD RMC): no regional variation along ENST00000271373 — one region, missense o/e 0.80.

Literature-anchored findings (GeneRIF, showing 17)

• found no significant difference (P > 0.05) in either allele or genotype frequency in the SNPs between patients and controls. (PMID:23933155)
• Tumor cells expressing MPC1 and MPC2 display increased mitochondrial pyruvate oxidation, with no changes in cell growth in adherent culture. (PMID:25458841)
• These results reveal a novel post-translational regulation of MPC1 by Sirt3, which is important for its activity and colon cancer cell growth. (PMID:26577410)
• a significant association between MPC2 variant rs10489202 and Schizophrenia susceptibility in Han Chinese (Meta-Analysis) (PMID:27460766)
• Our study indicates that MPC1 and MPC2 expressions are of prognostic values in PCAs and that positive expression of MPC1 or MPC2 is a predictor of favorable outcome. (PMID:27852261)
• Results indicate mitochondrial pyruvate transporter (MPC) to be the key regulatory junction perturbed by virulent strains of Mycobacterium tuberculosis leading to alteration of mitochondrial metabolic flux and regulation of acetyl-CoA formation. (PMID:28263840)
• In contrast to MPC1, which co-purifies with a host chaperone, we demonstrated that MPC2 homo-oligomers promote efficient pyruvate transport into proteoliposomes. The derived functional requirements and kinetic features of MPC2 resemble those previously demonstrated for MPC in the literature (PMID:29472561)
• Hypoxia induces lactate secretion and glycolytic efflux by downregulating MPC1/MPC2 levels in HUVEC cells. (PMID:29845198)
• MPC2 rs10489202 was genome-wide significantly associated with schizophrenia. The expression quantitative trait loci analysis in lymphoblastoid cell lines from East Asian donors revealed that MPC2 rs10489202 was specifically and significantly associated with the expression of TIPRL gene. (PMID:30087317)
• characterization of the rat ortholog (PMID:3022128)
• The data demonstrated that CtBP1 directly bound to the promoters of MPC1 and MPC2 and transcriptionally repressed them, leading to increased levels of free NADH in the cytosol and nucleus, thus positively feeding back CtBP1’s functions. (PMID:30356033)
• Characteristic Analysis of Homo- and Heterodimeric Complexes of Human Mitochondrial Pyruvate Carrier Related to Metabolic Diseases. (PMID:32403431)
• Mitochondrial pyruvate carrier: a potential target for diabetic nephropathy. (PMID:32664896)
• The Multifaceted Pyruvate Metabolism: Role of the Mitochondrial Pyruvate Carrier. (PMID:32708919)
• Decreased Expression of MPC2 Contributes to Aerobic Glycolysis and Colorectal Cancer Proliferation by Activating mTOR Pathway. (PMID:33791391)
• Structural Insights into the Human Mitochondrial Pyruvate Carrier Complexes. (PMID:34664967)
• MPC2 variants disrupt mitochondrial pyruvate metabolism and cause an early-onset mitochondriopathy. (PMID:36417180)

Cross-species orthologs

8 orthologs

Organism	Symbol	Gene ID
danio_rerio	mpc2b	ENSDARG00000024478
danio_rerio	mpc2a	ENSDARG00000037679
mus_musculus	Mpc2	ENSMUSG00000026568
rattus_norvegicus	Mpc2	ENSRNOG00000003150
drosophila_melanogaster	CG9396	FBGN0037714
drosophila_melanogaster	CG9399	FBGN0037715
drosophila_melanogaster	CG32832	FBGN0052832
caenorhabditis_elegans	mpc-2	WBGENE00018765

Paralogs (2): MPC1 (ENSG00000060762), MPC1L (ENSG00000238205)

Mouse-model phenotypes

Observed phenotypes of the mouse ortholog (MGI:1917706) from MGI (Alliance of Genome Resources) — knockout/mutant phenotypes, ranked by annotation count. 10 distinct phenotype terms.

Mouse phenotype (MP)	Records
increased circulating ketone body level	1
decreased circulating triglyceride level	1
decreased circulating insulin level	1
decreased insulin secretion	1
decreased oxygen consumption	1
impaired glucose tolerance	1
increased circulating glucose level	1
abnormal mitochondrial physiology	1
embryonic lethality during organogenesis, complete penetrance	1
increased circulating lactate level	1

Additional cross-species homologs

Sequence homologs in species beyond Ensembl Compara’s model organisms, by Diamond local protein alignment (% sequence identity; best hit per species). Lower-identity rows are more distant homologs. The matched accessions’ gene symbols aren’t in biobtree yet, so each row shows the UniProt accession.

Organism	UniProt	Identity	Method
Pongo abelii	Q5R4Z3	99.2%	Diamond
Bos taurus	Q3ZCG2	97.2%	Diamond
Arabidopsis thaliana	Q8L7H8	83.8%	Diamond
Saccharomyces cerevisiae S288C	P38857	78.6%	Diamond
Schizosaccharomyces pombe 972h-	Q09896	53.8%	Diamond

Genomic neighbors (locus context)

Genes flanking this one on the chromosome (NCBI/Entrez gene neighborhood). Positional context only — some neighbors share regulatory elements (bidirectional promoters, antisense/overlapping transcripts), but chromosomal adjacency is not itself a functional relationship (see Interactions for that).

Symbol	Type	Entrez
GPR161	protein-coding	23432
ADCY10	protein-coding	55811
DCAF6	protein-coding	55827
MIR1255B2	ncRNA	100313835
TIPRL	protein-coding	261726
TRP-AGG2-1	tRNA	100189019
MPZL1	protein-coding	9019
TRP-CGG1-1	tRNA	100189211

Protein

Protein identifiers

Mitochondrial pyruvate carrier 2 — O95563 (reviewed: O95563)

Alternative names: Brain protein 44

All UniProt accessions (2): O95563, Q5R3B4

UniProt curated annotations — full annotation on UniProt →

Function. Mediates the uptake of pyruvate into mitochondria to maintain the balance between glycolysis and oxidative phosphorylation. Plays an essential role in cellular metabolism.

Subunit / interactions. Heterodimer; dimerises with MPC1 or MPC1L to form a functional mitochondrial pyruvate carrier. May form a homodimer.

Subcellular location. Mitochondrion inner membrane.

Similarity. Belongs to the mitochondrial pyruvate carrier (MPC) (TC 2.A.105) family.

RefSeq proteins (2): NP_001137146, NP_056230 (=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR005336	MPC	Family

Pfam: PF03650

Catalyzed reactions (Rhea)

• pyruvate(out) + H(+)(out) = pyruvate(in) + H(+)(in) (RHEA:64720)

UniProt features (26 total): helix 8, mutagenesis site 6, topological domain 4, transmembrane region 3, strand 2, binding site 2, chain 1

Structure

Experimental structures (PDB)

17 structures by resolution:

PDB	Title	Method	Resolution (Å)
9MNZ	Cryo-EM structure of human MPC in complex with UK5099 in nanodiscs	ELECTRON MICROSCOPY	2.73
9MNY	Cryo-EM structure of human MPC with pyruvate	ELECTRON MICROSCOPY	2.78
9MO0	Cryo-EM structure of human MPC in complex with AKOS005153046	ELECTRON MICROSCOPY	2.83
8YW9	Cryo-EM structure of human mitochondrial pyruvate carrier in the matrix-facing …	ELECTRON MICROSCOPY	3.01
9MNX	Cryo-EM structure of human MPC in complex with UK5099 in LMNG	ELECTRON MICROSCOPY	3.11
8YW8	Cryo-EM structure of human mitochondrial pyruvate carrier in complex with the inhibitor …	ELECTRON MICROSCOPY	3.17
8YW6	Cryo-EM structure of apo human mitochondrial pyruvate carrier in the IMS-open …	ELECTRON MICROSCOPY	3.18
9O9T	Structure of human MPC IMS-open	ELECTRON MICROSCOPY	3.31
9MNW	Cryo-EM structure of human MPC in complex with GW604714	ELECTRON MICROSCOPY	3.35
9KNY	Cryo-EM structure of pyruvate-treated human mitochondrial pyruvate carrier in the …	ELECTRON MICROSCOPY	3.4
9KNW	Cryo-EM structure of apo human mitochondrial pyruvate carrier in the IMS-open …	ELECTRON MICROSCOPY	3.41
9O9S	Structure of human MPC matrix-open	ELECTRON MICROSCOPY	3.57
9GIV	Structure of the human mitochondrial pyruvate carrier inhibited by a UK5099-derivative	ELECTRON MICROSCOPY	3.65
9GIX	Structure of the human mitochondrial pyruvate carrier in the apo-state	ELECTRON MICROSCOPY	3.65
9KNX	Cryo-EM structure of human mitochondrial pyruvate carrier in the occluded conformation at …	ELECTRON MICROSCOPY	3.72
9GIY	Structure of the human mitochondrial pyruvate carrier inhibited by mitoglitazone	ELECTRON MICROSCOPY	3.79
9GIW	Structure of the human mitochondrial pyruvate carrier inhibited by zaprinast	ELECTRON MICROSCOPY	3.92

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-O95563-F1	89.34	0.53

Antibody-complex structures (SAbDab)

10 antibodies co-crystallized with this protein: 8YW6, 8YW8, 8YW9, 9GIX, 9KNW, 9KNX, 9KNY, 9MNX, 9MNY, 9MNZ

Human Protein Atlas

Protein class: Metabolic proteins, Transporters, Electrochemical Potential-driven transporters, Predicted membrane proteins, Predicted intracellular proteins

Protein evidence: Evidence at protein level

Antibody reliability (HPA): IH uncertain

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Ligand- & substrate-binding residues (2)

Position	Role
49	pyruvate
82	pyruvate

Mutagenesis-validated functional residues (6)

Position	Phenotype
49	impairs pyruvate uptake.
66	impairs pyruvate uptake.
71	abolishes pyruvate uptake.
82	impairs pyruvate uptake.
100	impairs pyruvate uptake.
110	abolishes pyruvate uptake.

Function

Pathways and Gene Ontology

Reactome pathways

0 curated (TAS) of 3; 0 disease pathways. Curated-first; evidence = TAS (manually curated) vs IEA (electronic inference).

3 pathways:

ID	Pathway	Evidence
R-HSA-1428517	Aerobic respiration and respiratory electron transport	—
R-HSA-1430728	Metabolism	—
R-HSA-70268	Pyruvate metabolism	electronic

MSigDB gene sets: 286 (showing top): BORCZUK_MALIGNANT_MESOTHELIOMA_UP, YAO_TEMPORAL_RESPONSE_TO_PROGESTERONE_CLUSTER_10, TGCGCANK_UNKNOWN, RORA1_01, GCANCTGNY_MYOD_Q6, GOBP_INSULIN_SECRETION, STARK_PREFRONTAL_CORTEX_22Q11_DELETION_DN, AREB6_03, MAZ_Q6, GOBP_CELLULAR_RESPONSE_TO_CARBOHYDRATE_STIMULUS, GOBP_POSITIVE_REGULATION_OF_PROTEIN_LOCALIZATION, GOBP_REGULATION_OF_HORMONE_LEVELS, GOBP_HORMONE_TRANSPORT, GOBP_ORGANOPHOSPHATE_METABOLIC_PROCESS, TGACCTY_ERR1_Q2

GO Biological Process (1): pyruvate import into mitochondria (GO:0006850)

GO Molecular Function (3): identical protein binding (GO:0042802), pyruvate transmembrane transporter activity (GO:0050833), protein binding (GO:0005515)

GO Cellular Component (4): nucleus (GO:0005634), mitochondrion (GO:0005739), mitochondrial inner membrane (GO:0005743), mitochondrial pyruvate carrier complex (GO:7770001)

Reactome top-level categories

2 top-level categories:

Category	Pathways
Aerobic respiration and respiratory electron transport	1
Metabolism	1

GO top-level categories

11 GO namespaces:

Category	Terms
pyruvate transmembrane transport	2
intracellular membrane-bounded organelle	2
import into the mitochondrion	1
protein binding	1
monocarboxylic acid transmembrane transporter activity	1
binding	1
cytoplasm	1
organelle inner membrane	1
mitochondrial membrane	1
inner mitochondrial membrane protein complex	1
transmembrane transporter complex	1

Experimentally-supported GO annotations

GO terms backed by direct experimental evidence (ECO experimental codes) — 6 of 8 annotations. The rest are phylogenetic / computational / electronic (IEA).

6 experimentally-supported GO terms:

GO term	NS	Evidence
pyruvate import into mitochondria	BP	direct assay
mitochondrial inner membrane	CC	direct assay
mitochondrial pyruvate carrier complex	CC	direct assay
mitochondrion	CC	direct assay
nucleus	CC	high-throughput assay
identical protein binding	MF	physical interaction

Protein interactions and networks

STRING

showing 15 of 1,072 interactions by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
MPC2	MPC1	Q9Y5U8	920
MPC2	MPC1L	P0DKB6	666
MPC2	PC	P11498	482
MPC2	DCAF6	Q58WW2	478
MPC2	MPZL1	O95297	448
MPC2	TMEM41A	Q96HV5	433
MPC2	PDHB	P11177	426
MPC2	NDUFS6	O75380	415
MPC2	SDHA	P31040	408
MPC2	PDHA1	P08559	403
MPC2	PDHX	O00330	401
MPC2	CS	O75390	397
MPC2	IDH2	P48735	391
MPC2	SLC25A11	Q02978	387
MPC2	MDH2	P40926	387

IntAct

Human interaction partners of MPC2 in IntAct, one row per partner (best MIscore; records = supporting IntAct interaction records).

24 partners by confidence:

Partner	Interaction type	MIscore	Records
MPC1	physical association	0.860	9
MPC1L	direct interaction	0.650	4
APOC1	physical association	0.560	3
BRK1	physical association	0.560	3
CIDEB	physical association	0.560	3
DIABLO	physical association	0.560	3
DNM1L	physical association	0.560	3
DR1	physical association	0.560	3
EEF1D	physical association	0.560	3
GTF3C3	physical association	0.560	3
MICOS10	physical association	0.560	3
RHBDD2	physical association	0.560	3
SNX1	physical association	0.560	3
SPG21	physical association	0.560	3
SYT16	physical association	0.560	3
TEX44	physical association	0.560	3
TIMM17B	physical association	0.560	3
FLOT2	association	0.530	2
H1-1	physical association	0.400	1
OGFOD3	association	0.350	2
TMBIM6	association	0.350	1
IFT70B	physical association	0.000	1
RAB5IF	physical association	0.000	1
RPLP1	physical association	0.000	1

BioGRID (106 interactions; top human partners by supporting records): MPC1 (Two-hybrid; 5 records), FLOT2 (Affinity Capture-MS; 3 records), ATP2B2 (Affinity Capture-MS; 2 records), CS (Negative Genetic; 2 records), OGFOD3 (Affinity Capture-MS; 2 records), SLC1A1 (Affinity Capture-MS; 2 records), SLC39A9 (Affinity Capture-MS; 2 records), TMEM171 (Affinity Capture-MS; 2 records), ACO2 (Positive Genetic), ADAM18 (Affinity Capture-MS), AMD1 (Negative Genetic), APOC1 (Two-hybrid), APOO (Proximity Label-MS), AQP3 (Affinity Capture-MS), BCAT2 (Positive Genetic)

SIGNOR signaling

2 signaling interactions:

A	Effect	B	Mechanism
MPC2	“form complex”	“Mitochondrial pyruvate carrier complex”	binding
MPC2	“form complex”	“Mitochondrial pyruvate carrier complex, testis variant”	binding

Protein complexes (CORUM) (1)

Experimentally-characterized complexes this protein is a subunit of (★ = the complex contains a known drug target).

1 complexes by size:

Complex	Subunits	Members
MPC1-MPC2 complex	2	MPC1, MPC2

Disease & clinical

Genetic variants

Variant evidence for MPC2: 1 GWAS association.

ClinVar

No ClinVar records for this gene.

SpliceAI

Top 10 splice-impact sites by Δscore (adjacent positions with the same effect merged into one range; 30 predictions of 456):

Position(s)	Effect	Δscore	Sites
1:167924538–167924539	acceptor_loss	1.0000	5
1:167935731–167935732	donor_loss	1.0000	5
1:167920545–167920546	donor_loss	0.9900	6
1:167920646	acceptor_gain	0.9900
1:167924538	acceptor_loss	0.9900
1:167920632–167920633	acceptor_loss	0.9800	4
1:167924495–167924496	donor_loss	0.9800	5
1:167920547	donor_loss	0.9700
1:167920632	acceptor_loss	0.9700
1:167920638	acceptor_gain	0.9700

AlphaMissense

476 missense substitutions predicted likely pathogenic (of 815 scored), across 108 residues. Top 20 hotspot residues, ranked by the number of likely-pathogenic substitutions (of those reachable by a single-nucleotide change), then by mean score:

Residue	Likely-pathogenic substitutions	Mean am_pathogenicity	Max am_pathogenicity
D59	8	0.990	0.998
F43	8	0.969	0.996
N100	8	0.968	0.999
F42	8	0.967	0.999
S68	8	0.958	0.997
N93	8	0.945	0.997
H34	8	0.941	0.989
F97	8	0.894	0.984
W82	7	0.989	0.999
W44	7	0.979	0.998
K49	7	0.969	0.997
W50	7	0.969	0.999
Q71	7	0.958	0.996
I89	7	0.954	0.999
Q110	7	0.939	0.988
F102	7	0.859	0.945
P91	6	0.997	0.999
G37	6	0.992	0.997
G79	6	0.992	1.000
P46	6	0.991	0.997

HPA cancer prognostics

RNA cancer specificity: Low cancer specificity

Human Protein Atlas survival analysis — favorable = higher expression predicts better survival.

1 prognostic cancer types:

Cancer	Prognostic	p-value
Kidney Renal Clear Cell Carcinoma (TCGA)	favorable	1.42e-05

Disease associations

OMIM: gene MIM:614737 | disease phenotypes:

GenCC curated gene-disease

2 curated gene-disease records:

Disease	Classification	Inheritance	Records
mitochondrial pyruvate carrier deficiency	Moderate	Autosomal recessive
metabolic disease	Limited	Autosomal recessive

Genomics England panels (PanelApp)

Clinical diagnostic gene panels including this gene (1 panels, 0 green/diagnostic-grade). Confidence: green = diagnostic, amber = moderate.

1 panels:

Panel	Rating
Fetal anomalies	amber

Mondo (2): mitochondrial pyruvate carrier deficiency (MONDO:0013877), metabolic disease (MONDO:0005066)

GWAS associations

1 associations:

Study	Trait	p-value
GCST001301_1	Schizophrenia	1e-8

MeSH disease descriptors

1 disease descriptors:

Descriptor	Name	Tree numbers
D008659	Metabolic Diseases	C18.452

Drugs & pharmacology

Drug and pharmacology data

Is drug target: yes

ChEMBL targets (1): CHEMBL4295686 (SINGLE PROTEIN)

Molecules with ChEMBL bioactivity

Phase ≥1, by development phase (incl. off-target/promiscuous compounds). Patent mentions across the top 20 by phase: 347 (via chembl_molecule»patent_compound — counts attach to the compound, not the gene–compound relationship, so off-target/promiscuous molecules can dominate).

1 molecules by phase:

Molecule	Name	Phase	Patents
CHEMBL146624	MITOGLITAZONE	2	347

PharmGKB: 1 entry (CPIC guideline: no)

GtoPdb / IUPHAR curated pharmacology

(IUPHAR/BPS Guide to Pharmacology — expert-curated)

Target class: transporter — SLC54 Mitochondrial pyruvate carriers

Most potent curated ligand interactions (9 total), top 9:

Ligand	Action	Affinity	Parameter
UK-5099	Inhibition	7.28	pIC50
α-cyanocinnamate	Inhibition	6.7	pIC50
α-Cyano-5-phenyl-2,4-pentadienic acid	Inhibition	6.7	pIC50
zaprinast	Inhibition	6.52	pIC50
entacapone	Inhibition	6.22	pIC50
mitoglitazone	Inhibition	5.89	pIC50
α-cyano-4-hydroxycinnamate	Inhibition	5.82	pIC50
nitrofurantoin	Inhibition	5.48	pIC50
lonidamine	Inhibition	5.34	pIC50

Binding affinities (BindingDB)

6 measured of 9 human assays (9 total across all organisms); most potent 6 below. Values come from heterogeneous assays and are not directly comparable.

Ligand	Measure	Value	Patent
Rosiglitazone	IC50	2000 nM	US-20250064791: 5-[[4-[2-[5-(1-HYDROXYETHYL)PYRIDIN-2-YL]ETHOXY]PHENYL]METHYL]-1,3-THIAZOLIDINE-2,4-DIONE AND ITS SALTS FOR USE IN THE TREATMENT OF MITOCHONDRIAL DISEASES
CHEBI:82937	IC50	4100 nM	US-20240091210: USE OF 5-[[4-[2-[5-ACETYLPYRIDIN-2-YL]ETHOXY]BENZYL]-1,3-THIAZOLIDINE-2,4-DIONE AND ITS SALTS
CHEMBL4291468	IC50	7000 nM
(E)-2-cyano-3-(1-phenylindol-3-yl)prop-2-enoic acid	IC50	17000 nM	US-20240091210: USE OF 5-[[4-[2-[5-ACETYLPYRIDIN-2-YL]ETHOXY]BENZYL]-1,3-THIAZOLIDINE-2,4-DIONE AND ITS SALTS
(Z)-2-cyano-3-(1-phenylindol-3-yl)prop-2-enoic acid	IC50	17000 nM	US-20250064791: 5-[[4-[2-[5-(1-HYDROXYETHYL)PYRIDIN-2-YL]ETHOXY]PHENYL]METHYL]-1,3-THIAZOLIDINE-2,4-DIONE AND ITS SALTS FOR USE IN THE TREATMENT OF MITOCHONDRIAL DISEASES
3-anilino-1-[3-(cyanomethyl)-1-(propan-2-ylcarbamoyl)azetidin-3-yl]pyrazole-4-carboxamide	IC50	26000 nM	US-9562012: PPAR-sparing compounds for the treatment of metabolic diseases

ChEMBL bioactivities

2 potent at pChembl≥5 of 2 total, top 2 by pChembl (potency: 10 = 0.1 nM, 6 = 1 µM).

pChembl	Type	Value	Unit	Molecule
5.92	IC50	1200	nM	MITOGLITAZONE
5.92	IC50	1200	nM	CHEMBL4291468

PubChem BioAssay actives

2 with measured affinity, of 2 total; 2 most potent distinct compounds. Largely complementary to BindingDB; screening values are coarse (µM, 4 dp), so sub-nM hits tie at the floor.

Compound	Assay	Type	Value	Unit
5-[[4-[2-(5-ethyl-2-pyridinyl)-2-oxoethoxy]phenyl]methyl]-1,3-thiazolidine-2,4-dione	1419250: Displacement of photoprobe from MPC2 (unknown origin)	ic50	1.2000	uM
5-[[4-[2-(3-methoxyphenyl)-2-oxoethoxy]phenyl]methyl]-1,3-thiazolidine-2,4-dione	1419250: Displacement of photoprobe from MPC2 (unknown origin)	ic50	1.2000	uM

CTD chemical–gene interactions

41 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
bisphenol A	affects expression, decreases expression	3
Valproic Acid	decreases methylation, increases expression	3
Aflatoxin B1	decreases expression, decreases methylation	3
Acetaminophen	decreases expression	2
Phenylmercuric Acetate	affects cotreatment, increases expression	2
Cyclosporine	decreases expression	2
methylmercuric chloride	decreases expression	1
triphenyl phosphate	affects expression	1
sodium arsenite	increases expression	1
brequinar	decreases expression	1
corosolic acid	decreases expression	1
K 7174	decreases expression	1
4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	affects cotreatment, increases expression	1
bisphenol B	increases expression	1
dorsomorphin	affects cotreatment, increases expression	1
enzalutamide	decreases expression	1
bisphenol AF	increases expression	1
Sunitinib	decreases expression	1
Zoledronic Acid	decreases expression	1
Benzo(a)pyrene	decreases expression	1
Cisplatin	increases expression	1
Cyclophosphamide	affects response to substance	1
Diethylstilbestrol	decreases expression	1
Doxorubicin	increases expression	1
Fluorouracil	affects response to substance	1
Hydrogen Peroxide	affects expression	1
Ivermectin	decreases expression	1
Lead	affects expression	1
Methyl Methanesulfonate	increases expression	1
Mitoxantrone	affects response to substance	1

ChEMBL screening assays

1 unique, capped per target: 1 binding

Representative assays (with source publication via chembl_document):

Assay ID	Type	Description	Source paper
CHEMBL4265674	Binding	Displacement of photoprobe from MPC2 (unknown origin)	PPARγ-sparing thiazolidinediones as insulin sensitizers. Design, synthesis and selection of compounds for clinical development. — *Bioorg Med Chem*

Cellosaurus cell lines

3 cell lines: 3 cancer cell line

First 10 cell lines (id-ordered, not curated):

Cellosaurus	Name	Category	Sex
CVCL_D4RI	HuH7-MPC2-KO-c10	Cancer cell line	Male
CVCL_D4RJ	HuH7-MPC2-KO-c12	Cancer cell line	Male
CVCL_F5IK	EDITGENE MPC2 Knockout HuH-7 Cell Line	Cancer cell line	Male

Clinical trials (associated diseases)

Via MONDO — disease-level, not drug-specific.

showing 60 of 300 trials:

NCT	Phase	Status	Title
NCT00192621	Phase 4	COMPLETED	Seronegatives and Metabolic Abnormalities Protocol 2 (SAMA002): Study to Compare the Effect of Kaletra and Combivir® in HIV-Negative Healthy Subjects
NCT01443806	Phase 4	COMPLETED	Characterisation of the Human Carboxylesterase 1 (CES1) Mutations in Thailand
NCT02645279	Phase 4	UNKNOWN	Comparison of Oral 30 % Dextrose and iv Midazolam Sedation During MRI in Neonates
NCT04653779	Phase 4	UNKNOWN	A Clinical Trial to Evaluate the Preference Regarding Convenience of Medication and Efficacy/Safety of SUGAMET®XR Tablet 5/1000mg
NCT05084079	Phase 4	UNKNOWN	Different Initial Insulin Dose Regimens on Time to Achieve Glycemic Targets and Treatment Safety in SIIT
NCT05855577	Phase 4	UNKNOWN	Motor Function Efficacy of Pharmacological Treatments Targeting Energy Metabolism, in Parkinson’s Patients
NCT06003153	Phase 4	RECRUITING	GLUCOSE-MGH: Genetic Links Understood Through Challenge With Oral Semaglutide Exposure at MGH
NCT06009653	Phase 4	WITHDRAWN	Effects of Tirzepatide Plus Intensive Lifestyle Therapy on Body Weight and Metabolic Health in Latinos With Obesity
NCT00387114	Phase 3	TERMINATED	Effect of an Anti-Oxidant Treatment on Resistin Serum Levels.A Randomized Study
NCT00546052	Phase 3	COMPLETED	A 52 Week Study to Evaluate the Effects of Losartan With or Without HCTZ on Plasma Glucose, Metabolic Parameters, Blood Pressure in Hypertensive Patients With Metabolic Syndrome (0954A-331)
NCT00607373	Phase 3	COMPLETED	Study to Assess the Safety and Efficacy of ISIS 301012 (Mipomersen) in Homozygous Familial Hypercholesterolemia
NCT00694109	Phase 3	COMPLETED	An Open-label Extension Study to Assess the Long-term Safety and Efficacy of ISIS 301012 (Mipomersen) in Patients With Familial Hypercholesterolemia or Severe-Hypercholesterolemia
NCT00935766	Phase 3	TERMINATED	Effect of Fish Oil (Omega-3 Fatty Acids) on Arteries
NCT01286909	Phase 3	UNKNOWN	Efficacy of Laflavon in Lowering Triglycerides and Raising High-Density Lipoprotein (HDL)
NCT01343680	Phase 3	TERMINATED	Trial of Two Central Venous Catheter (CVC) Flushing Schemes in Pediatric Hematology and Oncology Patients
NCT04371978	Phase 3	TERMINATED	Efficacy and Safety of Dipeptidyl Peptidase-4 Inhibitors in Diabetic Patients With Established COVID-19
NCT04809220	Phase 3	COMPLETED	A Study of Two Doses of Dulaglutide (LY2189265) in Japanese Patients With Type 2 Diabetes
NCT05260021	Phase 3	COMPLETED	A Study to Evaluate Tirzepatide (LY3298176) in Pediatric and Adolescent Participants With Type 2 Diabetes Mellitus Inadequately Controlled With Metformin or Basal Insulin or Both
NCT05425745	Phase 3	COMPLETED	Evaluate the Effect of Obicetrapib in Patients With HeFH on Top of Maximum Tolerated Lipid-Modifying Therapies.
NCT05505994	Phase 3	UNKNOWN	The Efficacy and Safety of DWP16001 in Combination With Metformin in T2DM Patients Inadequately Controlled on Metformin
NCT05691712	Phase 3	COMPLETED	A Study of Tirzepatide (LY3298176) in Chinese Participants With Type 2 Diabetes
NCT06568471	Phase 3	RECRUITING	A Study on Efficacy and Safety of HST101 in Chinese Patients with Hypercholesterolemia
NCT06672237	Phase 3	RECRUITING	A Phase 3 Study of NTLA-2001 in ATTRv-PN
NCT07613307	Phase 3	RECRUITING	A Study of Orforglipron (LY3502970) in Participants With Type 2 Diabetes Who Observe Ramadan Fasting
NCT00001723	Phase 2	COMPLETED	Safety and Efficacy of Xenical in Children and Adolescents With Obesity-Related Diseases
NCT00119379	Phase 2	COMPLETED	Effectiveness of Nucleoside Supplementation or Switch to Tenofovir in Reversing Fat Loss in HIV Infected Adults
NCT00362180	Phase 2	COMPLETED	Measure Liver Fat Content After ISIS 301012 (Mipomersen) Administration
NCT00446264	Phase 2	COMPLETED	Islet Allotransplantation With Steroid Free Immunosuppression
NCT00477594	Phase 2	COMPLETED	Open Label Extension of ISIS 301012 (Mipomersen) to Treat Familial Hypercholesterolemia
NCT00622765	Phase 2	COMPLETED	A Study of the Safety and Effectiveness of JNJ-16269110 (R256918) in Overweight and Obese Patients
NCT00707746	Phase 2	COMPLETED	Safety and Efficacy Study of ISIS 301012 (Mipomersen) Administration in High Risk Statin Intolerant Subjects
NCT01041677	Phase 2	COMPLETED	A Study of the Safety of R256918 in Obese Patients
NCT01135537	Phase 2	TERMINATED	Pharmacokinetics of Thymoglobulin in Paediatric Haematopoietic Stem-cell Transplants
NCT01596699	Phase 2	TERMINATED	Pilot Trial of Clofarabine Added to Standard Busulfan and Fludarabine for Conditioning Prior to Allogeneic Hematopoietic Cell Transplantation
NCT01927913	Phase 2	WITHDRAWN	Treatment of Iron Overload Requiring Chelation Therapy
NCT01968720	Phase 2	COMPLETED	Pilot Study To Assess CAT-2003 in Patients With Severe Hypertriglyceridemia
NCT02019667	Phase 2	COMPLETED	Phase 2 Clinical Trial of SGS-742 Therapy in Succinic Semialdehyde Dehydrogenase Deficiency
NCT02102737	Phase 2	COMPLETED	Comparison of A New Technique of Measure of the Insulin Resistance By Scintigraphy With the Reference Technique
NCT02512679	Phase 2	TERMINATED	Related Hematopoietic Stem Cell Transplantation (HSCT) for Genetic Diseases of Blood Cells
NCT02587572	Phase 2	WITHDRAWN	Safety and Efficacy Trial Using Allogeneic Human Mesenchymal Stem Cells: The SIRONA Trial
NCT03345004	Phase 2	COMPLETED	Diamyd Administered Into Lymph Nodes in Combination With Vitamin D in Type 1 Diabetes
NCT03682640	Phase 2	UNKNOWN	Azithromycin Insulin Diet Intervention Trial in Type 1 Diabetes
NCT03866954	Phase 2	WITHDRAWN	Trial of Erythrocyte Encapsulated Thymidine Phosphorylase In Mitochondrial Neurogastrointestinal Encephalomyopathy
NCT04055428	Phase 2	RECRUITING	NAUTICAL: Effect of Natriuretic Peptide Augmentation on Cardiometabolic Health in Black Individuals
NCT04227769	Phase 2	TERMINATED	IL-1-receptor Antagonist During Cephalic Phase of Insulin Secretion in Health and Type 2 Diabetes
NCT04414046	Phase 2	RECRUITING	TCR Alpha Beta T-cell Depleted Haploidentical HCT in the Treatment of Primary Immunodeficiency and Inherited Metabolic Disorders in Children
NCT04937452	Phase 2	COMPLETED	Dopaminergic Therapy for Frontotemporal Dementia Patients
NCT05256654	Phase 2	COMPLETED	A Study of LY3561774 in Participants With Mixed Dyslipidemia
NCT06320951	Phase 2	NOT_YET_RECRUITING	VITAL-IMPACT: Improving Cardiometabolic Health in Black Individuals Through Therapeutic Augmentation of Cyclic Guanosine Mono-Phosphate Signaling Pathway
NCT06843902	Phase 2	RECRUITING	Improving Coronary Vascular Health in Women
NCT06968208	Phase 2	NOT_YET_RECRUITING	The Efficacy and Safety of Puerarin in Obesity Treatment
NCT07699380	Phase 2	RECRUITING	METabolic MODulation to Enhance Insulin Sensitivity and Mitochondrial Function in Type 1 Diabetes (MetMod-T1D)
NCT01103245	Phase 1	COMPLETED	Aldosterone and the Metabolic Syndrome
NCT01301456	Phase 1	COMPLETED	Single-Dose And Multiple-Dose Safety And Tolerability Study Of PF-04856883 In Type 2 Diabetic Adult Females
NCT01345578	Phase 1	TERMINATED	Hepatocyte Transplantation for Liver Based Metabolic Disorders
NCT01435382	Phase 1	COMPLETED	A Pharmacokinetic and Pharmacodynamic Study of PF-04950615 (RN316) in Subjects With Hypercholesterolemia
NCT01474161	Phase 1	COMPLETED	Comparative Bioavailability - Gender Effect - Single and Multiple Ascending Dose Safety and Pharmacokinetic Study of GFT505
NCT02107872	Phase 1	COMPLETED	Study to Assess the Safety and Tolerability of Multiple Ascending Doses of REGN1500
NCT02231710	Phase 1	TERMINATED	Safety Study of Gene Modified Donor T Cell Infusion After Stem Cell Transplant for Non-Malignant Diseases
NCT02354443	Phase 1	TERMINATED	A Trial of a Single ProHema-CB Product Transplant in Pediatric Patients With Inherited Metabolic Disorders

Predicted chemistry — Sugi Predict

The predicted patent-compound landscape for MPC2 across ~30M SureChEMBL compounds — explore on Sugi Predict.