MSRB1

Summary

MSRB1 (methionine sulfoxide reductase B1, HGNC:14133) is a protein-coding gene on chromosome 16p13.3, encoding Methionine-R-sulfoxide reductase B1 (Q9NZV6). Methionine-sulfoxide reductase that specifically reduces methionine (R)-sulfoxide back to methionine.

The protein encoded by this gene belongs to the methionine-R-sulfoxide reductase B (MsrB) family. Members of this family function as repair enzymes that protect proteins from oxidative stress by catalyzing the reduction of methionine-R-sulfoxides to methionines. This protein is highly expressed in liver and kidney, and is localized to the nucleus and cytosol. It is the only member of the MsrB family that is a selenoprotein, containing a selenocysteine (Sec) residue at its active site. It also has the highest methionine-R-sulfoxide reductase activity compared to other members containing cysteine in place of Sec. Sec is encoded by the UGA codon, which normally signals translation termination. The 3’ UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon, rather than as a stop signal. A pseudogene of this locus has been identified on chromosome 19.

Source: NCBI Gene 51734 — RefSeq curated summary.

At a glance

• GWAS associations: 1
• Clinical variants (ClinVar): 32 total
• MANE Select transcript: NM_016332

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:14133
Approved symbol	MSRB1
Name	methionine sulfoxide reductase B1
Location	16p13.3
Locus type	gene with protein product
Status	Approved
Aliases	SelR, SepR, SelX, SELENOX, SELENOR
Ensembl gene	ENSG00000198736
Ensembl biotype	protein_coding
OMIM	606216
Entrez	51734

Gene structure

Transcript identifiers

Ensembl transcripts: 5 — 3 protein_coding, 1 retained_intron, 1 protein_coding_CDS_not_defined

ENST00000361871, ENST00000399753, ENST00000473663, ENST00000489198, ENST00000564908

RefSeq mRNA: 3 — MANE Select: NM_016332 NM_001382264, NM_001382265, NM_016332

CCDS: CCDS42100

Canonical transcript exons

ENST00000361871 — 4 exons

Exon	Start	End
ENSE00001435058	1938229	1939143
ENSE00002604473	1943102	1943199
ENSE00003549701	1941257	1941405
ENSE00003595814	1940778	1940892

Expression profiles

Bgee: expression breadth ubiquitous, 277 present calls, max score 98.98.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 25.7980 / max 909.1811, expressed in 1806 samples.

FANTOM5 promoters (5 alternative TSS)

Promoter ID	TPM avg	Samples expressed
155880	20.9909	1790
155881	3.0157	1560
155882	1.5960	831
155878	0.1420	27
155879	0.0535	21

Top tissues by expression

286 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
blood	UBERON:0000178	98.98	gold quality
right lobe of liver	UBERON:0001114	98.15	gold quality
body of pancreas	UBERON:0001150	97.74	gold quality
trabecular bone tissue	UBERON:0002483	97.47	gold quality
diaphragm	UBERON:0001103	97.41	gold quality
monocyte	CL:0000576	97.39	gold quality
leukocyte	CL:0000738	97.30	gold quality
mononuclear cell	CL:0000842	97.25	gold quality
granulocyte	CL:0000094	97.12	gold quality
liver	UBERON:0002107	97.11	gold quality
bone marrow	UBERON:0002371	96.53	gold quality
lower esophagus muscularis layer	UBERON:0035833	96.44	gold quality
lower esophagus	UBERON:0013473	96.42	gold quality
periodontal ligament	UBERON:0008266	96.21	gold quality
adult mammalian kidney	UBERON:0000082	96.15	gold quality
esophagogastric junction muscularis propria	UBERON:0035841	96.03	gold quality
mucosa of transverse colon	UBERON:0004991	95.78	gold quality
bone marrow cell	CL:0002092	95.30	gold quality
right coronary artery	UBERON:0001625	95.16	gold quality
hindlimb stylopod muscle	UBERON:0004252	94.83	gold quality
popliteal artery	UBERON:0002250	94.82	gold quality
tibial artery	UBERON:0007610	94.79	gold quality
nephron tubule	UBERON:0001231	94.62	gold quality
skeletal muscle tissue of rectus abdominis	UBERON:0004511	94.45	gold quality
mucosa of stomach	UBERON:0001199	94.39	gold quality
saphenous vein	UBERON:0007318	94.33	gold quality
body of tongue	UBERON:0011876	94.32	gold quality
left coronary artery	UBERON:0001626	94.27	gold quality
coronary artery	UBERON:0001621	94.03	gold quality
gastrocnemius	UBERON:0001388	93.99	gold quality

Single-cell (SCXA)

Detected in 6 experiment(s), a significant marker in 6.

Experiment	Marker?	Max mean expression
E-GEOD-114530	yes	902.27
E-HCAD-10	yes	29.73
E-CURD-112	yes	18.49
E-MTAB-9067	yes	11.21
E-MTAB-9801	yes	9.48
E-ANND-3	no	0.00

Regulation

Is transcription factor: no

Upstream regulators (CollecTRI, top): DNMT1, SP1

miRNA regulators (miRDB)

25 targeting MSRB1, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-545-3P	99.95	70.74	2783
HSA-MIR-124-3P	99.89	73.74	3043
HSA-MIR-506-3P	99.89	73.55	3057
HSA-MIR-6124	99.87	69.78	3551
HSA-MIR-579-3P	99.86	71.66	3628
HSA-MIR-629-3P	99.85	67.99	1875
HSA-MIR-664B-3P	99.84	71.65	3590
HSA-MIR-6842-5P	99.80	67.54	1587
HSA-MIR-7110-5P	99.80	67.84	1712
HSA-MIR-3202	99.66	67.70	2737
HSA-MIR-12122	99.56	69.33	1672
HSA-MIR-508-5P	99.41	64.25	1248
HSA-MIR-4316	99.37	65.75	1360
HSA-MIR-520A-5P	99.35	66.72	1632
HSA-MIR-525-5P	99.35	66.85	1615
HSA-MIR-4667-3P	99.26	65.45	1608
HSA-MIR-6837-5P	99.25	65.47	1632
HSA-MIR-4426	99.17	66.74	1949
HSA-MIR-661	99.09	65.94	2062
HSA-MIR-4297	98.77	66.95	2013
HSA-MIR-12114	98.70	63.45	730
HSA-MIR-7155-5P	98.65	66.14	1290
HSA-MIR-3145-5P	98.57	67.83	900
HSA-MIR-6804-5P	98.39	65.77	1084
HSA-MIR-197-3P	98.09	69.23	1004

Literature-anchored findings (GeneRIF, showing 12)

• The studies in mouse show that MsrB is a selenoprotein that exhibits high specificity for reduction of the R forms of free and protein-bound methionine sulfoxide. (PMID:11779133)
• The neutrophils expressed the highest activity Msrs. Msrs are important as antioxidant/repair systems for neutrophils, cells with enormous capacity for the generation of reactive oxidants and hence, susceptible to oxidative damage. (PMID:17938273)
• Strong candidate gene for schizophrenia; upregulated in lymphoblastoid cells of monozygotic twins. (PMID:18081029)
• The results demonstrate that in human lens epithelial cells MsrB1 may play important roles in regulating redox balance and mitigating endoplasmic reticulum stress. (PMID:22713178)
• MsrB1 plays important roles in protecting HLE cell mitochondria against oxidative damage and inhibits oxidative stress-induced apoptosis in diabetic cataracts by scavenging ROS. (PMID:23270945)
• FRET and co-IP assays demonstrated that Clu interacted with beta-amyloid peptide, a pathological protein of AD, which suggested a potential effect of SelR and Abeta with the aid of Clu. The interaction between SelR and Clu provides a novel avenue for further study on the mechanism of SelR in AD prevention. (PMID:23805218)
• Silencing the expression of the main Msr elements-MsrA, MsrB1, or MsrB2 exacerbates sensitivity toward oxidative stress. (PMID:23988788)
• MsrB1 protected human lens epithelial cells against the peroxynitrite-induced F-actin disruption. (PMID:24342607)
• Selenoprotein R Protects Human Lens Epithelial Cells against D-Galactose-Induced Apoptosis by Regulating Oxidative Stress and Endoplasmic Reticulum Stress (PMID:26875981)
• findings suggested that SelX played important roles in protecting LO2 cells against oxidative damage and reducing H2O2-induced apoptosis in liver cells. (PMID:26899321)
• In vivo, MsrB1 shRNAi can inhibit lung metastasis in metastasis model. In conclusion, MsrB1 regulates proliferation and invasion of u2os cells by affecting MAPK pathway and EMT, and MsrB1 gene may be a novel therapeutic target against tumors. (PMID:29395081)
• The selenoprotein methionine sulfoxide reductase B1 (MSRB1). (PMID:36084791)

Cross-species orthologs

5 orthologs

Organism	Symbol	Gene ID
danio_rerio	msrb1b	ENSDARG00000045160
mus_musculus	Msrb1	ENSMUSG00000075705
rattus_norvegicus	Msrb1	ENSRNOG00000055314
drosophila_melanogaster	MsrA	FBGN0000565
caenorhabditis_elegans		WBGENE00018393

Paralogs (3): MSRB2 (ENSG00000148450), MSRB3 (ENSG00000174099), MSRA (ENSG00000175806)

Protein

Protein identifiers

Methionine-R-sulfoxide reductase B1 — Q9NZV6 (reviewed: Q9NZV6)

Alternative names: Selenoprotein X

All UniProt accessions (3): Q9NZV6, H3BS64, H3BTT6

UniProt curated annotations — full annotation on UniProt →

Function. Methionine-sulfoxide reductase that specifically reduces methionine (R)-sulfoxide back to methionine. While in many cases, methionine oxidation is the result of random oxidation following oxidative stress, methionine oxidation is also a post-translational modification that takes place on specific residue. Acts as a regulator of actin assembly by reducing methionine (R)-sulfoxide mediated by MICALs (MICAL1, MICAL2 or MICAL3) on actin, thereby promoting filament repolymerization. Plays a role in innate immunity by reducing oxidized actin, leading to actin repolymerization in macrophages.

Subcellular location. Cytoplasm. Nucleus. Cytoskeleton.

Post-translational modifications. Truncated MSRB1/SEPX1 proteins produced by failed UGA/Sec decoding are ubiquitinated by some Cul2-RING E3 ubiquitin-protein ligase complexes (containing either PRAME, PRAMF6, PRAMF9 or FEM1C as substrate-recognition component).

Cofactor. Binds 1 zinc ion per subunit.

Similarity. Belongs to the MsrB Met sulfoxide reductase family.

RefSeq proteins (3): NP_001369193, NP_001369194, NP_057416* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR002579	Met_Sox_Rdtase_MsrB_dom	Domain
IPR011057	Mss4-like_sf	Homologous_superfamily
IPR052150	MsrB_Met_sulfoxide_reductase	Family

Pfam: PF01641

Enzyme classification (BRENDA):

• EC 1.8.4.12 — peptide-methionine (R)-S-oxide reductase (BRENDA: 101 organisms, 214 substrates, 7 inhibitors, 64 Km, 65 kcat entries)

Substrate kinetics (BRENDA)

19 substrates with measured Km, best-characterized 15. Km ranges are aggregated across organisms/conditions.

Substrate	Km (mM)	Measurements
THIOREDOXIN	0.004–7	9
L-METHIONINE-(R)-S-OXIDE	0.054–1.3	8
DABSYL-L-METHIONINE (R)-S-OXIDE	0.03–0.085	7
DABSYL-L-METHIONINE (R)-SULFOXIDE	0.02–0.06	6
N-ACETYL-L-METHIONINE-(R)-S-OXIDE	0.043–0.429	6
DITHIOTHREITOL	0.0091–2	4
L-METHIONINE (R)-SULFOXIDE	1.451–67	3
TRYPAREDOXIN I	0.0016–0.0021	3
ACETYL-L-METHIONINE (R)-SULFOXIDE N-METHYL ESTER	0.14–2.2	2
N-ACETYL-L-METHIONINE (R)-SULFOXIDE	0.049	2
(S)-1-NONEN-4-OL	1.2	1
CDSP32	0.0002	1
GLUTAREDOXIN	0.0028	1
GLUTAREDOXIN C4	0.0068	1
GLUTAREDOXIN S12	0.0005	1

Catalyzed reactions (Rhea), 2 shown:

• [thioredoxin]-disulfide + L-methionine + H2O = L-methionine (R)-S-oxide + [thioredoxin]-dithiol (RHEA:21260)
• L-methionyl-[protein] + [thioredoxin]-disulfide + H2O = L-methionyl-(R)-S-oxide-[protein] + [thioredoxin]-dithiol (RHEA:24164)

UniProt features (22 total): strand 10, binding site 4, helix 2, turn 2, chain 1, domain 1, active site 1, non-standard amino acid 1

Structure

Experimental structures (PDB)

1 structures.

PDB	Method	Resolution (Å)
3MAO	X-RAY DIFFRACTION	1.42

Predicted structure (AlphaFold)

No AlphaFold model available for Q9NZV6 — AlphaFold DB does not currently provide models for proteins above ~3000 aa.

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Catalytic / active sites (1): 95 (nucleophile)

Ligand- & substrate-binding residues (4): 23; 26; 71; 74

Function

Pathways and Gene Ontology

Reactome pathways

2 pathways

ID	Pathway
R-HSA-5676934	Protein repair
R-HSA-392499	Metabolism of proteins

MSigDB gene sets: 179 (showing top): GRAESSMANN_APOPTOSIS_BY_DOXORUBICIN_UP, GRAESSMANN_RESPONSE_TO_MC_AND_DOXORUBICIN_UP, DITTMER_PTHLH_TARGETS_UP, COUP_01, GOBP_DEFENSE_RESPONSE_TO_OTHER_ORGANISM, RICKMAN_TUMOR_DIFFERENTIATED_WELL_VS_POORLY_DN, KESHELAVA_MULTIPLE_DRUG_RESISTANCE, GOBP_ACTIN_FILAMENT_ORGANIZATION, PPAR_DR1_Q2, BROWN_MYELOID_CELL_DEVELOPMENT_UP, GOMF_ACTIN_BINDING, YAO_TEMPORAL_RESPONSE_TO_PROGESTERONE_CLUSTER_5, PARENT_MTOR_SIGNALING_UP, NIKOLSKY_BREAST_CANCER_16P13_AMPLICON, GOMF_OXIDOREDUCTASE_ACTIVITY_ACTING_ON_A_SULFUR_GROUP_OF_DONORS_DISULFIDE_AS_ACCEPTOR

GO Biological Process (4): actin filament polymerization (GO:0030041), protein repair (GO:0030091), innate immune response (GO:0045087), immune system process (GO:0002376)

GO Molecular Function (7): actin binding (GO:0003779), zinc ion binding (GO:0008270), peptide-methionine (R)-S-oxide reductase activity (GO:0033743), L-methionine (R)-S-oxide reductase activity (GO:0033745), protein binding (GO:0005515), oxidoreductase activity (GO:0016491), metal ion binding (GO:0046872)

GO Cellular Component (5): nucleus (GO:0005634), cytosol (GO:0005829), actin cytoskeleton (GO:0015629), cytoplasm (GO:0005737), cytoskeleton (GO:0005856)

Reactome top-level categories

Rollup of top-1 pathways:

Category	Pathways
Metabolism of proteins	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
oxidoreductase activity, acting on a sulfur group of donors, disulfide as acceptor	2
cellular anatomical structure	2
actin polymerization or depolymerization	1
protein polymerization	1
protein metabolic process	1
immune response	1
defense response to symbiont	1
biological_process	1
cytoskeletal protein binding	1
transition metal ion binding	1
catalytic activity, acting on a protein	1
binding	1
catalytic activity	1
cation binding	1
intracellular membrane-bounded organelle	1
cytoplasm	1
cytoskeleton	1
intracellular anatomical structure	1
intracellular membraneless organelle	1

Protein interactions and networks

STRING

1154 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
MSRB1	SELENOK	Q9Y6D0	865
MSRB1	SELENOO	Q9BVL4	842
MSRB1	SELENOT	P62341	837
MSRB1	GPX2	P18283	810
MSRB1	GPX3	P22352	810
MSRB1	SEPHS2	Q99611	808
MSRB1	SELENOS	Q9BQE4	802
MSRB1	SELENON	Q9NZV5	798
MSRB1	SELENOW	P63302	793
MSRB1	TXNRD2	Q9NNW7	792
MSRB1	SELENOH	Q8IZQ5	787
MSRB1	GPX7	Q96SL4	780
MSRB1	SELENOF	O60613	779
MSRB1	GPX6	P59796	771
MSRB1	TXNRD3	Q86VQ6	752

IntAct

34 interactions, top by confidence:

A	B	Type	Score
MSRB1	CLU	psi-mi:“MI:0915”(physical association)	0.670
MSRB1	CLU	psi-mi:“MI:2364”(proximity)	0.670
MSRB1	CLU	psi-mi:“MI:0407”(direct interaction)	0.670
APP	MSRB1	psi-mi:“MI:0915”(physical association)	0.600
APP	MSRB1	psi-mi:“MI:0407”(direct interaction)	0.600
IFT88	MSRB1	psi-mi:“MI:0915”(physical association)	0.560
CYSRT1	MSRB1	psi-mi:“MI:0915”(physical association)	0.560
INCA1	MSRB1	psi-mi:“MI:0915”(physical association)	0.560
TRIM27	MSRB1	psi-mi:“MI:0915”(physical association)	0.560
MSRB1	E2	psi-mi:“MI:0915”(physical association)	0.490
	MSRB1	psi-mi:“MI:0945”(oxidoreductase activity electron transfer reaction)	0.440
CLUH	MSRB1	psi-mi:“MI:0945”(oxidoreductase activity electron transfer reaction)	0.440
MSRB1	E2	psi-mi:“MI:0915”(physical association)	0.000
MSRB1	IFT88	psi-mi:“MI:0915”(physical association)	0.000
MSRB1	CYSRT1	psi-mi:“MI:0915”(physical association)	0.000
MSRB1	TRIM27	psi-mi:“MI:0915”(physical association)	0.000

BioGRID (18): MSRB1 (Affinity Capture-RNA), MSRB1 (Affinity Capture-MS), CLU (Two-hybrid), CLU (FRET), CLU (Affinity Capture-Western), MSRB1 (Affinity Capture-Western), MSRB1 (Reconstituted Complex), MSRB1 (Affinity Capture-RNA), MSRB1 (Two-hybrid), MSRB1 (Two-hybrid), MSRB1 (Two-hybrid), TRIM27 (Two-hybrid), MSRB1 (Affinity Capture-RNA), MSRB1 (Affinity Capture-RNA), MSRB1 (Two-hybrid)

ESM2 similar proteins: A0K833, A1E952, A5F6R2, A9AJS6, B1JTT6, B1YRN6, B4EBK9, B8GY23, C0M8H8, C0MDV8, C3LNU9, G2TRS2, O49707, P0DC42, P0DC43, P21220, P25566, P34436, P65447, P75129, Q0BEH0, Q1BH71, Q32GC7, Q39FG2, Q3MHL9, Q52KJ8, Q5R869, Q5XCD0, Q65ID2, Q6NW52, Q72EK2, Q7MMC4, Q802G6, Q84JT6, Q8D849, Q8GWF4, Q8P172, Q8VY86, Q92Y46, Q99ZV6

Diamond homologs: A1E952, A2SGN7, A3M4Q3, A4XVB1, B0BYW4, B0VC45, B0VR86, B1HZH4, B2HYT2, B7H3X2, B7I415, B9DNY9, C1DRM1, P14930, P25566, P34436, Q10L32, Q2YY44, Q3MHL9, Q46EH1, Q49XN4, Q4L6D3, Q52KJ8, Q5HPB4, Q5R869, Q6ADJ8, Q6AUK5, Q6FAL8, Q72NN2, Q802G6, Q84JT6, Q8BU85, Q8CSK6, Q8F7W8, Q8PWF5, Q8UGX7, Q9C5C8, Q9CJ17, Q9JLC3, Q9JWM8

SIGNOR signaling

0 interactions.

Disease & clinical

Clinical variants and AI predictions

ClinVar

32 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	25
Likely benign	3
Benign	0

Top pathogenic / likely-pathogenic (0)

SpliceAI

682 predictions. Top by Δscore:

Variant	Effect	Δscore
16:1940772:GCTCA:G	donor_loss	1.0000
16:1940773:CTCA:C	donor_loss	1.0000
16:1940774:TCA:T	donor_loss	1.0000
16:1940775:CA:C	donor_loss	1.0000
16:1940776:A:AT	donor_loss	1.0000
16:1940777:CCTT:C	donor_loss	1.0000
16:1940890:CAC:C	acceptor_gain	1.0000
16:1940892:CCTGG:C	acceptor_loss	1.0000
16:1941254:CACCT:C	donor_loss	1.0000
16:1941255:A:AC	donor_gain	1.0000
16:1941255:AC:A	donor_gain	1.0000
16:1941255:ACC:A	donor_loss	1.0000
16:1941256:C:CC	donor_gain	1.0000
16:1941256:CC:C	donor_gain	1.0000
16:1941401:AACGC:A	acceptor_gain	1.0000
16:1941402:ACGC:A	acceptor_gain	1.0000
16:1941403:CGC:C	acceptor_gain	1.0000
16:1941403:CGCC:C	acceptor_gain	1.0000
16:1941404:GC:G	acceptor_gain	1.0000
16:1941405:CCTG:C	acceptor_gain	1.0000
16:1941406:C:A	acceptor_loss	1.0000
16:1941406:C:CC	acceptor_gain	1.0000
16:1941408:G:C	acceptor_gain	1.0000
16:1941408:G:GC	acceptor_gain	1.0000
16:1941411:G:C	acceptor_gain	1.0000
16:1941411:G:GC	acceptor_gain	1.0000
16:1940891:AC:A	acceptor_gain	0.9900
16:1940892:CC:C	acceptor_gain	0.9900
16:1940893:C:CC	acceptor_gain	0.9900
16:1940894:T:C	acceptor_loss	0.9900

AlphaMissense

0 scored. Top likely-pathogenic:

dbSNP variants (sampled 300 via entrez): RS1000252205 (16:1944802 G>T), RS1000935295 (16:1941688 C>T), RS1001244135 (16:1943521 G>C), RS1001317448 (16:1939397 C>A), RS1001327302 (16:1939196 G>C), RS1001608027 (16:1940250 G>A), RS1002045275 (16:1945123 A>C), RS1002058565 (16:1939922 C>A), RS1002344436 (16:1938016 G>A,C), RS1002623251 (16:1942605 C>T), RS1002872371 (16:1944386 GAGCTGACTCAGCGCAAGAAGAC>G), RS1002997510 (16:1940159 C>T), RS1003013946 (16:1941514 G>A), RS1003322713 (16:1944619 C>A,T), RS1003609358 (16:1942681 G>A)

Disease associations

OMIM: gene MIM:606216 | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

1 associations (top):

Study	Trait	p-value
GCST003139_19	Glomerular filtration rate in chronic kidney disease	5.000000e-06

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

39 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Valproic Acid	increases methylation, affects expression, increases expression	3
Acetaminophen	decreases expression	2
Tobacco Smoke Pollution	increases expression	2
Aflatoxin B1	affects expression, decreases expression	2
aristolochic acid I	increases expression	1
selenomethylselenocysteine	increases expression	1
triphenyl phosphate	affects expression	1
uranyl acetate	affects expression	1
beta-lapachone	increases expression, decreases expression	1
arsenite	increases reaction, affects binding	1
sulforaphane	increases expression	1
cupric chloride	increases expression	1
beta-methylcholine	affects expression	1
di-n-butylphosphoric acid	affects expression	1
K 7174	decreases expression	1
abrine	decreases expression	1
Temozolomide	increases expression	1
Sunitinib	decreases expression	1
Leflunomide	decreases expression	1
Air Pollutants	decreases expression, increases abundance	1
Air Pollutants, Occupational	decreases expression	1
Atrazine	decreases expression	1
Benzo(a)pyrene	decreases expression	1
Estradiol	affects expression	1
Ethyl Methanesulfonate	decreases expression	1
Formaldehyde	decreases expression	1
Lead	affects expression	1
Methyl Methanesulfonate	decreases expression	1
Nickel	decreases expression	1
Smoke	decreases expression	1

Cellosaurus cell lines

1 cell lines: 1 cancer cell line

First 10 cell lines (id-ordered, not curated):

Cellosaurus	Name	Category	Sex
CVCL_E2CS	HAP1 MSRB1 (-)	Cancer cell line	Male

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.