MTG2

Summary

MTG2 (mitochondrial ribosome associated GTPase 2, HGNC:16239) is a protein-coding gene on chromosome 20q13.33, encoding Mitochondrial ribosome-associated GTPase 2 (Q9H4K7). Plays a role in the regulation of the mitochondrial ribosome assembly and of translational activity. It is a selective cancer dependency (DepMap: 50.4% of cell lines).

Small G proteins, such as GTPBP5, act as molecular switches that play crucial roles in the regulation of fundamental cellular processes such as protein synthesis, nuclear transport, membrane trafficking, and signal transduction (Hirano et al., 2006 [PubMed 17054726]).

Source: NCBI Gene 26164 — RefSeq curated summary.

At a glance

• GWAS associations: 3
• Clinical variants (ClinVar): 106 total
• Cancer dependency (DepMap): dependent in 50.4% of screened cell lines
• MANE Select transcript: NM_015666

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:16239
Approved symbol	MTG2
Name	mitochondrial ribosome associated GTPase 2
Location	20q13.33
Locus type	gene with protein product
Status	Approved
Aliases	FLJ10741, dJ1005F21.2, ObgH1
Ensembl gene	ENSG00000101181
Ensembl biotype	protein_coding
OMIM	610919
Entrez	26164

Gene structure

Transcript identifiers

Ensembl transcripts: 21 — 13 protein_coding, 7 protein_coding_CDS_not_defined, 1 nonsense_mediated_decay

ENST00000370823, ENST00000448254, ENST00000461411, ENST00000466099, ENST00000466933, ENST00000467101, ENST00000471352, ENST00000471962, ENST00000472005, ENST00000488748, ENST00000881344, ENST00000881345, ENST00000881346, ENST00000881347, ENST00000881348, ENST00000881349, ENST00000931516, ENST00000931517, ENST00000948274, ENST00000948275, ENST00000948276

RefSeq mRNA: 3 — MANE Select: NM_015666 NM_001384347, NM_001384348, NM_015666

CCDS: CCDS13492

Canonical transcript exons

ENST00000370823 — 7 exons

Exon	Start	End
ENSE00001896190	62183028	62183057
ENSE00003462050	62200683	62203568
ENSE00003484090	62198634	62198852
ENSE00003556400	62195802	62195949
ENSE00003641175	62193416	62193624
ENSE00003655413	62199119	62199257
ENSE00003666306	62197852	62197967

Expression profiles

Bgee: expression breadth ubiquitous, 223 present calls, max score 94.19.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 5.5526 / max 41.6014, expressed in 1751 samples.

FANTOM5 promoters (1 alternative TSS)

Promoter ID	TPM avg	Samples expressed
185707	5.5526	1751

Top tissues by expression

244 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
cerebellar hemisphere	UBERON:0002245	94.19	gold quality
right hemisphere of cerebellum	UBERON:0014890	94.13	gold quality
right lobe of liver	UBERON:0001114	94.05	gold quality
cerebellar cortex	UBERON:0002129	94.01	gold quality
hindlimb stylopod muscle	UBERON:0004252	92.97	gold quality
apex of heart	UBERON:0002098	92.84	gold quality
adenohypophysis	UBERON:0002196	92.73	gold quality
cerebellum	UBERON:0002037	92.53	gold quality
gastrocnemius	UBERON:0001388	92.38	gold quality
right adrenal gland	UBERON:0001233	92.10	gold quality
muscle of leg	UBERON:0001383	91.92	gold quality
left adrenal gland	UBERON:0001234	91.85	gold quality
pituitary gland	UBERON:0000007	91.69	gold quality
right lobe of thyroid gland	UBERON:0001119	91.68	gold quality
left adrenal gland cortex	UBERON:0035825	91.66	gold quality
right adrenal gland cortex	UBERON:0035827	91.56	gold quality
mucosa of transverse colon	UBERON:0004991	91.34	gold quality
right testis	UBERON:0004534	90.89	gold quality
left lobe of thyroid gland	UBERON:0001120	90.81	gold quality
sural nerve	UBERON:0015488	90.78	gold quality
left testis	UBERON:0004533	90.64	gold quality
tibial nerve	UBERON:0001323	90.61	gold quality
granulocyte	CL:0000094	90.49	gold quality
metanephros cortex	UBERON:0010533	90.44	gold quality
lower esophagus mucosa	UBERON:0035834	90.42	gold quality
right frontal lobe	UBERON:0002810	90.20	gold quality
adrenal gland	UBERON:0002369	90.19	gold quality
right ovary	UBERON:0002118	90.15	gold quality
lower esophagus muscularis layer	UBERON:0035833	90.11	gold quality
lower esophagus	UBERON:0013473	90.10	gold quality

Single-cell (SCXA)

Detected in 2 experiment(s), a significant marker in 1.

Experiment	Marker?	Max mean expression
E-ANND-3	yes	3.72
E-MTAB-6386	no	215.10

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

32 targeting MTG2, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-4283	100.00	66.42	2097
HSA-MIR-4534	99.99	66.58	1907
HSA-MIR-8068	99.98	73.85	2376
HSA-MIR-6778-3P	99.96	67.29	2693
HSA-MIR-8082	99.95	67.27	1170
HSA-MIR-6809-3P	99.91	71.45	3814
HSA-MIR-4753-3P	99.90	71.03	3786
HSA-MIR-6887-3P	99.66	67.83	1778
HSA-MIR-497-3P	99.61	69.71	1990
HSA-MIR-4441	99.49	66.56	3216
HSA-MIR-516A-3P	99.46	67.96	1378
HSA-MIR-516B-3P	99.46	67.96	1378
HSA-MIR-4251	99.40	69.19	3363
HSA-MIR-4284	99.36	65.25	1293
HSA-MIR-504-3P	99.30	67.18	1745
HSA-MIR-149-5P	99.25	67.16	1315
HSA-MIR-3152-3P	99.10	66.35	678
HSA-MIR-140-3P	99.04	67.69	1324
HSA-MIR-589-5P	98.72	66.96	927
HSA-MIR-4726-3P	98.49	63.89	1385
HSA-MIR-3155A	98.16	66.09	965
HSA-MIR-3155B	98.16	66.09	965
HSA-MIR-211-3P	98.14	66.77	1052
HSA-MIR-4640-5P	97.42	66.33	1543
HSA-MIR-4726-5P	97.24	65.67	1299
HSA-MIR-122-5P	97.23	64.92	1024
HSA-MIR-10398-5P	97.12	64.94	1051
HSA-MIR-34A-3P	96.80	67.70	805
HSA-MIR-1226-5P	96.50	65.28	643
HSA-MIR-6782-5P	96.45	64.42	612

Functional genomics

DepMap (CRISPR cell-line fitness): dependent in 50.4% of screened cell lines.

Literature-anchored findings (GeneRIF, showing 5)

• Knock-down of ObgH1 by RNAi induced mitochondria elongation, whereas knock-down of ObgH2 resulted in the disorganization of the nucleolar architecture. (PMID:17054726)
• GTPBP5 bears further study as a cause of TEF/EA accompanied by other malformations. (PMID:21608104)
• The results suggested that ObgH1 functions with the large subunit of the mitochondrial ribosome, and are involved in both the translation and assembly of respiratory complexes. (PMID:23396448)
• Human GTPBP5 (MTG2) fuels mitoribosome large subunit maturation by facilitating 16S rRNA methylation. (PMID:32652011)
• Human GTPBP5 is involved in the late stage of mitoribosome large subunit assembly. (PMID:33283228)

Cross-species orthologs

5 orthologs

Organism	Symbol	Gene ID
danio_rerio	mtg2	ENSDARG00000063574
mus_musculus	Mtg2	ENSMUSG00000039069
rattus_norvegicus	Mtg2	ENSRNOG00000059919
drosophila_melanogaster	CG13390	FBGN0032031
caenorhabditis_elegans	M01E5.2	WBGENE00010805

Paralogs (4): GTPBP10 (ENSG00000105793), GTPBP4 (ENSG00000107937), DRG2 (ENSG00000108591), DRG1 (ENSG00000185721)

Protein

Protein identifiers

Mitochondrial ribosome-associated GTPase 2 — Q9H4K7 (reviewed: Q9H4K7)

Alternative names: GTP-binding protein 5, Protein obg homolog 1

All UniProt accessions (3): Q9H4K7, B4DRC1, Q5JXJ0

UniProt curated annotations — full annotation on UniProt →

Function. Plays a role in the regulation of the mitochondrial ribosome assembly and of translational activity. Displays GTPase activity. Involved in the ribosome maturation process.

Subunit / interactions. Associates with the mitochondrial ribosome large subunit; the association occurs in a GTP-dependent manner.

Subcellular location. Mitochondrion. Mitochondrion inner membrane.

Similarity. Belongs to the TRAFAC class OBG-HflX-like GTPase superfamily. OBG GTPase family.

Isoforms (2)

UniProt ID	Names	Canonical?
Q9H4K7-1	1	yes
Q9H4K7-2	2

RefSeq proteins (3): NP_001371276, NP_001371277, NP_056481* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR005225	Small_GTP-bd	Domain
IPR006073	GTP-bd	Domain
IPR006169	GTP1_OBG_dom	Domain
IPR014100	GTP-bd_Obg/CgtA	Family
IPR027417	P-loop_NTPase	Homologous_superfamily
IPR031167	G_OBG	Domain
IPR036726	GTP1_OBG_dom_sf	Homologous_superfamily
IPR045086	OBG_GTPase	Family

Pfam: PF01018, PF01926

UniProt features (16 total): binding site 7, sequence variant 3, domain 2, region of interest 2, chain 1, splice variant 1

Structure

Experimental structures (PDB)

4 structures.

PDB	Method	Resolution (Å)
7OF7	ELECTRON MICROSCOPY	2.5
7OF5	ELECTRON MICROSCOPY	2.9
7O9K	ELECTRON MICROSCOPY	3.1
7ODT	ELECTRON MICROSCOPY	3.1

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q9H4K7-F1	75.02	0.28

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Ligand- & substrate-binding residues (7): 345–348; 371–373; 231–238; 238; 256–260; 258; 278–281

Function

Pathways and Gene Ontology

Reactome pathways

0 pathways

MSigDB gene sets: 101 (showing top): GOBP_RIBOSOME_BIOGENESIS, GOBP_RESPIRATORY_GASEOUS_EXCHANGE_BY_RESPIRATORY_SYSTEM, GOBP_REGULATION_OF_RESPIRATORY_SYSTEM_PROCESS, GOBP_MITOCHONDRIAL_TRANSLATION, GOBP_RESPIRATORY_SYSTEM_PROCESS, GOBP_RIBOSOME_ASSEMBLY, GOBP_TRANSLATION, GOBP_POST_TRANSCRIPTIONAL_REGULATION_OF_GENE_EXPRESSION, GOBP_RIBOSOMAL_LARGE_SUBUNIT_ASSEMBLY, GOBP_PROTEIN_RNA_COMPLEX_ORGANIZATION, GOCC_MITOCHONDRIAL_ENVELOPE, GOBP_ORGANELLE_ASSEMBLY, GOBP_REGULATION_OF_SYSTEM_PROCESS, GOBP_RIBONUCLEOPROTEIN_COMPLEX_BIOGENESIS, GOBP_RIBOSOMAL_LARGE_SUBUNIT_BIOGENESIS

GO Biological Process (5): regulation of respiratory system process (GO:0044065), regulation of mitochondrial translation (GO:0070129), mitochondrial large ribosomal subunit assembly (GO:1902775), regulation of translation (GO:0006417), ribosome biogenesis (GO:0042254)

GO Molecular Function (5): magnesium ion binding (GO:0000287), GTPase activity (GO:0003924), GTP binding (GO:0005525), nucleotide binding (GO:0000166), metal ion binding (GO:0046872)

GO Cellular Component (5): mitochondrion (GO:0005739), mitochondrial inner membrane (GO:0005743), mitochondrial matrix (GO:0005759), mitochondrial ribosome (GO:0005761), membrane (GO:0016020)

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
respiratory system process	1
regulation of respiratory gaseous exchange	1
regulation of system process	1
regulation of translation	1
mitochondrial translation	1
regulation of mitochondrial gene expression	1
ribosomal large subunit assembly	1
mitochondrial ribosome assembly	1
translation	1
post-transcriptional regulation of gene expression	1
regulation of protein metabolic process	1
ribonucleoprotein complex biogenesis	1
metal ion binding	1
ribonucleoside triphosphate phosphatase activity	1
guanyl ribonucleotide binding	1
purine ribonucleoside triphosphate binding	1
nucleoside phosphate binding	1
heterocyclic compound binding	1
cation binding	1
cytoplasm	1
intracellular membrane-bounded organelle	1
organelle inner membrane	1
mitochondrial membrane	1
mitochondrion	1
intracellular organelle lumen	1
organellar ribosome	1
mitochondrial matrix	1
cellular anatomical structure	1

Protein interactions and networks

STRING

1714 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
MTG2	MTG1	Q9BT17	880
MTG2	NOA1	Q8NC60	869
MTG2	MALSU1	Q96EH3	844
MTG2	MRM2	Q9UI43	785
MTG2	GTPBP6	O43824	747
MTG2	MTERF4	Q7Z6M4	739
MTG2	ERAL1	O75616	730
MTG2	GTPBP8	Q8N3Z3	712
MTG2	NSUN4	Q96CB9	697
MTG2	MRM1	Q6IN84	693
MTG2	DDX28	Q9NUL7	678
MTG2	MRM3	Q9HC36	650
MTG2	RPUSD4	Q96CM3	585
MTG2	MTERF3	Q96E29	571
MTG2	NGRN	Q9NPE2	564

IntAct

63 interactions, top by confidence:

A	B	Type	Score
NPM2	NPM3	psi-mi:“MI:0914”(association)	0.800
CFTR	ESYT2	psi-mi:“MI:0914”(association)	0.710
HSPD1	NUDT19	psi-mi:“MI:0914”(association)	0.710
TOMM22	XRCC3	psi-mi:“MI:0914”(association)	0.640
NPM1	NVL	psi-mi:“MI:0914”(association)	0.610
CRYZ	MMUT	psi-mi:“MI:0914”(association)	0.560
BPNT1	GTPBP10	psi-mi:“MI:0914”(association)	0.530
CD79A	METTL15	psi-mi:“MI:0914”(association)	0.530
LRP1	NME4	psi-mi:“MI:0914”(association)	0.530
MTG2	HSPD1	psi-mi:“MI:0914”(association)	0.530
ATP5F1D	NDUFB5	psi-mi:“MI:0914”(association)	0.530
NDUFAB1	MIEF1	psi-mi:“MI:0915”(physical association)	0.490
CFTR	PLEKHG3	psi-mi:“MI:0914”(association)	0.480
MTG2	TAB1	psi-mi:“MI:0915”(physical association)	0.370
MTG2	MAPK6	psi-mi:“MI:0915”(physical association)	0.370
NTAQ1	SBNO1	psi-mi:“MI:0914”(association)	0.350
GLMP	RTL8C	psi-mi:“MI:0914”(association)	0.350
OXLD1	NUDT19	psi-mi:“MI:0914”(association)	0.350

BioGRID (316): MTG2 (Affinity Capture-MS), MTG2 (Affinity Capture-MS), MTG2 (Affinity Capture-MS), PREP (Affinity Capture-MS), MTG2 (Affinity Capture-MS), MTG2 (Affinity Capture-MS), MTG2 (Affinity Capture-MS), MTG2 (Affinity Capture-MS), MTG2 (Affinity Capture-MS), MTG2 (Affinity Capture-MS), MTG2 (Affinity Capture-MS), MTG2 (Affinity Capture-MS), HSPD1 (Affinity Capture-MS), CLPP (Affinity Capture-MS), MTIF2 (Affinity Capture-MS)

ESM2 similar proteins: A4D1E9, A4IHT9, A6QLJ3, A6QPU5, A9JTX2, B1H116, B3RXR7, E1BMP7, E3TDS3, I0IUP3, O23617, O80738, P06801, P13697, P31754, P32296, P51530, Q0E671, Q16798, Q1LZ83, Q29K06, Q2KI15, Q2TAA5, Q3MHG6, Q4V7N2, Q503J2, Q5M8V6, Q5R7Z6, Q5RDW1, Q5U528, Q5VV42, Q6DHF7, Q6NS23, Q6NS26, Q6P4Y0, Q6PI48, Q7SYM0, Q8BIP0, Q8BMF3, Q8C3X4

Diamond homologs: A0L4B2, A0LPF9, A1RY30, A2BLW4, A5EY43, A5GNK6, A5IKX2, A6H294, A6TQJ6, A7HIF8, A8FRU4, A9A623, A9H253, B0K414, B0KAB8, B0T310, B1I5V8, B1KGH1, B1LA53, B1ZZ37, B2FNR1, B2U9V3, B2UPE7, B3QZ96, B3R1J8, B4RD64, B4SSW8, B4UIU2, B5EJF7, B7JC34, B8FUR9, B8I179, B8JBP2, B9DNE7, B9KZ43, C0QLE9, C1F407, C5BLV6, C6E2H7, D3FTV4

SIGNOR signaling

0 interactions.

Disease & clinical

Clinical variants and AI predictions

ClinVar

106 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	84
Likely benign	13
Benign	0

Top pathogenic / likely-pathogenic (0)

SpliceAI

1470 predictions. Top by Δscore:

Variant	Effect	Δscore
20:62197850:A:AG	acceptor_gain	1.0000
20:62197851:G:GG	acceptor_gain	1.0000
20:62198848:GAATG:G	donor_gain	1.0000
20:62198853:G:GG	donor_gain	1.0000
20:62198854:T:G	donor_loss	1.0000
20:62199116:CAG:C	acceptor_loss	1.0000
20:62199117:A:C	acceptor_loss	1.0000
20:62199118:G:T	acceptor_loss	1.0000
20:62200677:CTGCA:C	acceptor_loss	1.0000
20:62200678:TGCAG:T	acceptor_loss	1.0000
20:62200679:GCAG:G	acceptor_loss	1.0000
20:62200680:CAG:C	acceptor_loss	1.0000
20:62200681:A:AG	acceptor_gain	1.0000
20:62200681:A:G	acceptor_loss	1.0000
20:62200682:G:GG	acceptor_gain	1.0000
20:62200682:GT:G	acceptor_gain	1.0000
20:62188947:T:G	donor_gain	0.9900
20:62195800:A:AG	acceptor_gain	0.9900
20:62195801:G:GG	acceptor_gain	0.9900
20:62195801:GAAAA:G	acceptor_gain	0.9900
20:62197621:C:G	donor_gain	0.9900
20:62197851:GTT:G	acceptor_gain	0.9900
20:62198631:CA:C	acceptor_loss	0.9900
20:62198632:A:AG	acceptor_gain	0.9900
20:62198633:G:GG	acceptor_gain	0.9900
20:62199117:A:AG	acceptor_gain	0.9900
20:62199117:AGGT:A	acceptor_gain	0.9900
20:62199117:AGGTG:A	acceptor_gain	0.9900
20:62199118:G:GG	acceptor_gain	0.9900
20:62199118:GGT:G	acceptor_gain	0.9900

AlphaMissense

2582 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
20:62199197:T:C	F256L	0.991
20:62199199:C:A	F256L	0.991
20:62199199:C:G	F256L	0.991
20:62200742:T:C	F296L	0.989
20:62200744:C:A	F296L	0.989
20:62200744:C:G	F296L	0.989
20:62198635:T:A	V157D	0.984
20:62198741:C:A	N192K	0.980
20:62198741:C:G	N192K	0.980
20:62200894:G:C	K346N	0.979
20:62200894:G:T	K346N	0.979
20:62195938:T:A	V114D	0.977
20:62200839:T:C	L328P	0.976
20:62199141:A:T	K237M	0.974
20:62195836:T:A	V80D	0.972
20:62198710:C:A	A182D	0.972
20:62195871:T:C	F92L	0.971
20:62195873:C:A	F92L	0.971
20:62195873:C:G	F92L	0.971
20:62199142:G:C	K237N	0.970
20:62199142:G:T	K237N	0.970
20:62199228:T:A	V266D	0.970
20:62200685:G:C	A277P	0.970
20:62199140:A:G	K237E	0.968
20:62200891:C:A	N345K	0.968
20:62200891:C:G	N345K	0.968
20:62199150:T:C	L240P	0.967
20:62200837:A:C	E327D	0.967
20:62200837:A:T	E327D	0.967
20:62198737:G:T	G191V	0.966

dbSNP variants (sampled 300 via entrez): RS1000278150 (20:62183166 GGAGAGGCCCCGGCCTAGGAGCT>G), RS1000574003 (20:62195414 A>G), RS1000610753 (20:62201606 G>A), RS1000635810 (20:62191645 G>A,C), RS1000770872 (20:62187839 T>C), RS1000898610 (20:62182883 G>A,C), RS1000950571 (20:62182992 G>A), RS1001195956 (20:62197074 A>G), RS1001293563 (20:62196672 A>G), RS1001352211 (20:62182401 T>G), RS1001518392 (20:62181830 T>C), RS1001619479 (20:62186436 G>A), RS1001635995 (20:62195065 G>A), RS1001662768 (20:62196539 GCACA>G), RS1001688381 (20:62194925 A>G)

Disease associations

OMIM: gene MIM:610919 | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

3 associations (top):

Study	Trait	p-value
GCST001942_4	Prostate cancer	4.000000e-08
GCST008097_11	Bisphosphonate-associated atypical femoral fracture	2.000000e-06
GCST012490_386	Femur bone mineral density x serum urate levels interaction	4.000000e-08

EFO canonical traits (3, from GWAS)

EFO ID	Trait name
EFO:0009958	response to bisphosphonate
EFO:0009960	atypical femoral fracture
EFO:0004531	urate measurement

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

21 total (human), top 21 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
sodium arsenite	decreases expression	2
aristolochic acid I	increases expression	1
FR900359	increases phosphorylation	1
triphenyl phosphate	affects expression	1
pirinixic acid	affects binding, increases activity, increases expression	1
di-n-butylphosphoric acid	affects expression	1
CGP 52608	affects binding, increases reaction	1
corosolic acid	decreases expression	1
abrine	increases expression	1
bisphenol S	affects cotreatment, decreases expression	1
Arsenic	affects expression	1
Dexamethasone	decreases expression, affects cotreatment	1
Hydrogen Peroxide	affects cotreatment, decreases expression, increases expression	1
Indomethacin	affects cotreatment, decreases expression	1
Ribonucleotides	affects binding	1
Smoke	decreases expression	1
Theophylline	decreases expression, affects cotreatment	1
Vincristine	increases expression	1
1-Methyl-3-isobutylxanthine	affects cotreatment, decreases expression	1
Cadmium Chloride	increases expression	1
Lactic Acid	decreases expression	1

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.