MUC8

Summary

MUC8 (mucin 8, HGNC:7519) is a protein-coding gene on chromosome 12q24.33.

At a glance

• GWAS associations: 1
• Clinical variants (ClinVar): 8 total

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:7519
Approved symbol	MUC8
Name	mucin 8
Location	12q24.33
Locus type	gene with protein product
Status	Approved
OMIM	601932
Entrez	100129528

Gene structure

Transcript identifiers

Ensembl transcripts: 0

RefSeq mRNA: 0 — MANE Select: None

Canonical transcript exons

None — 0 exons

Expression profiles

Top tissues by expression

0 total, by Bgee expression score (0-100, higher = more expressed):

Regulation

Is transcription factor: no

Literature-anchored findings (GeneRIF, showing 13)

• Gene induction by interleukin-1 beta is mediated by a sequential ERK MAPK/RSK1/CREB cascade pathway in human airway epithelial cells (PMID:12842905)
• MUC8 may play an important role in the pathogenesis of sinus hypersecretion in chronic rhinosinusitis. (PMID:15330148)
• cAMP-response element at the -803 region of the MUC8 promoter is an important site of PGE2-induced MUC8 gene expression (PMID:15615708)
• These findings suggest that IL-1beta, increases ciliogenesis in NHMEE cells and that MUC8 protein may play a role in this process (PMID:15966694)
• MUC1, MUC5B and MUC8, but not MUC2 or MUC5AC, are up-regulated in endometrial adenocarcinomas (PMID:16188033)
• Reflux laryngitis is associated with down-regulation of mucin gene expression. (PMID:18834073)
• SOCS3 negatively regulates IL-1beta-induced MUC8 gene expression. (PMID:18952062)
• Data confirmed an essential role for AP2 alpha in MUC8 gene expression. (PMID:20564234)
• these results suggest that HMGB1 induces MUC8 expression in a JNK and PI3K/Akt signaling pathway-dependent manner but that HMGB1 acts in an ROS-independent manner. (PMID:22521432)
• These results suggest that visfatin induces MUC8 and MUC5B expression through p38 MAPK/ROS/NF-kappaB signaling pathway in human airway epithelial cells. (PMID:24885580)
• ATP increased P2Y-mediated upregulation of MUC8 expression; however, IL-1alpha significantly decreased the extent to which ATP/P2Y upregulated MUC8 expression. (PMID:25575516)
• The results of this study suggest for the first time that cadmium induces MUC8 expression via TLR4-mediated ERK1/2 and p38 MAPK signaling pathway in human airway epithelial cells (PMID:26782637)
• Results revealed a genetic association between MUC8 and COPD, and that the specific short minisatellite alleles (2/2) of MUC8-MS5 may be a risk factor for COPD. (PMID:29892905)

Cross-species orthologs

0 orthologs

Protein

Protein identifiers

Canonical reviewed UniProt: None (reviewed: )

All UniProt accessions (0):

RefSeq proteins (0): (*=MANE)

Domains & families (InterPro)

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Function

Pathways and Gene Ontology

Reactome pathways

0 pathways

MSigDB gene sets: 0 (showing top):

GO Biological Process (0):

GO Molecular Function (0):

GO Cellular Component (0):

Protein interactions and networks

STRING

0 interactions, top by confidence (×1000):

IntAct

0 interactions, top by confidence:

SIGNOR signaling

0 interactions.

Disease & clinical

Clinical variants and AI predictions

ClinVar

8 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	0
Likely benign	8
Benign	0

Top pathogenic / likely-pathogenic (0)

SpliceAI

0 predictions. Top by Δscore:

AlphaMissense

0 scored. Top likely-pathogenic:

dbSNP variants (sampled 300 via entrez): RS1000145424 (12:132476087 A>G), RS1000767742 (12:132476330 C>T), RS1001409229 (12:132471547 C>T), RS1001493895 (12:132475974 G>A,C), RS1002723519 (12:132474504 G>A), RS1003156021 (12:132474514 G>C), RS1003167522 (12:132474399 C>A,G), RS1004386377 (12:132474196 C>T), RS1004664000 (12:132472670 T>A,C), RS1005193245 (12:132476504 G>A,T), RS1006078625 (12:132471837 G>A), RS1006124916 (12:132471264 C>T), RS1006246392 (12:132476112 CGGTCATCACGGGT>C,CGGTCATCACGGGTGGTCATCACGGGT), RS1006337050 (12:132471559 T>A,C), RS1006618575 (12:132476358 C>T)

Disease associations

OMIM: gene MIM:601932 | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

1 associations (top):

Study	Trait	p-value
GCST90002395_149	Mean platelet volume	2.000000e-18

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

3 total (human), top 3 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
SB 203580	decreases reaction, increases expression	1
U 0126	decreases reaction, increases expression	1
Cadmium Chloride	increases expression, increases secretion, increases reaction, decreases reaction	1

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.