MXD1

Summary

MXD1 (MAX dimerization protein 1, HGNC:6761) is a protein-coding gene on chromosome 2p13.3, encoding Max dimerization protein 1 (Q05195). Component of a transcriptional repressor complex together with MAX.

This gene encodes a member of the MYC/MAX/MAD network of basic helix-loop-helix leucine zipper transcription factors. The MYC/MAX/MAD transcription factors mediate cellular proliferation, differentiation and apoptosis. The encoded protein antagonizes MYC-mediated transcriptional activation of target genes by competing for the binding partner MAX and recruiting repressor complexes containing histone deacetylases. Mutations in this gene may play a role in acute leukemia, and the encoded protein is a potential tumor suppressor. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene.

Source: NCBI Gene 4084 — RefSeq curated summary.

At a glance

• GWAS associations: 10
• Clinical variants (ClinVar): 9 total
• Transcription factor: yes — 32 downstream targets (CollecTRI)
• MANE Select transcript: NM_002357

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:6761
Approved symbol	MXD1
Name	MAX dimerization protein 1
Location	2p13.3
Locus type	gene with protein product
Status	Approved
Aliases	MAD1, bHLHc58
Ensembl gene	ENSG00000059728
Ensembl biotype	protein_coding
OMIM	600021
Entrez	4084

Gene structure

Transcript identifiers

Ensembl transcripts: 8 — 5 protein_coding, 1 nonsense_mediated_decay, 1 retained_intron, 1 protein_coding_CDS_not_defined

ENST00000264444, ENST00000409442, ENST00000410000, ENST00000435990, ENST00000465446, ENST00000540449, ENST00000876182, ENST00000876183

RefSeq mRNA: 3 — MANE Select: NM_002357 NM_001202513, NM_001202514, NM_002357

CCDS: CCDS1896, CCDS56123

Canonical transcript exons

ENST00000264444 — 6 exons

Exon	Start	End
ENSE00000759552	69935351	69935465
ENSE00000759553	69937235	69937394
ENSE00000846481	69938097	69942945
ENSE00001006489	69921736	69921765
ENSE00001885295	69915109	69915403
ENSE00003549842	69916121	69916220

Expression profiles

Bgee: expression breadth ubiquitous, 270 present calls, max score 99.71.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 45.3489 / max 4551.2652, expressed in 1795 samples.

FANTOM5 promoters (16 alternative TSS)

Promoter ID	TPM avg	Samples expressed
20783	30.4618	1460
20782	10.5276	1690
20802	1.6152	541
20798	0.3330	70
20795	0.3159	89
20799	0.3124	103
20796	0.2957	92
20789	0.2686	95
20794	0.2469	66
20800	0.2458	88

Top tissues by expression

295 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
buccal mucosa cell	CL:0002336	99.71	gold quality
esophagus squamous epithelium	UBERON:0006920	99.22	gold quality
lower esophagus mucosa	UBERON:0035834	99.09	gold quality
pharyngeal mucosa	UBERON:0000355	99.05	gold quality
oocyte	CL:0000023	98.97	gold quality
secondary oocyte	CL:0000655	98.77	gold quality
amniotic fluid	UBERON:0000173	97.88	gold quality
blood	UBERON:0000178	97.88	gold quality
epithelium of esophagus	UBERON:0001976	97.51	gold quality
oral cavity	UBERON:0000167	96.78	gold quality
jejunal mucosa	UBERON:0000399	96.36	gold quality
esophagus mucosa	UBERON:0002469	95.58	gold quality
colonic mucosa	UBERON:0000317	95.48	gold quality
mucosa of sigmoid colon	UBERON:0004993	95.36	gold quality
gingiva	UBERON:0001828	95.26	gold quality
body of tongue	UBERON:0011876	95.10	gold quality
gingival epithelium	UBERON:0001949	94.76	gold quality
trabecular bone tissue	UBERON:0002483	94.01	gold quality
monocyte	CL:0000576	93.49	gold quality
bone marrow	UBERON:0002371	93.44	gold quality
leukocyte	CL:0000738	93.24	gold quality
mononuclear cell	CL:0000842	93.20	gold quality
rectum	UBERON:0001052	92.00	gold quality
right lung	UBERON:0002167	91.65	gold quality
duodenum	UBERON:0002114	91.53	gold quality
tongue	UBERON:0001723	91.33	gold quality
sperm	CL:0000019	91.31	gold quality
vagina	UBERON:0000996	91.20	gold quality
superior surface of tongue	UBERON:0007371	91.10	gold quality
middle temporal gyrus	UBERON:0002771	90.05	gold quality

Single-cell (SCXA)

Detected in 8 experiment(s), a significant marker in 8.

Experiment	Marker?	Max mean expression
E-MTAB-9801	yes	2888.34
E-CURD-7	yes	522.84
E-MTAB-9221	yes	34.38
E-GEOD-125970	yes	21.77
E-CURD-112	yes	18.33
E-HCAD-10	yes	15.69
E-MTAB-9467	yes	11.68
E-ANND-3	no	0.00

Regulation

Is transcription factor: yes

Downstream targets (CollecTRI)

32 targets.

Target	Regulation
AKT1
AMPD1
APOC3
CAT
CCND2
CDH1
CDH17
CSF3
CXCR4	Repression
DSPP
GPT
HSPA4	Repression
ID2
IGHMBP2
INS
MAD1L1
MAP2K1
MAX
MX1
ODC1	Unknown
OPRK1
PDLIM7
PDX1
PTEN	Repression
SIN3A
SIN3B
TERT	Activation
TNFRSF11A
TP53
TRRAP

Upstream regulators (CollecTRI, top): CTNNB1, MAX, MYC, PDX1, SMAD3, STAT3, TCF7L2, ZBTB16

miRNA regulators (miRDB)

173 targeting MXD1, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-6867-5P	100.00	82.21	3464
HSA-MIR-5692A	100.00	74.40	6850
HSA-MIR-3163	100.00	77.23	8605
HSA-MIR-3646	100.00	73.56	5283
HSA-MIR-4795-3P	100.00	74.62	4024
HSA-MIR-190A-3P	100.00	80.35	5520
HSA-MIR-29A-3P	100.00	73.11	1835
HSA-MIR-29B-3P	100.00	73.18	1833
HSA-MIR-29C-3P	100.00	73.15	1833
HSA-MIR-3662	99.99	73.82	5684
HSA-MIR-548C-3P	99.99	74.01	7587
HSA-MIR-186-5P	99.99	70.83	3707
HSA-MIR-4500	99.99	72.72	2367
HSA-MIR-520D-5P	99.98	73.34	4883
HSA-MIR-524-5P	99.98	73.43	4882
HSA-MIR-4789-5P	99.98	70.76	2721
HSA-LET-7A-5P	99.98	72.29	1790
HSA-LET-7B-5P	99.98	72.31	1790
HSA-LET-7C-5P	99.98	72.29	1790
HSA-LET-7E-5P	99.98	72.29	1790
HSA-LET-7F-5P	99.98	72.56	1784
HSA-LET-7G-5P	99.98	72.37	1784
HSA-LET-7I-5P	99.98	72.37	1788
HSA-MIR-98-5P	99.98	72.33	1787
HSA-MIR-3148	99.97	75.06	6478
HSA-MIR-607	99.97	73.62	5593
HSA-MIR-548AN	99.97	70.91	2817
HSA-MIR-570-3P	99.96	72.41	4910
HSA-MIR-4725-3P	99.96	69.53	2520
HSA-MIR-6780B-5P	99.96	69.60	2562

Literature-anchored findings (GeneRIF, showing 28)

• Mad1 gene transfer inhibits the proliferation of human melanoma cells (PMID:12366697)
• examination of functionality of basic domains compared with Myc (PMID:12538578)
• X-ray structures of Myc-Max and Mad-Max recognizing DNA. Molecular bases of regulation by proto-oncogenic transcription factors. (PMID:12553908)
• Mad expression and Id2 down-regulation are important events during the TGF-beta cytostatic program in epithelial cells. (PMID:12824180)
• HBP1 and Mad1 repressors bind the Sin3 corepressor PAH2 domain with opposite helical orientations (PMID:15235594)
• MAD1 and Proto-Oncogene Proteins c-myc reciprocally regulate ribosomal DNA transcription, providing a mechanism for coordination of ribosome biogenesis and cell growth (PMID:15282543)
• c-myc and mad1 can regulate the hTERT transcript in a different manner in hTERT positive cells, but not in normal cells (PMID:15645079)
• Max as a novel co-activator of C/EBPalpha functions, thereby suggesting a possible link between C/EBPalpha and Myc-Max-Mad network. (PMID:17082780)
• Mad1, Mxi1 and Rox genes were expressed and displayed mutations in haematological malignancies. (PMID:17577784)
• The PTEN tumor suppressor gene is a target of MAD1. (PMID:17998413)
• Mxd1 D112a and Max N78a and H81d, which are located in the leucine zippers of the proteins, can dictate the specificity of heterodimerization and whether or not the Mxd1/Max/DNA complex forms. (PMID:18155722)
• Results suggest STAT3 functions as a C/EBPbeta cofactor in the regulation of the MAD1 gene. (PMID:18203738)
• This study provides a direct link between the growth factor signaling pathways regulated by PI3 kinase/Akt and MAP kinases with Myc-mediated transcription. (PMID:18451027)
• Missense mutations in Mad1, Mxi1 and Rox were found in acute leukemia patients. (PMID:18457265)
• results suggest that phosphorylation of MAD1 by AKT inhibits MAD1-mediated transcription suppression and subsequently activates the transcription of MAD1 target genes (PMID:19526459)
• TGF-beta can override Myc activity despite a stabilizing cancer mutation and induce senescence in myeloid tumor cells, at least in part by induction of Mad1 (PMID:19766114)
• miR-17-92 cluster members miR-19a/b facilitated gastric cancer cell migration, invasion and metastasis through targeting the antagonist of c-Myc – MXD1. (PMID:24675462)
• This study suggests that genetic variants of MXD1 may modulate the effect of smoking on carotid plaque burden. (PMID:24954085)
• down regulation of miR-202 increased the expression of its target Mxd1, followed by Mxd1 recruitment to the Sin3A repressor complex and through its dimerization with Max, and increased repression of Myc-Max target proteins. (PMID:25611699)
• TCP10L stabilizes MAD1 protein level through direct interaction, and they cooperatively regulate cell cycle progression. (PMID:26698869)
• the miR-382-5p/MXD1 axis plays a critical role in myelopoiesis by affecting the lineage choice of CD34(+) hematopoietic stem/progenitor cells. (PMID:27520398)
• Results suggest a role for MAX dimerization protein 1 (MXD1) in the control of ribosome biogenesis. (PMID:27588501)
• Study revealed that HIF-1alpha-induced Mxd1 contributes to cisplatin-resistance in hypoxic osteosarcoma cells by directly repressing PTEN, which leads to the activation of PI3K/AKT antiapoptotic and survival pathway. (PMID:28543796)
• these data show that MXD1 functions as a negative regulator of BCR-ABL1 expression and subsequently inhibits proliferation and sensitizes chronic myeloid leukemia cells to imatinib treatment (PMID:30419548)
• Compared with noncancerous breast tissues, miRNA-382-5p expression was upregulated but MXD1 mRNA expression was downregulated in breast cancer tissues. The dysregulation of miRNA-382-5p-MXD1 axis may be involved in the development and aggressive progression of breast cancer. miRNA-382-5p may target MXD1, leading to cell invasion and proliferation in breast cancer cells in vitro. (PMID:31635836)
• MXD1 regulates the H9N2 and H1N1 influenza A virus-induced chemokine expression and their replications in human macrophage. (PMID:32794336)
• Targeting miR-21 with NL101 blocks c-Myc/Mxd1 loop and inhibits the growth of B cell lymphoma. (PMID:33537096)
• MXD1 is a Potential Prognostic Biomarker and Correlated With Specific Molecular Change and Tumor Microenvironment Feature in Esophageal Squamous Cell Carcinoma. (PMID:34761715)

Cross-species orthologs

4 orthologs

Organism	Symbol	Gene ID
danio_rerio	mxd1	ENSDARG00000032039
mus_musculus	Mxd1	ENSMUSG00000001156
rattus_norvegicus	Mxd1	ENSRNOG00000017720
caenorhabditis_elegans		WBGENE00003163

Paralogs (4): MNT (ENSG00000070444), MXI1 (ENSG00000119950), MXD4 (ENSG00000123933), MXD3 (ENSG00000213347)

Protein

Protein identifiers

Max dimerization protein 1 — Q05195 (reviewed: Q05195)

Alternative names: Protein MAD

All UniProt accessions (4): Q05195, B7ZLI7, C9JBE8, F8WBI0

UniProt curated annotations — full annotation on UniProt →

Function. Component of a transcriptional repressor complex together with MAX. In complex with MAX binds to the core DNA sequence 5’-CAC[GA]TG-3’. Antagonizes MYC transcriptional activity by competing with MYC for MAX binding. Binds to the TERT promoter and represses telomerase expression, possibly by interfering with MYC binding.

Subunit / interactions. Heterodimer with MAX; the interaction is required for DNA-binding. DNA binding requires dimerization with another bHLH protein; does not form homodimers, and does not bind to DNA in the absence of MAX in vitro. Interacts with RNF17.

Subcellular location. Nucleus.

Post-translational modifications. Ubiquitinated by BIRC2/c-IAP1, leading to its subsequent degradation by the proteasome.

Isoforms (2)

UniProt ID	Names	Canonical?
Q05195-1	1	yes
Q05195-2	2

RefSeq proteins (3): NP_001189442, NP_001189443, NP_002348* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR011598	bHLH_dom	Domain
IPR036638	HLH_DNA-bd_sf	Homologous_superfamily
IPR040157	MXD1_bHLHzip	Domain

Pfam: PF00010

UniProt features (12 total): helix 3, region of interest 2, compositionally biased region 2, chain 1, domain 1, strand 1, short sequence motif 1, splice variant 1

Structure

Experimental structures (PDB)

5 structures.

PDB	Method	Resolution (Å)
1NLW	X-RAY DIFFRACTION	2
1E91	SOLUTION NMR
1G1E	SOLUTION NMR
1PD7	SOLUTION NMR
1S5Q	SOLUTION NMR

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q05195-F1	73.22	0.34

Function

Pathways and Gene Ontology

Reactome pathways

0 pathways

MSigDB gene sets: 347 (showing top): GSE45365_NK_CELL_VS_CD8A_DC_UP, PID_HDAC_CLASSI_PATHWAY, PID_TELOMERASE_PATHWAY, PEREZ_TP63_TARGETS, ENK_UV_RESPONSE_KERATINOCYTE_UP, IVANOVA_HEMATOPOIESIS_MATURE_CELL, GARGALOVIC_RESPONSE_TO_OXIDIZED_PHOSPHOLIPIDS_BLUE_UP, BILD_HRAS_ONCOGENIC_SIGNATURE, CHANG_IMMORTALIZED_BY_HPV31_DN, MODULE_75, RICKMAN_TUMOR_DIFFERENTIATED_WELL_VS_POORLY_DN, FOSTER_TOLERANT_MACROPHAGE_UP, GROSS_HYPOXIA_VIA_ELK3_AND_HIF1A_UP, KINSEY_TARGETS_OF_EWSR1_FLII_FUSION_DN, MODULE_123

GO Biological Process (2): negative regulation of transcription by RNA polymerase II (GO:0000122), regulation of transcription by RNA polymerase II (GO:0006357)

GO Molecular Function (6): RNA polymerase II cis-regulatory region sequence-specific DNA binding (GO:0000978), DNA-binding transcription factor activity, RNA polymerase II-specific (GO:0000981), DNA-binding transcription repressor activity, RNA polymerase II-specific (GO:0001227), protein dimerization activity (GO:0046983), DNA binding (GO:0003677), protein binding (GO:0005515)

GO Cellular Component (6): chromatin (GO:0000785), nucleus (GO:0005634), nucleoplasm (GO:0005654), mitochondrion (GO:0005739), cytosol (GO:0005829), Mad-Max complex (GO:0070443)

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
RNA polymerase II transcription regulatory region sequence-specific DNA binding	3
cellular anatomical structure	3
regulation of transcription by RNA polymerase II	2
transcription by RNA polymerase II	2
intracellular membrane-bounded organelle	2
cytoplasm	2
negative regulation of DNA-templated transcription	1
regulation of DNA-templated transcription	1
cis-regulatory region sequence-specific DNA binding	1
chromatin	1
DNA-binding transcription factor activity	1
negative regulation of transcription by RNA polymerase II	1
DNA-binding transcription factor activity, RNA polymerase II-specific	1
DNA-binding transcription repressor activity	1
protein binding	1
nucleic acid binding	1
binding	1
chromosome	1
nuclear lumen	1
RNA polymerase II transcription repressor complex	1

Protein interactions and networks

STRING

1042 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
MXD1	MAX	P25912	861
MXD1	MYC	P01106	807
MXD1	SIN3A	Q96ST3	695
MXD1	MLXIP	Q9HAP2	643
MXD1	MNT	Q99583	623
MXD1	MXI1	P50539	613
MXD1	SIN3B	O75182	511
MXD1	BCL6	P41182	499
MXD1	AKT1	P31749	498
MXD1	HDAC1	Q13547	495
MXD1	MLXIPL	Q9NP71	438
MXD1	ZNF532	Q9HCE3	431
MXD1	SPDEF	O95238	416
MXD1	MGA	Q8IWI9	412
MXD1	ARID5B	Q14865	412

IntAct

15 interactions, top by confidence:

A	B	Type	Score
MAX	E2F6	psi-mi:“MI:0914”(association)	0.710
MXD1	MAX	psi-mi:“MI:0915”(physical association)	0.670
RPS6KB1	MXD1	psi-mi:“MI:0407”(direct interaction)	0.440
MXD1	AKT1	psi-mi:“MI:0407”(direct interaction)	0.440
RPS6KA1	MXD1	psi-mi:“MI:0407”(direct interaction)	0.440
MXD1		psi-mi:“MI:0915”(physical association)	0.400
IFNA14	MXD1	psi-mi:“MI:0915”(physical association)	0.370
MLX	MXD1	psi-mi:“MI:0915”(physical association)	0.370
MXD1	ARID4A	psi-mi:“MI:0914”(association)	0.350
DISC1	AGRN	psi-mi:“MI:0914”(association)	0.350
MAX	AGRN	psi-mi:“MI:0914”(association)	0.350
MXD1	SIN3B	psi-mi:“MI:2364”(proximity)	0.270

BioGRID (90): SIN3A (Affinity Capture-MS), SAP130 (Affinity Capture-MS), BRMS1L (Affinity Capture-MS), SAP30L (Affinity Capture-MS), MAX (Affinity Capture-MS), ARID4B (Affinity Capture-MS), SUDS3 (Affinity Capture-MS), ARID4A (Affinity Capture-MS), BRMS1 (Affinity Capture-MS), MXD1 (Synthetic Growth Defect), MXD1 (Reconstituted Complex), ARID4B (Affinity Capture-MS), SAP130 (Affinity Capture-MS), SUDS3 (Affinity Capture-MS), SIN3A (Affinity Capture-MS)

ESM2 similar proteins: A1L2X1, D4A7E1, E1BD44, F1QW76, F7EMX9, G5ECU7, G5EF76, O09015, O35284, O57598, O96642, P13096, P13097, P13098, P13903, P46505, P50539, P50540, P50541, P97831, P97876, Q00P32, Q01068, Q01069, Q01070, Q01071, Q04788, Q05195, Q07291, Q09771, Q09926, Q0VFI9, Q0VH34, Q10574, Q16520, Q18711, Q21361, Q23579, Q62282, Q8AW52

Diamond homologs: G5EG44, O09015, P50538, P50539, P50540, P50541, Q05195, Q0VFI9, Q0VH33, Q0VH34, Q14582, Q28DB3, Q60948, Q62912, Q7SX95, Q80US8, Q9BW11, O08789, P28574, P52162, P52164, P61244, P61245, Q07016, Q0VH32, Q99583, P49709, P52160, Q7ZVS9, Q90342

SIGNOR signaling

8 interactions.

A	Effect	B	Mechanism
RPS6KA1	down-regulates	MXD1	phosphorylation
RPS6KB1	down-regulates	MXD1	phosphorylation
RPS6KB2	down-regulates	MXD1	phosphorylation
AKT	down-regulates	MXD1	phosphorylation
AKT1	down-regulates	MXD1	phosphorylation
RPS6K	down-regulates	MXD1	phosphorylation
MXD1	“down-regulates quantity by repression”	UBTF	“transcriptional regulation”
SMC3	“down-regulates activity”	MXD1	binding

Disease & clinical

Clinical variants and AI predictions

ClinVar

9 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	5
Likely benign	0
Benign	0

Top pathogenic / likely-pathogenic (0)

SpliceAI

1192 predictions. Top by Δscore:

Variant	Effect	Δscore
2:69903179:AG:A	acceptor_gain	1.0000
2:69903180:GG:G	acceptor_gain	1.0000
2:69904253:GGCA:G	acceptor_gain	1.0000
2:69916120:GAA:G	acceptor_gain	1.0000
2:69918315:A:G	donor_gain	1.0000
2:69935349:A:AG	acceptor_gain	1.0000
2:69935349:AGAC:A	acceptor_gain	1.0000
2:69935349:AGACG:A	acceptor_gain	1.0000
2:69935350:G:GG	acceptor_gain	1.0000
2:69935350:GAC:G	acceptor_gain	1.0000
2:69935350:GACG:G	acceptor_gain	1.0000
2:69935350:GACGG:G	acceptor_gain	1.0000
2:69935462:AAAGG:A	donor_loss	1.0000
2:69935463:AAGGT:A	donor_loss	1.0000
2:69935465:GGTA:G	donor_loss	1.0000
2:69935466:G:C	donor_loss	1.0000
2:69937232:CA:C	acceptor_loss	1.0000
2:69937234:GA:G	acceptor_gain	1.0000
2:69937234:GAA:G	acceptor_gain	1.0000
2:69937234:GAAA:G	acceptor_gain	1.0000
2:69937390:CAGGG:C	donor_gain	1.0000
2:69937391:AGGG:A	donor_gain	1.0000
2:69937391:AGGGG:A	donor_loss	1.0000
2:69937392:GGG:G	donor_gain	1.0000
2:69937392:GGGG:G	donor_gain	1.0000
2:69937393:GG:G	donor_gain	1.0000
2:69937393:GGG:G	donor_gain	1.0000
2:69937393:GGGTG:G	donor_loss	1.0000
2:69937394:G:T	donor_gain	1.0000
2:69937394:GG:G	donor_gain	1.0000

AlphaMissense

1471 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
2:69921765:G:C	R68T	1.000
2:69935351:A:C	R68S	1.000
2:69935351:A:T	R68S	1.000
2:69935362:T:C	L72P	1.000
2:69935364:C:A	R73S	1.000
2:69935374:T:C	L76P	1.000
2:69935383:T:C	L79S	1.000
2:69935440:T:C	L98S	1.000
2:69935448:G:C	A101P	1.000
2:69921743:C:G	H61D	0.999
2:69921745:C:A	H61Q	0.999
2:69921745:C:G	H61Q	0.999
2:69921755:G:A	E65K	0.999
2:69921756:A:T	E65V	0.999
2:69921757:G:C	E65D	0.999
2:69921757:G:T	E65D	0.999
2:69921758:A:C	K66Q	0.999
2:69921758:A:G	K66E	0.999
2:69921759:A:C	K66T	0.999
2:69921759:A:T	K66M	0.999
2:69921760:G:C	K66N	0.999
2:69921760:G:T	K66N	0.999
2:69921764:A:G	R68G	0.999
2:69921765:G:T	R68I	0.999
2:69935352:C:G	R69G	0.999
2:69935353:G:C	R69P	0.999
2:69935355:G:C	A70P	0.999
2:69935362:T:A	L72H	0.999
2:69935365:G:C	R73P	0.999
2:69935383:T:G	L79W	0.999

dbSNP variants (sampled 300 via entrez): RS1000250393 (2:69930735 A>G), RS1000417667 (2:69928958 A>G), RS1000602907 (2:69924016 A>G), RS1000615661 (2:69929240 C>A), RS1000646801 (2:69929079 A>G), RS1000776927 (2:69922341 G>A), RS1000793817 (2:69936177 G>A), RS1000832117 (2:69942370 C>A,G), RS1000845874 (2:69924115 A>T), RS1000881685 (2:69917043 A>C,T), RS1000948573 (2:69936458 CTTGAGAGCCACAGCCAAAATCCCTGT>C), RS1000988852 (2:69924360 T>C), RS1001150249 (2:69930214 C>A), RS1001212249 (2:69922128 T>G), RS1001221617 (2:69927819 T>C)

Disease associations

OMIM: gene MIM:600021 | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

10 associations (top):

Study	Trait	p-value
GCST002482_2	Carotid plaque burden (smoking interaction)	2.000000e-06
GCST004599_276	Mean platelet volume	9.000000e-17
GCST004603_210	Platelet count	7.000000e-10
GCST004611_13	High light scatter reticulocyte count	7.000000e-09
GCST006804_153	Red cell distribution width	3.000000e-09
GCST90002385_132	High light scatter reticulocyte count	4.000000e-11
GCST90002395_328	Mean platelet volume	2.000000e-38
GCST90002402_239	Platelet count	2.000000e-28
GCST90002405_128	Reticulocyte count	1.000000e-11
GCST90002406_21	Reticulocyte fraction of red cells	3.000000e-10

EFO canonical traits (4, from GWAS)

EFO ID	Trait name
EFO:0006501	carotid plaque build
EFO:0004309	platelet count
EFO:0007986	reticulocyte count
EFO:0009188	Red cell distribution width

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

127 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
sodium arsenite	decreases expression, affects cotreatment, increases abundance, increases expression	4
Air Pollutants	affects cotreatment, decreases expression, increases abundance, increases expression	4
Tobacco Smoke Pollution	increases expression	4
Copper	decreases expression, increases expression, affects binding	3
Methotrexate	affects cotreatment, increases expression, affects response to substance	3
Cyclosporine	increases expression	3
Cadmium Chloride	decreases expression, increases abundance, increases expression	3
entinostat	decreases expression, affects cotreatment	2
2,2’,4,4’-tetrabromodiphenyl ether	increases expression	2
(+)-JQ1 compound	increases expression	2
Arsenic Trioxide	increases expression	2
Acetaminophen	increases expression	2
Benzo(a)pyrene	increases expression	2
Cadmium	increases abundance, increases expression	2
Drugs, Chinese Herbal	increases expression	2
Estradiol	affects expression, increases reaction, increases expression	2
Folic Acid	affects cotreatment, increases expression	2
Formaldehyde	increases expression	2
Lipopolysaccharides	increases expression, affects cotreatment	2
Phenylmercuric Acetate	affects cotreatment, increases expression	2
Smoke	decreases expression, increases abundance	2
Tetrachlorodibenzodioxin	decreases reaction, increases expression, decreases expression	2
Tretinoin	increases expression	2
Valproic Acid	increases expression	2
Particulate Matter	increases abundance, increases expression	2
aristolochic acid I	increases expression	1
3-((6-(2-methoxyphenyl)pyrimidin-4-yl)amino)phenyl)methane sulfonamide	decreases expression	1
ethylbenzene	increases expression	1
methylmercuric chloride	increases expression	1
alpha phellandrene	increases expression	1

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.