NAA25

Summary

NAA25 (N-alpha-acetyltransferase 25, NatB auxiliary subunit, HGNC:25783) is a protein-coding gene on chromosome 12q24.13, encoding N-alpha-acetyltransferase 25, NatB auxiliary subunit (Q14CX7). Non-catalytic subunit of the NatB complex which catalyzes acetylation of the N-terminal methionine residues of peptides beginning with Met-Asp, Met-Glu, Met-Asn and Met-Gln. It is a selective cancer dependency (DepMap: 78.2% of cell lines).

This gene encodes the auxiliary subunit of the heteromeric N-terminal acetyltransferase B complex. This complex acetylates methionine residues that are followed by acidic or asparagine residues.

Source: NCBI Gene 80018 — RefSeq curated summary.

At a glance

• GWAS associations: 34
• Clinical variants (ClinVar): 99 total
• Cancer dependency (DepMap): dependent in 78.2% of screened cell lines
• MANE Select transcript: NM_024953

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:25783
Approved symbol	NAA25
Name	N-alpha-acetyltransferase 25, NatB auxiliary subunit
Location	12q24.13
Locus type	gene with protein product
Status	Approved
Aliases	FLJ13089
Ensembl gene	ENSG00000111300
Ensembl biotype	protein_coding
OMIM	612755
Entrez	80018

Gene structure

Transcript identifiers

Ensembl transcripts: 11 — 5 protein_coding, 4 retained_intron, 2 nonsense_mediated_decay

ENST00000261745, ENST00000547133, ENST00000548181, ENST00000548627, ENST00000549711, ENST00000550701, ENST00000551858, ENST00000552527, ENST00000911268, ENST00000965676, ENST00000965677

RefSeq mRNA: 1 — MANE Select: NM_024953 NM_024953

CCDS: CCDS9159

Canonical transcript exons

ENST00000261745 — 24 exons

Exon	Start	End
ENSE00001311173	112026689	112029653
ENSE00002379409	112108716	112108783
ENSE00003458402	112090726	112090864
ENSE00003463574	112043625	112043868
ENSE00003463927	112078188	112078266
ENSE00003497159	112074675	112074764
ENSE00003507695	112060270	112060359
ENSE00003527289	112081060	112081134
ENSE00003546546	112039229	112039339
ENSE00003560681	112048292	112048443
ENSE00003564807	112071895	112072064
ENSE00003566875	112061181	112061388
ENSE00003578245	112093051	112093136
ENSE00003587352	112087683	112087801
ENSE00003601542	112047665	112047790
ENSE00003605758	112043088	112043211
ENSE00003606372	112040481	112040578
ENSE00003607587	112078634	112078741
ENSE00003609028	112075678	112075789
ENSE00003615074	112033233	112033379
ENSE00003643215	112042039	112042104
ENSE00003666259	112053558	112053657
ENSE00003666308	112068880	112068992
ENSE00003686313	112054388	112054568

Expression profiles

Bgee: expression breadth ubiquitous, 255 present calls, max score 93.99.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 24.4454 / max 403.4021, expressed in 1809 samples.

FANTOM5 promoters (1 alternative TSS)

Promoter ID	TPM avg	Samples expressed
133325	24.4454	1809

Top tissues by expression

260 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
tibialis anterior	UBERON:0001385	93.99	gold quality
endothelial cell	CL:0000115	91.75	gold quality
deltoid	UBERON:0001476	91.37	gold quality
skeletal muscle tissue of rectus abdominis	UBERON:0004511	91.13	gold quality
adrenal tissue	UBERON:0018303	90.19	gold quality
corpus callosum	UBERON:0002336	89.62	gold quality
nipple	UBERON:0002030	89.00	gold quality
male germ line stem cell (sensu Vertebrata) in testis	CL:0000089 ∩ UBERON:0000473	88.44	gold quality
gastrocnemius	UBERON:0001388	87.48	gold quality
sural nerve	UBERON:0015488	87.37	gold quality
calcaneal tendon	UBERON:0003701	86.95	gold quality
muscle of leg	UBERON:0001383	86.94	gold quality
pigmented layer of retina	UBERON:0001782	86.76	gold quality
skeletal muscle organ	UBERON:0014892	86.62	gold quality
upper arm skin	UBERON:0004263	86.60	silver quality
colonic epithelium	UBERON:0000397	86.54	gold quality
epithelial cell of pancreas	CL:0000083	86.48	silver quality
skeletal muscle tissue	UBERON:0001134	86.12	gold quality
biceps brachii	UBERON:0001507	85.85	gold quality
cerebellar vermis	UBERON:0004720	85.84	gold quality
inferior vagus X ganglion	UBERON:0005363	85.51	gold quality
muscle tissue	UBERON:0002385	85.14	gold quality
bone marrow cell	CL:0002092	84.75	gold quality
tibial nerve	UBERON:0001323	84.57	gold quality
skin of leg	UBERON:0001511	84.54	gold quality
quadriceps femoris	UBERON:0001377	84.47	silver quality
ileal mucosa	UBERON:0000331	84.46	gold quality
skin of abdomen	UBERON:0001416	84.45	gold quality
skeletal muscle tissue of biceps brachii	UBERON:0004502	84.44	gold quality
secondary oocyte	CL:0000655	84.35	gold quality

Single-cell (SCXA)

Detected in 2 experiment(s), a significant marker in 2.

Experiment	Marker?	Max mean expression
E-GEOD-98556	yes	871.00
E-ANND-3	yes	5.39

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

176 targeting NAA25, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-190A-3P	100.00	80.35	5520
HSA-MIR-5011-5P	100.00	83.46	5820
HSA-MIR-3646	100.00	73.56	5283
HSA-LET-7A-3P	100.00	74.03	3932
HSA-LET-7B-3P	100.00	74.08	3913
HSA-LET-7F-1-3P	100.00	74.02	3928
HSA-MIR-98-3P	100.00	74.08	3907
HSA-MIR-30A-5P	100.00	76.31	3233
HSA-MIR-30B-5P	100.00	76.29	3248
HSA-MIR-30C-5P	100.00	76.29	3248
HSA-MIR-30D-5P	100.00	76.32	3233
HSA-MIR-30E-5P	100.00	76.32	3242
HSA-MIR-1277-5P	100.00	73.95	5056
HSA-MIR-3163	100.00	77.23	8605
HSA-MIR-3613-3P	100.00	76.36	7965
HSA-MIR-656-3P	100.00	72.15	2788
HSA-MIR-3924	100.00	72.09	2394
HSA-MIR-8485	100.00	77.57	4731
HSA-MIR-450A-1-3P	100.00	69.33	1837
HSA-MIR-3662	99.99	73.82	5684
HSA-MIR-548AW	99.99	72.57	3559
HSA-MIR-3667-3P	99.99	67.17	1636
HSA-MIR-371B-5P	99.99	75.34	4759
HSA-MIR-3185	99.99	68.12	1959
HSA-MIR-4531	99.99	69.70	3181
HSA-MIR-511-3P	99.99	68.85	1467
HSA-MIR-12136	99.98	72.81	5713
HSA-MIR-4482-3P	99.98	72.50	3147
HSA-MIR-4775	99.98	75.00	6394
HSA-MIR-373-5P	99.98	75.36	4753

Functional genomics

DepMap (CRISPR cell-line fitness): dependent in 78.2% of screened cell lines.

Literature-anchored findings (GeneRIF, showing 8)

• Human N-acetyltransferase complexe NatB consists of human N-acetyltransferase 3 and human MDM20. The hMDM20 knockdown decreased the fraction of cells in G(0)/G(1)-phase and increased the fraction of cells in the sub-G(0)/G(1)-phase. (PMID:18570629)
• hMdm20 (C12orf30) is an auxiliary subunit of the human NatB N-terminal acetyltransferase complex while hNat3 (NAT5) is the catalytic subunit. This ribosome associated complex acetylates nascent Met-Asp/Glu- polypeptides. (PMID:18570629)
• There are associations between juvenile idiopathic arthritis and variants in the TNFAIP3, STAT4, and C12orf30 regions that have previously shown associations with other autoimmune diseases, including rheumatoid arthritis and systemic lupus erythematosus. (PMID:19565500)
• The C120rf30 gene maps into a region of extensive linkage disequilibrium including several genes that represent functional candidates of type 1 diabetes-susceptibility. (PMID:20089178)
• The human NatB complex composed of Naa20 (NAT3) and Naa25 (MDM20) N-terminally acetylates Met-Glu-, Met-Asp-, Met-Asn- and Met-Gln- N-termini, and is important for the structure and function of actomyosin fibers and for proper cellular migration. (PMID:22814378)
• Mdm20 acts as a novel regulator of Rictor, thereby controlling mTORC2 activity, and leading to the activation of PKCalphaS657 and FoxO1. (PMID:26600389)
• The relationship between the prognosis of children with acute arterial stroke and polymorphisms of CDKN2B, HDAC9, NINJ2, NAA25 genes. (PMID:30656483)
• Genome-wide long non-coding RNA association study on Han Chinese women identifies lncHSAT164 as a novel susceptibility gene for breast cancer. (PMID:34018994)

Cross-species orthologs

5 orthologs

Organism	Symbol	Gene ID
danio_rerio	naa25	ENSDARG00000075446
mus_musculus	Naa25	ENSMUSG00000042719
rattus_norvegicus	Naa25	ENSRNOG00000001350
drosophila_melanogaster	psidin	FBGN0243511
caenorhabditis_elegans		WBGENE00020068

Paralogs (2): NAA15 (ENSG00000164134), NAA16 (ENSG00000172766)

Protein

Protein identifiers

N-alpha-acetyltransferase 25, NatB auxiliary subunit — Q14CX7 (reviewed: Q14CX7)

Alternative names: Mitochondrial distribution and morphology protein 20, N-terminal acetyltransferase B complex subunit MDM20, N-terminal acetyltransferase B complex subunit NAA25, p120

All UniProt accessions (4): Q14CX7, F8VSB9, F8W0N5, H0YHR9

UniProt curated annotations — full annotation on UniProt →

Function. Non-catalytic subunit of the NatB complex which catalyzes acetylation of the N-terminal methionine residues of peptides beginning with Met-Asp, Met-Glu, Met-Asn and Met-Gln. May play a role in normal cell-cycle progression.

Subunit / interactions. Component of the N-terminal acetyltransferase B (NatB) complex which is composed of NAA20 and NAA25.

Subcellular location. Cytoplasm.

Similarity. Belongs to the MDM20/NAA25 family.

Isoforms (2)

UniProt ID	Names	Canonical?
Q14CX7-1	1	yes
Q14CX7-2	2

RefSeq proteins (1): NP_079229* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR011990	TPR-like_helical_dom_sf	Homologous_superfamily
IPR019183	NAA25_NatB_aux_su	Family

Pfam: PF09797

Enzyme classification (BRENDA):

• EC 2.3.1.254 — N-terminal methionine Nalpha-acetyltransferase NatB (BRENDA: 7 organisms, 25 substrates, 1 inhibitors, 10 Km, 6 kcat entries)

Substrate kinetics (BRENDA)

10 substrates with measured Km, best-characterized 10. Km ranges are aggregated across organisms/conditions.

Substrate	Km (mM)	Measurements
ACETYL-COA	0.0069	1
MFGPEEGGRWGRPVGRRRRRPVRVYP	3.734	1
MIGPEEGGRWGRPVGRRRRRPVRVYP	0.185	1
MLALISRRWGRPVGRRRRRPVRVYP	0.19	1
MLDPEEGGRWGRPVGRRRRRPVRVYP	0.091	1
MLGPEGGRWGRPVGRRRRRPVRVYP	0.079	1
MLGTEEGGRWGRPVGRRRRRPVRVYP	0.416	1
MLGTGPARWGRPVGRRRRRPVRVYP	0.32	1
MLLPEEGGRWGRPVGRRRRRPVRVYP	0.478	1
MLRPEEGGRWGRPVGRRRRRPVRVYP	0.46	1

UniProt features (91 total): helix 47, turn 15, strand 14, repeat 4, sequence variant 4, sequence conflict 4, splice variant 2, chain 1

Structure

Experimental structures (PDB)

3 structures.

PDB	Method	Resolution (Å)
7STX	ELECTRON MICROSCOPY	3.14
8G0L	ELECTRON MICROSCOPY	3.39
6VP9	ELECTRON MICROSCOPY	3.46

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q14CX7-F1	91.31	0.79

Function

Pathways and Gene Ontology

Reactome pathways

0 pathways

MSigDB gene sets: 162 (showing top): TGCGCANK_UNKNOWN, GCM_GSPT1, RORA1_01, GCM_ZNF198, GCM_PPM1D, TGACCTY_ERR1_Q2, MONNIER_POSTRADIATION_TUMOR_ESCAPE_UP, WEI_MYCN_TARGETS_WITH_E_BOX, CATTTCA_MIR203, GCM_SUFU, DODD_NASOPHARYNGEAL_CARCINOMA_UP, TGTTTAC_MIR30A5P_MIR30C_MIR30D_MIR30B_MIR30E5P, HOOI_ST7_TARGETS_DN, TGACCTTG_SF1_Q6, NAKAMURA_TUMOR_ZONE_PERIPHERAL_VS_CENTRAL_UP

GO Biological Process (1): cytoskeleton organization (GO:0007010)

GO Molecular Function (2): acetyltransferase activator activity (GO:0010698), protein binding (GO:0005515)

GO Cellular Component (4): cytoplasm (GO:0005737), Golgi apparatus (GO:0005794), cytosol (GO:0005829), NatB complex (GO:0031416)

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
cellular anatomical structure	2
cytoplasm	2
organelle organization	1
enzyme activator activity	1
acetyltransferase activity	1
binding	1
intracellular anatomical structure	1
endomembrane system	1
intracellular membrane-bounded organelle	1
N-terminal protein acetyltransferase complex	1

Protein interactions and networks

STRING

1536 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
NAA25	NAA20	P61599	998
NAA25	NAA15	Q9BXJ9	931
NAA25	NAA30	Q147X3	877
NAA25	NAA35	Q5VZE5	839
NAA25	NAA10	P41227	823
NAA25	SH2B3	Q9UQQ2	760
NAA25	NAA50	Q9GZZ1	718
NAA25	NAA40	Q86UY6	677
NAA25	TMEM116	Q8NCL8	649
NAA25	WASF1	Q92558	643
NAA25	CLEC16A	Q2KHT3	640
NAA25	NAA60	Q9H7X0	622
NAA25	PTPN2	P17706	618
NAA25	ESCO1	Q5FWF5	614
NAA25	HYPK	Q9NX55	612

IntAct

43 interactions, top by confidence:

A	B	Type	Score
CDH2	CTNNB1	psi-mi:“MI:0914”(association)	0.930
PSMB7	PSMA7	psi-mi:“MI:0914”(association)	0.790
ACTR1A	DCTN2	psi-mi:“MI:0914”(association)	0.790
AP2S1	AP2A2	psi-mi:“MI:0914”(association)	0.640
PTGR3	DBT	psi-mi:“MI:0914”(association)	0.640
CDH2	JUP	psi-mi:“MI:0914”(association)	0.560
REG1B	REG1A	psi-mi:“MI:0914”(association)	0.560
REG1A	REG1B	psi-mi:“MI:0914”(association)	0.560
CXCR4	TMEM120B	psi-mi:“MI:0914”(association)	0.530
TNFRSF8	DAPK3	psi-mi:“MI:0914”(association)	0.530
PRKAR2B	AMY1A	psi-mi:“MI:0914”(association)	0.530
LUC7L2	ZNF593	psi-mi:“MI:0914”(association)	0.530
REG1A	NAA25	psi-mi:“MI:0914”(association)	0.530
NAA20	NAA25	psi-mi:“MI:0915”(physical association)	0.520
M		psi-mi:“MI:0914”(association)	0.350
SUZ12	TNPO2	psi-mi:“MI:0914”(association)	0.350
ATG16L1	ESYT2	psi-mi:“MI:0914”(association)	0.350
GPR17	TMEM120B	psi-mi:“MI:0914”(association)	0.350
CENPM	DNM1L	psi-mi:“MI:0914”(association)	0.350
AKAP1	MFN2	psi-mi:“MI:0914”(association)	0.350
RHOF	GSTT1	psi-mi:“MI:0914”(association)	0.350
BBS1	SHTN1	psi-mi:“MI:0914”(association)	0.350
AHR	SHTN1	psi-mi:“MI:0914”(association)	0.350
ZBTB2	SHTN1	psi-mi:“MI:0914”(association)	0.350
MND1	SH3PXD2B	psi-mi:“MI:0914”(association)	0.350
TBC1D9	SH3PXD2B	psi-mi:“MI:0914”(association)	0.350
MILR1	SBNO1	psi-mi:“MI:0914”(association)	0.350
SMAD4	SBNO1	psi-mi:“MI:0914”(association)	0.350

BioGRID (69): NAA25 (Affinity Capture-MS), NAA25 (Affinity Capture-MS), NAA20 (Co-fractionation), NAA25 (Co-fractionation), NAA25 (Co-fractionation), NAA25 (Co-fractionation), NAA25 (Affinity Capture-MS), NAA25 (Affinity Capture-MS), NAA25 (Affinity Capture-MS), NAA25 (Affinity Capture-MS), NAA25 (Affinity Capture-MS), NAA25 (Affinity Capture-RNA), NAA25 (Affinity Capture-MS), NAA25 (Positive Genetic), NAA25 (Negative Genetic)

ESM2 similar proteins: A0A1S4D1D3, A0A1W2PR95, A0A8I6ASZ5, A8WE67, D2K8N5, D3Z8X7, D3ZND0, E1C760, E7EXT2, F6Y9J3, F7AEX0, O08836, O60308, P27641, P54729, P78318, Q0P4W3, Q14CX7, Q15021, Q2QY04, Q2YD98, Q3ZC62, Q4V8E4, Q5EAU9, Q61249, Q68FJ0, Q6NY52, Q6PBQ2, Q6PGY6, Q6QI44, Q7ZXA8, Q80V31, Q86VS3, Q8BWZ3, Q8C6E0, Q8C9J3, Q8IYW2, Q8K2Z4, Q8LDQ4, Q8LNU5

Diamond homologs: Q14CX7, Q294E0, Q6QI44, Q7PYI4, Q8BWZ3, Q9VDQ7, Q17DK2

SIGNOR signaling

1 interactions.

A	Effect	B	Mechanism
NAA25	“form complex”	NatB	binding

Disease & clinical

Clinical variants and AI predictions

ClinVar

99 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	75
Likely benign	7
Benign	0

Top pathogenic / likely-pathogenic (0)

SpliceAI

4009 predictions. Top by Δscore:

Variant	Effect	Δscore
12:112029789:CAAT:C	acceptor_gain	1.0000
12:112029792:T:C	acceptor_gain	1.0000
12:112029792:T:TC	acceptor_gain	1.0000
12:112029795:C:CT	acceptor_gain	1.0000
12:112029796:A:AC	acceptor_gain	1.0000
12:112029796:A:C	acceptor_gain	1.0000
12:112029801:A:AC	acceptor_gain	1.0000
12:112029801:A:C	acceptor_gain	1.0000
12:112040474:AACTT:A	donor_loss	1.0000
12:112040475:ACTT:A	donor_loss	1.0000
12:112040476:CTTAC:C	donor_loss	1.0000
12:112040477:TTA:T	donor_loss	1.0000
12:112040478:TAC:T	donor_loss	1.0000
12:112040479:A:C	donor_loss	1.0000
12:112040480:C:G	donor_loss	1.0000
12:112040576:CAT:C	acceptor_gain	1.0000
12:112040577:AT:A	acceptor_gain	1.0000
12:112040579:C:CC	acceptor_gain	1.0000
12:112042103:CT:C	acceptor_gain	1.0000
12:112042105:C:CC	acceptor_gain	1.0000
12:112042111:T:C	acceptor_gain	1.0000
12:112042111:T:TC	acceptor_gain	1.0000
12:112043207:GGATA:G	acceptor_gain	1.0000
12:112043208:GATA:G	acceptor_gain	1.0000
12:112043210:TA:T	acceptor_gain	1.0000
12:112043212:C:CC	acceptor_gain	1.0000
12:112043619:TGGTA:T	donor_loss	1.0000
12:112043620:GGTAC:G	donor_loss	1.0000
12:112043621:GTAC:G	donor_loss	1.0000
12:112043622:TACCT:T	donor_loss	1.0000

AlphaMissense

6409 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
12:112048364:A:G	L603P	1.000
12:112048409:C:T	G588D	1.000
12:112048421:G:T	A584D	1.000
12:112048422:C:G	A584P	1.000
12:112054411:C:A	K535N	1.000
12:112054411:C:G	K535N	1.000
12:112054413:T:C	K535E	1.000
12:112078259:A:G	L198P	1.000
12:112078689:G:T	A177D	1.000
12:112078690:C:G	A177P	1.000
12:112078692:A:G	L176P	1.000
12:112078692:A:T	L176H	1.000
12:112081072:G:C	S155R	1.000
12:112081072:G:T	S155R	1.000
12:112081074:T:G	S155R	1.000
12:112081084:C:A	W151C	1.000
12:112081084:C:G	W151C	1.000
12:112081086:A:G	W151R	1.000
12:112081086:A:T	W151R	1.000
12:112081121:A:G	L139P	1.000
12:112081130:C:T	G136D	1.000
12:112087710:T:A	R125S	1.000
12:112087710:T:G	R125S	1.000
12:112087720:G:T	A122D	1.000
12:112087721:C:G	A122P	1.000
12:112087729:A:G	L119P	1.000
12:112087771:G:T	A105D	1.000
12:112090740:C:G	R90P	1.000
12:112090755:A:G	L85P	1.000
12:112090764:A:G	L82P	1.000

dbSNP variants (sampled 300 via entrez): RS1000021466 (12:112091081 A>T), RS1000082646 (12:112057405 C>T), RS1000097342 (12:112084529 G>A), RS1000135391 (12:112097380 G>T), RS1000156362 (12:112032487 ATCAGCAGTTTAGC>A,ATCAGCAGTTTAGCTCAGCAGTTTAGC), RS1000163961 (12:112036789 A>G), RS1000265842 (12:112035748 G>C,T), RS1000289629 (12:112083927 A>G), RS1000339077 (12:112064801 G>A,C,T), RS1000363022 (12:112049716 G>A), RS1000391686 (12:112064554 C>T), RS1000442457 (12:112027919 T>C), RS1000501074 (12:112035127 A>G,T), RS1000530659 (12:112089643 G>A), RS1000536476 (12:112057734 T>C,G)

Disease associations

OMIM: gene MIM:612755 | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

34 associations (top):

Study	Trait	p-value
GCST000038_1	Type 1 diabetes	2.000000e-16
GCST000258_8	Type 1 diabetes	6.000000e-18
GCST001474_12	Hypothyroidism	3.000000e-12
GCST004131_54	Inflammatory bowel disease	2.000000e-09
GCST004132_84	Crohn’s disease	7.000000e-07
GCST004603_121	Platelet count	2.000000e-54
GCST004607_57	Plateletcrit	7.000000e-58
GCST005329_1	Coffee consumption	2.000000e-16
GCST005439_1	Response to alcohol consumption (flushing response)	2.000000e-14
GCST005440_17	Alcohol dependence symptom count	6.000000e-10
GCST005441_8	Alcohol consumption (max-drinks)	2.000000e-12
GCST005951_1	Body mass index	4.000000e-12
GCST005951_75	Body mass index	2.000000e-11
GCST006166_13	Diastolic blood pressure x alcohol consumption interaction (2df test)	1.000000e-34
GCST006166_36	Diastolic blood pressure x alcohol consumption interaction (2df test)	3.000000e-33
GCST006167_26	Mean arterial pressure x alcohol consumption interaction (2df test)	6.000000e-12
GCST006231_56	Mean arterial pressure	2.000000e-17
GCST006434_40	Systolic blood pressure x alcohol consumption interaction (2df test)	6.000000e-21
GCST006434_64	Systolic blood pressure x alcohol consumption interaction (2df test)	5.000000e-19
GCST007576_238	Chronotype	1.000000e-10
GCST008058_12	Estimated glomerular filtration rate	1.000000e-09
GCST008059_211	Estimated glomerular filtration rate	3.000000e-08
GCST008060_19	Estimated glomerular filtration rate	3.000000e-06
GCST008972_141	Urate levels	2.000000e-13
GCST010274_1	Gout (combined type)	2.000000e-27
GCST010476_15	Myocardial infarction	1.000000e-09
GCST011499_1	Fish consumption	6.000000e-11
GCST011971_17	Weight	8.000000e-21
GCST011971_18	Weight	2.000000e-20
GCST012044_5	Tea consumption	6.000000e-08

EFO canonical traits (15, from GWAS)

EFO ID	Trait name
EFO:0004309	platelet count
EFO:0007985	platelet crit
EFO:0006782	cups of coffee per day measurement
EFO:0007835	alcohol dependence measurement
EFO:0004340	body mass index
EFO:0004329	alcohol drinking
EFO:0006336	diastolic blood pressure
EFO:0006340	mean arterial pressure
EFO:0006335	systolic blood pressure
EFO:0008328	chronotype measurement
EFO:0004531	urate measurement
EFO:0010139	fish consumption measurement
EFO:0004338	body weight
EFO:0010091	tea consumption measurement
EFO:0003939	energy intake

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

27 total (human), top 27 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Valproic Acid	increases expression, decreases expression	4
sodium arsenite	decreases expression, affects cotreatment, increases abundance, increases expression	3
Cyclosporine	increases expression	2
triphenyl phosphate	affects expression	1
kojic acid	increases expression	1
trichostatin A	increases expression	1
arsenite	affects binding, decreases reaction	1
di-n-butylphosphoric acid	affects expression	1
2,3,5-(triglutathion-S-yl)hydroquinone	increases ADP-ribosylation	1
jinfukang	decreases expression	1
Acetaminophen	decreases expression	1
Allergens	increases expression	1
Arsenic	affects cotreatment, increases abundance, increases expression, decreases expression	1
Dichlorodiphenyl Dichloroethylene	increases expression	1
Enzyme Inhibitors	decreases activity, increases O-linked glycosylation	1
Estradiol	increases expression	1
Formaldehyde	decreases expression	1
Ivermectin	decreases expression	1
Nickel	increases expression	1
Ribonucleotides	affects binding	1
Rotenone	decreases expression	1
Tetrachlorodibenzodioxin	decreases expression	1
Vincristine	decreases expression	1
7,8-Dihydro-7,8-dihydroxybenzo(a)pyrene 9,10-oxide	decreases expression	1
Aflatoxin B1	decreases methylation	1
beta-Naphthoflavone	increases expression	1
Copper Sulfate	increases expression	1

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.