NAMPT

Summary

NAMPT (nicotinamide phosphoribosyltransferase, HGNC:30092) is a protein-coding gene on chromosome 7q22.3, encoding Nicotinamide phosphoribosyltransferase (P43490). Catalyzes the condensation of nicotinamide with 5-phosphoribosyl-1-pyrophosphate to yield nicotinamide mononucleotide, an intermediate in the biosynthesis of NAD. It is a selective cancer dependency (DepMap: 33.6% of cell lines).

This gene encodes a protein that catalyzes the condensation of nicotinamide with 5-phosphoribosyl-1-pyrophosphate to yield nicotinamide mononucleotide, one step in the biosynthesis of nicotinamide adenine dinucleotide. The protein belongs to the nicotinic acid phosphoribosyltransferase (NAPRTase) family and is thought to be involved in many important biological processes, including metabolism, stress response and aging. This gene has a pseudogene on chromosome 10.

Source: NCBI Gene 10135 — RefSeq curated summary.

At a glance

• GWAS associations: 2
• Clinical variants (ClinVar): 39 total
• Regional missense constraint (gnomAD): 1 of 4 regions constrained (≈5% of expected missense variation)
• GTEx eGene: eQTL in 14 tissues, sQTL in 3 (q < 0.05)
• Drug target: yes — 2 curated mechanism-of-action drugs; 4 molecules with ChEMBL bioactivity
• Cancer dependency (DepMap): dependent in 33.6% of screened cell lines
• Constraint (gnomAD): pLI 1.00 (loss-of-function intolerant), LOEUF 0.34 (highly constrained)
• MANE Select transcript: NM_005746
• Interaction hub: 2,956 STRING partners (top 3% of genes corpus-wide)

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:30092
Approved symbol	NAMPT
Name	nicotinamide phosphoribosyltransferase
Location	7q22.3
Locus type	gene with protein product
Status	Approved
Aliases	PBEF
Ensembl gene	ENSG00000105835
Ensembl biotype	protein_coding
OMIM	608764
Entrez	10135

Gene structure

Transcript identifiers

Ensembl transcripts: 64 — 29 protein_coding, 17 nonsense_mediated_decay, 14 retained_intron, 4 protein_coding_CDS_not_defined

MANE Select: ENST00000222553

Transcript support level (Ensembl TSL; 1 = fully mRNA-supported): TSL 1: 3, TSL 2: 4, TSL 3: 2, TSL 4: 4

ENST00000222553, ENST00000354289, ENST00000393618, ENST00000417537, ENST00000424768, ENST00000441045, ENST00000463871, ENST00000467730, ENST00000484527, ENST00000486949, ENST00000489358, ENST00000489732, ENST00000491027, ENST00000679461, ENST00000679643, ENST00000679717, ENST00000679873, ENST00000679894, ENST00000679951, ENST00000680077, ENST00000680129, ENST00000680152, ENST00000680468, ENST00000680482, ENST00000680516, ENST00000680584, ENST00000680616, ENST00000680669, ENST00000680675, ENST00000680708, ENST00000680786, ENST00000680823, ENST00000680864, ENST00000680991, ENST00000681223, ENST00000681255, ENST00000681297, ENST00000681372, ENST00000681391, ENST00000681455, ENST00000681456, ENST00000681491, ENST00000681494, ENST00000681550, ENST00000681631, ENST00000681653, ENST00000681878, ENST00000681887, ENST00000681936, ENST00000901886, ENST00000901887, ENST00000921397, ENST00000968694, ENST00001005257, ENST00001039537, ENST00001039538, ENST00001039539, ENST00001039541, ENST00001039543, ENST00001039544, ENST00001092482, ENST00001092483, ENST00001092484, ENST00001137869

RefSeq mRNA: 1 — MANE Select: NM_005746 NM_005746

CCDS: CCDS5737

Canonical transcript exons

ENST00000222553 — 11 exons

Exon	Start	End
ENSE00000714587	106263392	106263617
ENSE00000714588	106261588	106261707
ENSE00000714590	106254364	106254504
ENSE00000714592	106253017	106253151
ENSE00000881741	106248298	106251193
ENSE00001516080	106284828	106284983
ENSE00003465913	106277023	106277179
ENSE00003517363	106269154	106269312
ENSE00003655156	106274946	106275049
ENSE00003666475	106268464	106268600
ENSE00003687091	106272530	106272658

Expression profiles

Bgee: expression breadth ubiquitous, 291 present calls, max score 99.42.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 211.0872 / max 19186.5621, expressed in 1824 samples.

Highest expression (Bgee): blood, pericardium, mucosa of stomach, lower esophagus mucosa, lung.

Genetic regulation across tissues (GTEx eQTL / sQTL)

NAMPT is an eGene in GTEx v10 — its expression is genetically regulated (eQTL) in 14 tissues and its splicing (sQTL) in 3 (q < 0.05). Strongest associations first; slope = normalized effect of the lead variant’s alternative allele.

17 significant tissue × QTL associations:

Tissue	QTL	q-value	Slope	Lead variant
Cells Cultured fibroblasts	eqtl	2.9e-14	-0.18	7:106228146:T:C
Heart Left Ventricle	eqtl	5.5e-06	-0.10	7:106294357:G:A
Artery Tibial	eqtl	6.2e-06	-0.11	7:106258028:T:C
Heart Atrial Appendage	eqtl	8.0e-06	-0.11	7:106258959:C:T
Cells Cultured fibroblasts	sqtl	1.1e-04	+0.30	7:106278979:T:C
Adipose Visceral Omentum	sqtl	1.9e-04	-0.32	7:106233301:G:A
Brain Cerebellar Hemisphere	eqtl	4.9e-04	-0.21	7:106237966:A:G
Brain Cerebellum	eqtl	5.7e-04	-0.20	7:106231974:T:C
Esophagus Muscularis	eqtl	1.2e-03	-0.09	7:106285885:C:A
Adipose Subcutaneous	sqtl	1.1e-02	+0.27	7:106278476:A:T
Muscle Skeletal	eqtl	1.8e-02	-0.10	7:106289014:ATAACTATCAATGGTACTAAGATACATGTT:A
Nerve Tibial	eqtl	1.9e-02	-0.18	7:107272939:A:C
Brain Frontal Cortex BA9	eqtl	2.1e-02	+0.15	7:106068492:A:G
Adipose Visceral Omentum	eqtl	2.2e-02	-0.06	7:106235244:A:G
Thyroid	eqtl	2.4e-02	+0.23	7:105470399:C:G
Whole Blood	eqtl	3.8e-02	-0.05	7:106224959:A:G
Minor Salivary Gland	eqtl	4.1e-02	+0.16	7:105742304:T:C

FANTOM5 promoters

showing 10 of 31 alternative TSS:

Promoter ID	TPM avg	Samples expressed
85541	102.1935	1789
85542	79.5813	1815
85543	12.5390	1752
85490	9.7423	868
85539	2.4761	1088
85548	0.7883	95
85549	0.7010	95
85537	0.3660	86
85496	0.2372	28
204636	0.2291	68

Top tissues by expression

showing 100 of 294 tissues by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
blood	UBERON:0000178	99.42	gold quality
pericardium	UBERON:0002407	99.28	gold quality
mucosa of stomach	UBERON:0001199	99.02	gold quality
lower esophagus mucosa	UBERON:0035834	98.99	gold quality
right lung	UBERON:0002167	98.83	gold quality
vena cava	UBERON:0004087	98.79	gold quality
upper lobe of left lung	UBERON:0008952	98.76	gold quality
left uterine tube	UBERON:0001303	98.73	gold quality
upper lobe of lung	UBERON:0008948	98.69	gold quality
cauda epididymis	UBERON:0004360	98.63	gold quality
lower lobe of lung	UBERON:0008949	98.49	gold quality
gall bladder	UBERON:0002110	98.40	gold quality
adrenal tissue	UBERON:0018303	98.32	gold quality
monocyte	CL:0000576	98.24	gold quality
pharyngeal mucosa	UBERON:0000355	98.24	gold quality
esophagus mucosa	UBERON:0002469	98.24	gold quality
peritoneum	UBERON:0002358	98.17	gold quality
omental fat pad	UBERON:0010414	98.17	gold quality
nipple	UBERON:0002030	98.08	gold quality
mononuclear cell	CL:0000842	97.83	gold quality
leukocyte	CL:0000738	97.78	gold quality
adipose tissue of abdominal region	UBERON:0007808	97.74	gold quality
mucosa of paranasal sinus	UBERON:0005030	97.65	gold quality
minor salivary gland	UBERON:0001830	97.52	gold quality
periodontal ligament	UBERON:0008266	97.49	gold quality
heart right ventricle	UBERON:0002080	97.48	gold quality
vermiform appendix	UBERON:0001154	97.46	gold quality
islet of Langerhans	UBERON:0000006	97.39	gold quality
right lobe of liver	UBERON:0001114	97.28	gold quality
saphenous vein	UBERON:0007318	97.26	gold quality
penis	UBERON:0000989	97.02	gold quality
bone marrow	UBERON:0002371	97.02	gold quality
mucosa of urinary bladder	UBERON:0001259	96.81	gold quality
tibial artery	UBERON:0007610	96.79	gold quality
popliteal artery	UBERON:0002250	96.78	gold quality
lung	UBERON:0002048	96.76	gold quality
spleen	UBERON:0002106	96.74	gold quality
upper leg skin	UBERON:0004262	96.74	gold quality
artery	UBERON:0001637	96.65	gold quality
mouth mucosa	UBERON:0003729	96.59	gold quality
descending thoracic aorta	UBERON:0002345	96.54	gold quality
right atrium auricular region	UBERON:0006631	96.52	gold quality
saliva-secreting gland	UBERON:0001044	96.50	gold quality
trabecular bone tissue	UBERON:0002483	96.44	gold quality
colonic epithelium	UBERON:0000397	96.40	gold quality
rectum	UBERON:0001052	96.21	gold quality
cartilage tissue	UBERON:0002418	96.21	gold quality
esophagus	UBERON:0001043	96.19	gold quality
urinary bladder	UBERON:0001255	96.19	gold quality
aorta	UBERON:0000947	96.08	gold quality
trachea	UBERON:0003126	96.06	gold quality
liver	UBERON:0002107	96.04	gold quality
oral cavity	UBERON:0000167	95.99	gold quality
calcaneal tendon	UBERON:0003701	95.97	gold quality
adrenal gland	UBERON:0002369	95.95	gold quality
hindlimb stylopod muscle	UBERON:0004252	95.93	gold quality
left adrenal gland	UBERON:0001234	95.89	gold quality
ectocervix	UBERON:0012249	95.85	gold quality
left adrenal gland cortex	UBERON:0035825	95.85	gold quality
olfactory segment of nasal mucosa	UBERON:0005386	95.84	gold quality
cardiac atrium	UBERON:0002081	95.83	gold quality
left coronary artery	UBERON:0001626	95.80	gold quality
gastrocnemius	UBERON:0001388	95.77	gold quality
coronary artery	UBERON:0001621	95.77	gold quality
cardia of stomach	UBERON:0001162	95.73	gold quality
caecum	UBERON:0001153	95.72	gold quality
subcutaneous adipose tissue	UBERON:0002190	95.63	gold quality
body of stomach	UBERON:0001161	95.60	gold quality
muscle of leg	UBERON:0001383	95.59	gold quality
adrenal cortex	UBERON:0001235	95.54	gold quality
heart	UBERON:0000948	95.53	gold quality
type B pancreatic cell	CL:0000169	95.42	gold quality
esophagus squamous epithelium	UBERON:0006920	95.41	gold quality
vagina	UBERON:0000996	95.37	gold quality
adipose tissue	UBERON:0001013	95.32	gold quality
heart left ventricle	UBERON:0002084	95.30	gold quality
pancreas	UBERON:0001264	95.27	gold quality
superficial temporal artery	UBERON:0001614	95.27	gold quality
cardiac ventricle	UBERON:0002082	95.27	gold quality
smooth muscle tissue	UBERON:0001135	95.20	gold quality
connective tissue	UBERON:0002384	95.19	gold quality
thoracic aorta	UBERON:0001515	95.17	gold quality
ascending aorta	UBERON:0001496	95.15	gold quality
stromal cell of endometrium	CL:0002255	95.14	gold quality
body of pancreas	UBERON:0001150	95.00	gold quality
right adrenal gland	UBERON:0001233	94.94	gold quality
stomach	UBERON:0000945	94.91	gold quality
skin of abdomen	UBERON:0001416	94.85	gold quality
prostate gland	UBERON:0002367	94.85	gold quality
right ovary	UBERON:0002118	94.78	gold quality
palpebral conjunctiva	UBERON:0001812	94.74	gold quality
tonsil	UBERON:0002372	94.73	gold quality
right coronary artery	UBERON:0001625	94.71	gold quality
pleura	UBERON:0000977	94.68	gold quality
parietal pleura	UBERON:0002400	94.67	gold quality
right adrenal gland cortex	UBERON:0035827	94.56	gold quality
visceral pleura	UBERON:0002401	94.52	gold quality
body of tongue	UBERON:0011876	94.44	gold quality
tibial nerve	UBERON:0001323	94.40	gold quality
eye	UBERON:0000970	94.28	gold quality

Single-cell (SCXA)

Detected in 44 experiment(s), a significant marker in 38.

Experiment	Marker?	Max mean expression
E-MTAB-9221	yes	53125.90
E-MTAB-6678	yes	15051.71
E-GEOD-149689	yes	12152.16
E-GEOD-139324	yes	9179.68
E-HCAD-36	yes	9052.55
E-GEOD-150728	yes	8121.76
E-HCAD-15	yes	6745.67
E-GEOD-130148	yes	5553.65
E-HCAD-32	yes	4280.08
E-MTAB-10855	yes	4017.30
E-CURD-112	yes	3950.59
E-CURD-120	yes	3931.62
E-CURD-126	yes	3755.93
E-CURD-46	yes	3726.96
E-MTAB-9841	yes	3362.76

HPA expression

RNA tissue specificity: Tissue enhanced

showing 60 of 80 HPA tissues / cells by nTPM:

Tissue / cell	Axis	nTPM	Protein (IHC)
Appendix	tissue	339.4	medium
Bone marrow	tissue	294.8	low
Urinary bladder	tissue	263.5	low
Liver	tissue	224.4	low
Esophagus	tissue	214.3	low
Adipose tissue	tissue	198.2	not detected
Gallbladder	tissue	106.2	medium
Placenta	tissue	81.8	low
Pancreas	tissue	76.3	medium
Adrenal gland	tissue	65.7	medium
Lung	tissue	54.6	low
Vagina	tissue	54.1	low
Salivary gland	tissue	51.0	low
Breast	tissue	49.6	medium
Spleen	tissue	47.2	medium
Smooth muscle	tissue	44.7	not detected
Tongue	tissue	41.8
Stomach 1	tissue	41.2	medium
Skeletal muscle	tissue	40.2	not detected
Colon	tissue	38.7	medium
Choroid plexus	tissue	37.5
Tonsil	tissue	37.4	medium
Small intestine	tissue	37.3	medium
Duodenum	tissue	36.1	medium
Heart muscle	tissue	34.3	not detected
Locus coeruleus	tissue	34.1
Prostate	tissue	33.4	low
Frontal cortex	tissue	29.5
Endometrium 1	tissue	28.8	low
Caudate putamen	tissue	28.6
Rectum	tissue	28.5	medium
Kidney	tissue	27.4	low
Parathyroid gland	tissue	24.4	not detected
Spinal cord	tissue	23.6
Lymph node	tissue	21.6	low
Cervix	tissue	21.5	medium
Cerebral cortex	tissue	21.3	low
Motor cortex	tissue	21.3
Hippocampus	tissue	21.0	not detected
Corpus callosum	tissue	20.8
Prefrontal cortex	tissue	20.7
Midbrain	tissue	20.6
Thalamus	tissue	20.6
Retrosplenial and cingulate cortex	tissue	20.6
Somatosensory cortex	tissue	20.4
Hippocampal formation	tissue	20.1
Entorhinal cortex	tissue	20.1
Pons	tissue	20.0
Substantia nigra	tissue	19.9
Thyroid gland	tissue	19.7	low
Cerebellum	tissue	19.5	not detected
Occipital cortex	tissue	19.3
Superior colliculi	tissue	19.0
Pituitary gland	tissue	18.9
Putamen	tissue	18.8
Retrosplenial cortex	tissue	18.8
Medulla oblongata	tissue	18.3
Periaqueductal gray	tissue	18.2
Temporal cortex	tissue	18.2
Septum	tissue	17.6

Brain sub-regions (HPA Brain Atlas): detected in 191; highest nTPM — Nucleus raphe pallidus (152.9), Area postrema (104.8), Anterior thalamic nucleus, ventral (93.4), Blood vessel (82.9), Area parastriata, superior (68.1).

Regulation

Is transcription factor: no

Upstream regulators (CollecTRI, top): BMAL1, CLOCK, HIF1A, JUN, NEUROD1, NFKB1, NFKB, PPARA, PPARD, PPARG, PRKAA1, RELA, RORB

Functional genomics

gnomAD constraint: pLI 1, LOEUF 0.336, missense Z 3.61 — population loss-of-function intolerance (pLI ≥ 0.9 = LoF-intolerant; lower LOEUF = more constrained). gnomAD

Regional missense constraint (gnomAD)

ENST00000222553 splits into 4 regions with different missense tolerance; 1 is missense-constrained (≈5% of the expected missense variation). Missense variants in a constrained region (low observed/expected) are more likely to be pathogenic. gnomAD

Region (GRCh38)	Missense obs / exp	o/e	Constrained
7:106,251,086–106,268,581	143 / 331.1	0.43	no
7:106,268,582–106,269,204	2 / 26.2	0.08	yes (p 2.3e-06)
7:106,269,205–106,284,842	103 / 194.2	0.53	no
7:106,284,843–106,284,884	23 / 16.4	1.40	no
DepMap (CRISPR cell-line fitness): dependent in 33.6% of screened cell lines.

Most-dependent cell lines (DepMap gene-effect, lower = stronger; ≤ −0.5 shown): SNU-16 (-2.75), COLO 205 (-2.573), AsPC-1 (-2.454), MDA-MB-231 (-2.407), SU-DHL-8 (-2.398), SNU-C5 (-2.285), THP-1 (-2.233), PA-TU-8902 (-2.165), NOMO-1 (-2.022), PF-382 (-1.914), RKO (-1.909), SNU-C1 (-1.855), MC116 (-1.73), OCI-AML2 (-1.727), SNU-5 (-1.717).

Literature-anchored findings (GeneRIF, showing 40)

• PBEF1 is upregulated in neutrophils by IL-1beta and functions as a novel inhibitor of apoptosis in response to a variety of inflammatory stimuli. (PMID:15124023)
• These findings identify PBEF1 as a regulator of NAD+-dependent reactions in smooth muscle cells (SMCs), reactions that promote, among other potential processes, the acquisition of a mature SMC phenotype. (PMID:15947248)
• Although PBEF had no chemotaxic effects, it was antiapoptotic for both amniotic epithelial cells and fibroblasts and may protect these cells against apoptosis that is induced by chronic distension, labor, or infection. (PMID:16021090)
• visfatin plasma concentrations and visceral visfatin messenger RNA expression correlated with measures of obesity but not with visceral fat mass or waist-to-hip ratio (PMID:16186392)
• PBEF contributes to acute lung injury susceptibility (PMID:16188281)
• visfatin may play a role in the pathogenesis of type 2 diabetes mellitus (PMID:16234302)
• A true adipokine, but it is not regulated by thiazolidineidones and, thus unlikely to contribute to the insulin-sensitizing actions of these drugs. (PMID:16394088)
• increased macrophage population in obese human visceral white adipose tissue might be responsible for the enhanced production of chemokines as well as resistin and visfatin (PMID:16496121)
• Visfatin/pre-B-cell colony-enhancing factor appears to be preferentially produced by the visceral adipose tissue and has insulin mimetic actions (PMID:16531748)
• data suggest that genetic variation in the visfatin gene may have a minor effect on visceral and subcutaneous visfatin messenger RNA expression profiles but does not play a major role in the development of obesity or type 2 diabetes mellitus (PMID:16636125)
• These data show that an inflammatory stimulus in the fetal membranes inducing NF-kappaB and AP-1 would up-regulate PBEF as well as IL-8. (PMID:16701870)
• findings show that, in human obesity, plasma visfatin is reduced, whereas visfatin mRNA is differentially regulated in adipose tissue (PMID:16720654)
• Circulating visfatin concentrations are increased by hyperglycaemia. This effect is suppressed by exogenous hyperinsulinaemia or somatostatin infusion. (PMID:16736128)
• FK866 is bound in a tunnel at the interface of the NMPRTase dimer, and mutations in this binding site can abolish the inhibition by FK866, providing a starting point for the development of new anticancer agents. (PMID:16783377)
• Pre-B cell colony-enhancing factor (PBEF) is regulated via IL-6 trans-signaling and the IL-6-related cytokine OSM. PBEF is also actively expressed during arthritis. (PMID:16802343)
• results show that there are decreased concentrations of plasma visfatin in gestational diabetes mellitus subjects and this may indicate that visfatin plays a role in the pathogenesis of gestational diabetes mellitus (PMID:16814166)
• visfatin is a new hypoxia-inducible gene of which expression is stimulated through the interaction of HIF-1 with HRE sites in its promoter region. (PMID:16828081)
• visfatin has a local metabolic role in the recovery period following exercise. (PMID:16868228)
• The results indicate that hyperglycemia causes an increase in plasma visfatin levels and, as in people with diabetes mellitus type 2 but not with impaired glucose tolerance, this increase gets more prominent as the glucose intolerance worsens. (PMID:16956691)
• circulating visfatin is increased with progressive beta-cell deterioration. (PMID:17003355)
• A significant association was found between two SNPs of visfatin (rs9770242 and rs1319501), in perfect linkage disequilibrium, and fasting insulin levels (P = 0.002). (PMID:17003359)
• visfatin is highly expressed in lean, more insulin-sensitive subjects and is attenuated in subjects with high intramyocellular lipids, low insulin sensitivity, and high levels of inflammatory markers (PMID:17090638)
• potential link with pathogenesis of glucose resistance and type 2 diabetes (PMID:17177135)
• In patients with inflammatory bowel disease, plasma levels of visfatin are elevated and its mRNA expression is significantly increased in colonic tissue of Crohn’s and ulcerative colitis patients (PMID:17237424)
• Circulating levels of the cytokine visfatin/PBEF-1 are influenced by renal function, but are not associated with fat mass or surrogate markers of insulin resistance in patients with chronic kidney disease. (PMID:17261426)
• Visfatin is down-regulated by overfeeding (PMID:17284735)
• Nampt is a longevity protein that can add stress-resistant life to human smooth muscle cells by optimizing SIRT1-mediated p53 degradation (PMID:17307730)
• Serum visfatin concentration is significantly associated with parameters of iron metabolism, especially in subjects with altered glucose tolerance. (PMID:17327330)
• An increase in fasting visfatin, the levels of which correlate with both fasting and post-glucose-load insulin concentrations, accompanies worsening glucose tolerance in the third trimester of pregnancy. (PMID:17334748)
• Women with PCOS exhibit higher plasma visfatin levels than control subjects of similar body mass index. (PMID:17335820)
• the regulation of glucose uptake, proliferation, and type I collagen production by visfatin in human osteoblasts involves IR phosphorylation, the same signal-transduction pathway used by insulin (PMID:17340225)
• This review summarizes current knowledge of the various functions of PBEF/visfatin towards involvement in the pathophysiology of several diseases. (PMID:17392604)
• Taken together, these results demonstrate that visfatin promotes angiogenesis via activation of mitogen-activated protein kinase ERK-dependent pathway. (PMID:17408594)
• PBEF/NAMPT/visfatin level is an indicator of beneficial lipid profile in non-diabetic Caucasian subjects (PMID:17429683)
• Plasma visfatin levels are increased in overweight and obese subjects with metabolic syndrome. (PMID:17556870)
• Visfatin has a role in insulin resistance and markers of hyperandrogenism in lean PCOS patients (PMID:17582143)
• During fasting, increased Nampt provides protection against cell death and requires an intact mitochondrial NAD(+) salvage pathway as well as the mitochondrial NAD(+)-dependent deacetylases SIRT3 and SIRT4. (PMID:17889652)
• Circulating visfatin may be related with some proinflammatory condition even in a nondiabetic state (PMID:17904242)
• Rosuvastatin induced a significant decrease in plasma visfatin levels in patients with primary hyperlipidemia. (PMID:17931620)
• Visfatin, TNF-alpha, and IL-6 mRNA expressions are increased in peripheral mononuclear-monocytic cells from women with type 2 diabetes. (PMID:17952840)

Cross-species orthologs

7 orthologs

Organism	Symbol	Gene ID
danio_rerio	nampt1	ENSDARG00000030598
danio_rerio	nampt3.1	ENSDARG00000076694
danio_rerio	nampt3.2	ENSDARG00000078738
danio_rerio	nampt4.1	ENSDARG00000100321
danio_rerio	nampt4.2	ENSDARG00000112678
mus_musculus	Nampt	ENSMUSG00000020572
rattus_norvegicus	Nampt	ENSRNOG00000009754

Paralogs (1): NAPRT (ENSG00000147813)

Mouse-model phenotypes

Observed phenotypes of the mouse ortholog (MGI:1929865) from MGI (Alliance of Genome Resources) — knockout/mutant phenotypes, ranked by annotation count. 28 distinct phenotype terms.

Mouse phenotype (MP)	Records
preweaning lethality, complete penetrance	2
decreased neutrophil cell number	1
optic nerve atrophy	1
abnormal retina morphology	1
thymus hypoplasia	1
hydrocephaly	1
abnormal brain morphology	1
decreased insulin secretion	1
abnormal photoreceptor outer segment morphology	1
abnormal photoreceptor inner segment morphology	1
abnormal rod electrophysiology	1
abnormal cone electrophysiology	1
decreased B cell number	1
decreased T cell number	1
decreased double-negative T cell number	1
decreased susceptibility to injury	1
impaired glucose tolerance	1
retina pigment epithelium atrophy	1
decreased circulating glucose level	1
abnormal mitochondrial morphology	1
retina cone cell degeneration	1
retina photoreceptor degeneration	1
thin retina outer nuclear layer	1
decreased interleukin-6 secretion	1
embryonic lethality, complete penetrance	1

+3 more (showing top 25).

Additional cross-species homologs

Sequence homologs in species beyond Ensembl Compara’s model organisms, by Diamond local protein alignment (% sequence identity; best hit per species). Lower-identity rows are more distant homologs. The matched accessions’ gene symbols aren’t in biobtree yet, so each row shows the UniProt accession.

Organism	UniProt	Identity	Method
Sus scrofa	Q52I78	98.0%	Diamond
Mycoplasmoides genitalium G37	P47283	66.7%	Diamond
Mycoplasmoides pneumoniae M129	P75067	66.7%	Diamond
Xanthomonas campestris pv. campestris str. 8004	A0A0H2X5R2	44.0%	Diamond
Acinetobacter baylyi ADP1	Q6FDK2	34.1%	Diamond

Genomic neighbors (locus context)

Genes flanking this one on the chromosome (NCBI/Entrez gene neighborhood). Positional context only — some neighbors share regulatory elements (bidirectional promoters, antisense/overlapping transcripts), but chromosomal adjacency is not itself a functional relationship (see Interactions for that).

Symbol	Type	Entrez
NAMPT-AS1	ncRNA	128266843
CCDC71L	protein-coding	168455
CTB-30L5.1	ncRNA	102724339
SYPL1	protein-coding	6856

Protein

Protein identifiers

Nicotinamide phosphoribosyltransferase — P43490 (reviewed: P43490)

Alternative names: Pre-B-cell colony-enhancing factor 1, Visfatin

All UniProt accessions (26): A0A0C4DFS8, A0A7P0T862, A0A7P0T895, A0A7P0T8D2, A0A7P0T8L3, A0A7P0T8R4, A0A7P0T8Z3, A0A7P0T931, A0A7P0T941, A0A7P0T973, A0A7P0T9F0, A0A7P0T9I9, A0A7P0TA73, A0A7P0TAI8, A0A7P0TAS5, A0A7P0TAZ2, A0A7P0TB17, A0A7P0TBB7, A0A7P0Z437, A0A7P0Z466, A0A7P0Z4L4, A0A7P0Z4N0, B7Z8W6, C9JF35, C9JG65, P43490

UniProt curated annotations — full annotation on UniProt →

Function. Catalyzes the condensation of nicotinamide with 5-phosphoribosyl-1-pyrophosphate to yield nicotinamide mononucleotide, an intermediate in the biosynthesis of NAD. It is the rate limiting component in the mammalian NAD biosynthesis pathway. The secreted form behaves both as a cytokine with immunomodulating properties and an adipokine with anti-diabetic properties, it has no enzymatic activity, partly because of lack of activation by ATP, which has a low level in extracellular space and plasma. Plays a role in the modulation of circadian clock function. NAMPT-dependent oscillatory production of NAD regulates oscillation of clock target gene expression by releasing the core clock component: CLOCK-BMAL1 heterodimer from NAD-dependent SIRT1-mediated suppression.

Subunit / interactions. Homodimer.

Subcellular location. Nucleus. Cytoplasm. Secreted.

Tissue specificity. Expressed in large amounts in bone marrow, liver tissue, and muscle. Also present in heart, placenta, lung, and kidney tissues.

Activity regulation. Inhibited by FK866. FK866 competes for the same binding site as nicotinamide, but due to its very low dissociation rate, it is essentially an irreversible inhibitor.

Pathway. Cofactor biosynthesis; NAD(+) biosynthesis; nicotinamide D-ribonucleotide from 5-phospho-alpha-D-ribose 1-diphosphate and nicotinamide: step 1/1.

Similarity. Belongs to the NAPRTase family.

RefSeq proteins (1): NP_005737* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR013785	Aldolase_TIM	Homologous_superfamily
IPR016471	Nicotinamide_PRibTrfase	Family
IPR036068	Nicotinate_pribotase-like_C	Homologous_superfamily
IPR041525	N/Namide_PRibTrfase	Domain
IPR041529	DUF5598	Domain

Pfam: PF04095, PF18127

Enzyme classification (BRENDA)

• EC 2.4.2.12 — nicotinamide phosphoribosyltransferase (BRENDA: 7 organisms, 46 substrates, 542 inhibitors, 51 Km, 10 kcat entries)

Substrate kinetics (BRENDA)

7 substrates with measured Km, best-characterized 7. Km ranges are aggregated across organisms/conditions.

Substrate	Km (mM)	Measurements
NICOTINAMIDE	—	27
5-PHOSPHO-ALPHA-D-RIBOSE 1-DIPHOSPHATE	0.0001–0.78	15
ALPHA-D-5-PHOSPHORIBOSYL 1-DIPHOSPHATE	0.0006–0.0117	3
5-PHOSPHORIBOSYL 1-DIPHOSPHATE	0.0005–0.0232	2
ATP	2.2–7.4	2
ADP	0.44	1
PHOSPHATE	0.18	1

Catalyzed reactions (Rhea)

• beta-nicotinamide D-ribonucleotide + diphosphate = 5-phospho-alpha-D-ribose 1-diphosphate + nicotinamide + H(+) (RHEA:16149)

UniProt features (72 total): helix 27, strand 26, binding site 8, modified residue 3, mutagenesis site 3, turn 3, chain 1, sequence variant 1

Structure

Experimental structures (PDB)

showing 30 of 85 structures by resolution:

PDB	Title	Method	Resolution (Å)
8DSC	Human NAMPT in complex with substrate NAM and small molecule activator NP-A1-R	X-RAY DIFFRACTION	1.32
8DSE	Human NAMPT in complex with substrate NAM and activator quercitrin	X-RAY DIFFRACTION	1.43
8DSD	Human NAMPT in complex with substrate NAM and small molecule activator NP-A1-S	X-RAY DIFFRACTION	1.43
8DSI	Human NAMPT in complex with substrate NAM	X-RAY DIFFRACTION	1.43
9WDD	Crystal structure of NAMPT-KPT-7523 complex	X-RAY DIFFRACTION	1.45
4LVF	Fragment-based Identification of Amides Derived From …	X-RAY DIFFRACTION	1.5
6E68	NAMPT co-crystal with inhibitor compound 2	X-RAY DIFFRACTION	1.5
4LVA	Fragment-based Identification of Amides Derived From …	X-RAY DIFFRACTION	1.55
4O10	Structural and Biochemical Analyses of the Catalysis and Potency Impact of Inhibitor …	X-RAY DIFFRACTION	1.55
6TA0	Human NAMPT in complex with nicotinic acid and phosphoribosyl pyrophosphate	X-RAY DIFFRACTION	1.58
4KFN	Structure-Based Discovery of Novel Amide-Containing Nicotinamide …	X-RAY DIFFRACTION	1.6
4KFO	Structure-Based Discovery of Novel Amide-Containing Nicotinamide …	X-RAY DIFFRACTION	1.6
5KIT	Crystal Structure of Nicotinamide Phosphoribosyltransferase (Nampt) in Complex with …	X-RAY DIFFRACTION	1.6
6TAC	Human NAMPT deletion mutant in complex with nicotinamide mononucleotide, pyrophosphate …	X-RAY DIFFRACTION	1.6
4LWW	Discovery of Potent and Efficacious Cyanoguanidine-containing Nicotinamide …	X-RAY DIFFRACTION	1.64
4O1B	The crystal structure of a mutant NAMPT (G217R) in complex with an inhibitor APO866	X-RAY DIFFRACTION	1.65
6TA2	Human NAMPT in complex with nicotinic acid mononucleotide and phosphate	X-RAY DIFFRACTION	1.68
5UPF	Crystal structure of human NAMPT with isoindoline urea inhibitor compound 53	X-RAY DIFFRACTION	1.69
4LTS	Discovery of Potent and Efficacious Cyanoguanidine-containing Nicotinamide …	X-RAY DIFFRACTION	1.69
4N9D	Fragment-based Design of 3-Aminopyridine-derived Amides as Potent Inhibitors of Human …	X-RAY DIFFRACTION	1.7
4LVG	Fragment-based Identification of Amides Derived From …	X-RAY DIFFRACTION	1.7
4O1D	Structural Basis for Resistance to Diverse Classes of NAMPT Inhibitors	X-RAY DIFFRACTION	1.71
4N9E	Fragment-based Design of 3-Aminopyridine-derived Amides as Potent Inhibitors of Human …	X-RAY DIFFRACTION	1.72
4WQ6	The crystal structure of human Nicotinamide phosphoribosyltransferase (NAMPT) in complex …	X-RAY DIFFRACTION	1.72
5U2N	Crystal structure of human NAMPT with A-1326133	X-RAY DIFFRACTION	1.73
7PPH	CRYSTAL STRUCTURE OF NAMPT IN COMPLEX WITH Compound 10	X-RAY DIFFRACTION	1.74
4LVD	Fragment-based Identification of Amides Derived From …	X-RAY DIFFRACTION	1.75
4M6P	Identification of Amides Derived From 1H-Pyrazolo[3,4-b]pyridine-5-carboxylic Acid as …	X-RAY DIFFRACTION	1.75
4O13	The crystal structure of NAMPT in complex with GNE-618	X-RAY DIFFRACTION	1.75
4O19	The crystal structure of a mutant NAMPT (G217V)	X-RAY DIFFRACTION	1.75

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-P43490-F1	94.36	0.90

Human Protein Atlas

Protein class: Enzymes, ENZYME proteins, Transferases, Metabolic proteins, Predicted secreted proteins, Predicted intracellular proteins, Plasma proteins, Cancer-related genes, Candidate cancer biomarkers

Protein evidence: Evidence at protein level

Subcellular location (HPA, imaging): nuclear speckles; cell junctions

Antibody reliability (HPA): IH approved · IF approved

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Ligand- & substrate-binding residues (8)

Position	Role
196	diphosphate
219	beta-nicotinamide D-ribonucleotide
247	diphosphate
311–313	beta-nicotinamide D-ribonucleotide
311	diphosphate
353–354	beta-nicotinamide D-ribonucleotide
384	beta-nicotinamide D-ribonucleotide
392	beta-nicotinamide D-ribonucleotide

Post-translational modifications (3)

Type	Positions
Phosphotyrosine	188
Phosphoserine	472
N-acetylmethionine	1

Mutagenesis-validated functional residues (3)

Position	Phenotype
219	no effect on activity towards nicotinamide. alters specificity, so that the enzyme acquires activity towards nicotinic acid.
247	reduces activity towards nicotinamide.
311	reduces activity towards nicotinamide.

Function

Pathways and Gene Ontology

Reactome pathways

1 curated (TAS) of 11; 0 disease pathways. Curated-first; evidence = TAS (manually curated) vs IEA (electronic inference).

11 pathways:

ID	Pathway	Evidence
R-HSA-196807	Nicotinate metabolism	curated
R-HSA-1368108	BMAL1:CLOCK,NPAS2 activates circadian expression	electronic
R-HSA-9909396	Circadian clock	—
R-HSA-74160	Gene expression (Transcription)	—
R-HSA-212436	Generic Transcription Pathway	—
R-HSA-1430728	Metabolism	—
R-HSA-196854	Metabolism of vitamins and cofactors	—
R-HSA-196849	Metabolism of water-soluble vitamins and cofactors	—
R-HSA-9768919	NPAS4 regulates expression of target genes	electronic
R-HSA-73857	RNA Polymerase II Transcription	—
R-HSA-9634815	Transcriptional Regulation by NPAS4	—

MSigDB gene sets: 556 (showing top): GOBP_CIRCADIAN_RHYTHM, MODULE_92, GOBP_RESPONSE_TO_NITROGEN_COMPOUND, RODRIGUES_THYROID_CARCINOMA_ANAPLASTIC_UP, MCLACHLAN_DENTAL_CARIES_UP, RODRIGUES_THYROID_CARCINOMA_POORLY_DIFFERENTIATED_UP, GOBP_INFLAMMATORY_RESPONSE, GOBP_NADPPLUS_METABOLIC_PROCESS, MODULE_45, MODULE_64, GOBP_CANONICAL_NF_KAPPAB_SIGNAL_TRANSDUCTION, ROVERSI_GLIOMA_COPY_NUMBER_UP, MENSE_HYPOXIA_UP, GOBP_POSITIVE_REGULATION_OF_MAPK_CASCADE, GOBP_ORGANOPHOSPHATE_METABOLIC_PROCESS

GO Biological Process (16): NADP+ biosynthetic process (GO:0006741), inflammatory response (GO:0006954), signal transduction (GO:0007165), cell-cell signaling (GO:0007267), positive regulation of cell population proliferation (GO:0008284), NAD+ biosynthetic process (GO:0009435), positive regulation of gene expression (GO:0010628), circadian regulation of gene expression (GO:0032922), NAD+ biosynthetic process via the salvage pathway (GO:0034355), positive regulation of canonical NF-kappaB signal transduction (GO:0043123), positive regulation of transcription by RNA polymerase II (GO:0045944), positive regulation of ERK1 and ERK2 cascade (GO:0070374), nicotinate metabolic process (GO:1901847), circadian rhythm (GO:0007623), pyridine nucleotide biosynthetic process (GO:0019363), rhythmic process (GO:0048511)

GO Molecular Function (7): cytokine activity (GO:0005125), identical protein binding (GO:0042802), nicotinamide phosphoribosyltransferase activity (GO:0047280), catalytic activity (GO:0003824), protein binding (GO:0005515), transferase activity (GO:0016740), glycosyltransferase activity (GO:0016757)

GO Cellular Component (6): nucleus (GO:0005634), mitochondrial matrix (GO:0005759), cytosol (GO:0005829), extracellular exosome (GO:0070062), extracellular region (GO:0005576), cytoplasm (GO:0005737)

Reactome top-level categories

8 top-level categories:

Category	Pathways
Circadian clock	1
Metabolism of water-soluble vitamins and cofactors	1
Transcriptional Regulation by NPAS4	1
Metabolism of vitamins and cofactors	1
Metabolism	1
RNA Polymerase II Transcription	1
Gene expression (Transcription)	1
Generic Transcription Pathway	1

GO top-level categories

50 GO namespaces:

Category	Terms
cellular anatomical structure	3
purine nucleotide biosynthetic process	2
nicotinamide nucleotide biosynthetic process	2
NAD+ metabolic process	2
cell communication	2
signaling	2
regulation of gene expression	2
NADP+ metabolic process	1
defense response	1
cellular process	1
regulation of cellular process	1
cellular response to stimulus	1
cell population proliferation	1
regulation of cell population proliferation	1
positive regulation of cellular process	1
gene expression	1
positive regulation of macromolecule biosynthetic process	1
circadian rhythm	1
NAD+ biosynthetic process	1
pyridine nucleotide salvage	1
purine nucleotide salvage	1
canonical NF-kappaB signal transduction	1
regulation of canonical NF-kappaB signal transduction	1
positive regulation of intracellular signal transduction	1
regulation of transcription by RNA polymerase II	1
transcription by RNA polymerase II	1
positive regulation of DNA-templated transcription	1
positive regulation of MAPK cascade	1
ERK1 and ERK2 cascade	1
regulation of ERK1 and ERK2 cascade	1
alkaloid metabolic process	1
monocarboxylic acid metabolic process	1
pyridine-containing compound metabolic process	1
rhythmic process	1
nucleotide biosynthetic process	1
pyridine-containing compound biosynthetic process	1
biological_process	1
receptor ligand activity	1
protein binding	1
pentosyltransferase activity	1
molecular_function	1
binding	1
catalytic activity	1
transferase activity	1
intracellular membrane-bounded organelle	1
mitochondrion	1
intracellular organelle lumen	1
cytoplasm	1
extracellular vesicle	1
intracellular anatomical structure	1

Experimentally-supported GO annotations

GO terms backed by direct experimental evidence (ECO experimental codes) — 8 of 30 annotations. The rest are phylogenetic / computational / electronic (IEA).

8 experimentally-supported GO terms:

GO term	NS	Evidence
inflammatory response	BP	direct assay
positive regulation of ERK1 and ERK2 cascade	BP	direct assay
positive regulation of canonical NF-kappaB signal transduction	BP	direct assay
positive regulation of gene expression	BP	direct assay
positive regulation of transcription by RNA polymerase II	BP	direct assay
extracellular exosome	CC	high-throughput assay
identical protein binding	MF	physical interaction
nicotinamide phosphoribosyltransferase activity	MF	mutant phenotype

Protein interactions and networks

STRING

showing 15 of 2,956 interactions by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
NAMPT	NAPRT	Q6XQN6	948
NAMPT	NMNAT1	Q9HAN9	905
NAMPT	RETN	Q9HD89	883
NAMPT	SIRT1	Q96EB6	881
NAMPT	RETNLB	Q9BQ08	881
NAMPT	ADIPOQ	Q15848	862
NAMPT	LEP	P41159	800
NAMPT	BMAL1	O00327	784
NAMPT	CLOCK	O15516	784
NAMPT	RARRES2	Q99969	762
NAMPT	ITLN1	Q8WWA0	760
NAMPT	PER2	O15055	759
NAMPT	SERPINA12	Q8IW75	750
NAMPT	A0A2R8YFG2	A0A2R8YFG2	742
NAMPT	NMNAT2	Q9BZQ4	740

IntAct

Human interaction partners of NAMPT in IntAct, one row per partner (best MIscore; records = supporting IntAct interaction records).

12 partners by confidence:

Partner	Interaction type	MIscore	Records
USP49	physical association	0.560	3
FTL	physical association	0.510	3
IFITM3	physical association	0.510	3
MT-ND1	physical association	0.510	3
ETFA	physical association	0.400	1
XPO7	physical association	0.400	1
ADORA2A	physical association	0.370	1
AKT2	physical association	0.370	1
GGT1	physical association	0.370	1
UBE2L6	physical association	0.370	1
MAPK15	association	0.350	1
DISC1	physical association	0.000	1

BioGRID (182 interactions; top human partners by supporting records): IFITM3 (Proximity Label-MS; 4 records), FTL (Two-hybrid; 3 records), ND1 (Two-hybrid; 3 records), TMEM25 (Affinity Capture-MS; 3 records), CCNF (Affinity Capture-MS; 2 records), MYC (Affinity Capture-MS; 2 records), PARK2 (Affinity Capture-MS; 2 records), TFRC (Affinity Capture-MS; 2 records), AAR2 (Affinity Capture-MS), ADORA2A (Two-hybrid), AGR2 (Affinity Capture-MS), AKAP1 (Proximity Label-MS), AKT2 (Two-hybrid), ANPEP (Proximity Label-MS), ANXA6 (Co-fractionation)

SIGNOR signaling

5 signaling interactions:

A	Effect	B	Mechanism
NAMPT	“up-regulates quantity”	NAD(1-)	“chemical modification”
PRKAA1	“up-regulates quantity”	NAMPT	“transcriptional regulation”
AMPK	“up-regulates quantity”	NAMPT
CLOCK/BMAL1	“up-regulates quantity by expression”	NAMPT	“transcriptional regulation”
NAMPT	down-regulates	CLOCK/BMAL1

Disease & clinical

Genetic variants

Variant evidence for NAMPT: 39 ClinVar records (0 pathogenic / likely pathogenic); 2 GWAS associations.

ClinVar

39 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	16
Likely benign	2
Benign	4

SpliceAI

Top 10 splice-impact sites by Δscore (adjacent positions with the same effect merged into one range; 22 predictions of 763):

Position(s)	Effect	Δscore	Sites
7:106253016	donor_loss	1.0000	2
7:106253153	acceptor_loss	1.0000
7:106253160	acceptor_gain	1.0000
7:106268462–106268463	donor_loss	1.0000	5
7:106268615	acceptor_gain	1.0000
7:106268622	acceptor_gain	1.0000
7:106272528–106272529	donor_loss	1.0000	5
7:106272659–106272660	acceptor_loss	1.0000	4
7:106272664	acceptor_gain	1.0000
7:106272667	acceptor_gain	1.0000

AlphaMissense

1,534 missense substitutions predicted likely pathogenic (of 3,225 scored), across 347 residues. Top 20 hotspot residues, ranked by the number of likely-pathogenic substitutions (of those reachable by a single-nucleotide change), then by mean score:

Residue	Likely-pathogenic substitutions	Mean am_pathogenicity	Max am_pathogenicity
D16	8	0.997	0.999
D279	8	0.996	0.998
H247	8	0.995	0.999
D219	8	0.994	0.998
D313	8	0.993	0.997
D192	8	0.990	0.997
H22	8	0.989	0.999
D354	8	0.988	0.997
F193	8	0.983	0.999
H211	8	0.983	0.997
D393	8	0.981	0.994
F215	8	0.957	0.998
H90	8	0.944	0.993
F380	8	0.941	0.991
F96	8	0.939	0.993
F91	8	0.926	0.985
N377	8	0.919	0.995
F37	8	0.909	0.982
S248	8	0.909	0.995
H191	8	0.908	0.984

HPA cancer prognostics

RNA cancer specificity: Low cancer specificity

Human Protein Atlas survival analysis — favorable = higher expression predicts better survival.

2 prognostic cancer types:

Cancer	Prognostic	p-value
Pancreatic Adenocarcinoma (validation)	unfavorable	4.04e-05
Kidney Renal Clear Cell Carcinoma (validation)	unfavorable	0.00087

Disease associations

OMIM: gene MIM:608764 | disease phenotypes:

GWAS associations

2 associations:

Study	Trait	p-value
GCST012380_2	Eosinophilic esophagitis	1e-8
GCST008531_4	Grapefruit juice consumption	9e-6

EFO canonical traits (from GWAS)

1 canonical traits:

EFO ID	Trait name
EFO:0010094	grapefruit juice consumption measurement

Drugs & pharmacology

Drug and pharmacology data

Is drug target: yes

ChEMBL targets (4): CHEMBL1744525 (SINGLE PROTEIN), CHEMBL5465234 (PROTEIN-PROTEIN INTERACTION), CHEMBL6066026 (PROTEIN-PROTEIN INTERACTION), CHEMBL6193845 (PROTEIN-PROTEIN INTERACTION)

Drugs by curated mechanism of action (ChEMBL)

Drugs whose curated ChEMBL mechanism of action targets the NAMPT protein itself — single-protein targets only (drugs acting on a protein family or complex that merely includes it are excluded). Includes antibodies and oligonucleotides that bioactivity screening does not capture.

2 curated-mechanism drugs:

Drug	Modality	Max phase
DAPORINAD	Small molecule	2
TEGLARINAD CHLORIDE	Small molecule	2

Molecules with ChEMBL bioactivity

Phase ≥1, by development phase (incl. off-target/promiscuous compounds). Patent mentions across the top 20 by phase: 3,634 (via chembl_molecule»patent_compound — counts attach to the compound, not the gene–compound relationship, so off-target/promiscuous molecules can dominate).

4 molecules by phase:

Molecule	Name	Phase	Patents
CHEMBL3621988	TUCIDINOSTAT	3	2,280
CHEMBL566757	DAPORINAD	2	624
CHEMBL4297467	PADNARSERTIB	2	135
CHEMBL17289	CHS-828	1	595

PharmGKB: 1 entry (CPIC guideline: no)

PharmGKB variant annotations

Per-publication pharmacogenomic findings for this gene (significant associations).

3 published findings:

Variant	Drug(s)	Category	Finding	PMID
rs1319501		Other	Genotypes CC + CT is associated with decreased steady-state level of NAMPT protein as compared to genotype TT.	PMID:27168100
rs3801266		Other	Genotypes CC + CT is associated with increased steady-state level of NAMPT protein as compared to genotype TT.	PMID:27168100
rs1319501	nitric oxide	Efficacy	Genotype TT is associated with increased concentrations of nitric oxide in women with Pre-Eclampsia as compared to genotypes CC + CT.	PMID:33944612

Binding affinities (BindingDB)

5350 measured of 6098 human assays (6100 total across all organisms); most potent 50 below. Values come from heterogeneous assays and are not directly comparable.

Ligand	Measure	Value	Patent
3-(4-{[2-methoxy-5- (trifluoromethyl)phenyl]sulfamoyl}phenyl)-1- (pyridin-3-ylmethyl)urea	IC50	0.1 nM	US-11279687: Compounds and compositions for the inhibition of NAMPT
CHEMBL6168792	IC50	0.12 nM
CHEMBL5429026	IC50	0.15 nM
CHEMBL4544378	IC50	0.155 nM
CHEMBL5437893	IC50	0.16 nM
CHEMBL3260316	IC50	0.174 nM
CHEMBL3094250	IC50	0.2 nM
MPI-0479626	IC50	0.23 nM
CHEMBL2417796	IC50	0.23 nM
CHEMBL4851176	IC50	0.23 nM
CHEMBL1801863	IC50	0.3 nM
CHEMBL3094255	IC50	0.3 nM
3-(pyridin-3-ylmethyl)-1-{4-[(5,6,7,8- tetrahydronaphthalen-1- yl)sulfamoyl]phenyl}urea	IC50	0.3 nM	US-11279687: Compounds and compositions for the inhibition of NAMPT
3-{4-[(2-chloro-5- methylphenyl)sulfamoyl]phenyl}-1-(pyridin- 3-ylmethyl)urea	IC50	0.3 nM	US-11279687: Compounds and compositions for the inhibition of NAMPT
CHEMBL4860398	IC50	0.32 nM
CHEMBL4873506	IC50	0.32 nM
CHEMBL4852664	IC50	0.41 nM
CHEMBL3260317	IC50	0.412 nM
CHEMBL1801864	IC50	0.45 nM
CHEMBL4868614	IC50	0.46 nM
CHEMBL3260314	IC50	0.461 nM
CHEMBL4859375	IC50	0.48 nM
1-[4-(1H-indole-7-sulfonyl)phenyl]-3-(pyridin- 3-ylmethyl)urea	IC50	0.5 nM	US-11279687: Compounds and compositions for the inhibition of NAMPT
CHEMBL1801934	IC50	0.55 nM
CHEMBL3098518	IC50	0.6 nM
3-(4-{[2- (difluoromethoxy)phenyl]sulfamoyl}phenyl)- 1-(pyridin-3-ylmethyl)urea	IC50	0.6 nM	US-11279687: Compounds and compositions for the inhibition of NAMPT
CHEMBL3260315	IC50	0.632 nM
3-(4-{[3-fluoro-5-(trifluoromethyl)benzene]sulfonyl[phenyl)-1-(pyridin-3-ylmethyl)urea	IC50	0.7 nM	US-11279687: Compounds and compositions for the inhibition of NAMPT
CHEMBL1801862	IC50	0.79 nM
1-cyano-2-[[4-(3,4-difluorophenyl)sulfonylphenyl]methyl]-3-pyridin-4-ylguanidine	IC50	0.8 nM	US-9676721: Compounds and compositions for the inhibition of NAMPT
1-[4-(dibenzylsulfamoyl)phenyl]-3-(pyridin-3- ylmethyl)urea	IC50	0.8 nM	US-11279687: Compounds and compositions for the inhibition of NAMPT
3-{4-[(2-iodophenyl)sulfamoyl]phenyl}-1- (pyridin-3-ylmethyl)urea	IC50	0.8 nM	US-11279687: Compounds and compositions for the inhibition of NAMPT
N-[4-[4-[(2-cyclopropylacetyl)amino]cyclohexyl]phenyl]-1,3-dihydropyrrolo[3,4-c]pyridine-2-carboxamide	IC50	0.86 nM	US-9302989: NAMPT and rock inhibitors
3-{4-[(2,3-dimethylphenyl)sulfamoyl]phenyl}- 1-(pyridin-3-ylmethyl)urea	IC50	0.9 nM	US-11279687: Compounds and compositions for the inhibition of NAMPT
3-{4-[(2-chloro-4- fluorophenyl)sulfamoyl]phenyl}-1-(pyridin-3- ylmethyl)urea	IC50	0.9 nM	US-11279687: Compounds and compositions for the inhibition of NAMPT
3-{4-[(5-chloro-2- methoxyphenyl)sulfamoyl]phenyl}-1-(pyridin- 3-ylmethyl)urea	IC50	0.9 nM	US-11279687: Compounds and compositions for the inhibition of NAMPT
3-{4-[benzyl(ethyl)sulfamoyl]phenyl}-1- (pyridin-3-ylmethyl)urea	IC50	0.9 nM	US-11279687: Compounds and compositions for the inhibition of NAMPT
3-{4-[(3-chloro-4- methylbenzene)sulfonyl]phenyl}-1-(pyridin-3- ylmethyl)urea	IC50	0.9 nM	US-11279687: Compounds and compositions for the inhibition of NAMPT
N-[[5-[[6-(4-methylpiperazin-1-yl)-3-pyridinyl]sulfonyl]-2-pyridinyl]methyl]furo[2,3-c]pyridine-2-carboxamide	IC50	0.916 nM	US-9458172: Pyridinyl and pyrimidinyl sulfoxide and sulfone derivatives
N-[4-(1-benzoylpiperidin-4-yl)butyl]-5-cyano-1,3-dihydroisoindole-2-carboxamide	IC50	0.946 nM	US-9302989: NAMPT and rock inhibitors
N-[4-[4-(2-methylpropanoylamino)cyclohexyl]phenyl]-1,3-dihydropyrrolo[3,4-c]pyridine-2-carboxamide	IC50	0.973 nM	US-9302989: NAMPT and rock inhibitors
N-[[5-(3,5-dimethoxyphenyl)sulfonyl-2-pyridinyl]methyl]furo[2,3-c]pyridine-2-carboxamide	IC50	0.99 nM	US-9458172: Pyridinyl and pyrimidinyl sulfoxide and sulfone derivatives
2-[[4-[4-chloro-3-(trifluoromethyl)phenyl]sulfonylphenyl]methyl]-1-cyano-3-pyridin-4-ylguanidine	IC50	1 nM	US-9676721: Compounds and compositions for the inhibition of NAMPT
1-cyano-2-[[4-(3,5-difluorophenyl)sulfonylphenyl]methyl]-3-pyridin-4-ylguanidine	IC50	1 nM	US-9676721: Compounds and compositions for the inhibition of NAMPT
2-[2-[4-(benzenesulfonyl)phenyl]ethyl]-1-cyano-3-pyridin-4-ylguanidine	IC50	1 nM	US-9676721: Compounds and compositions for the inhibition of NAMPT
1-cyano-2-[[4-(3-fluoro-4-methoxyphenyl)sulfonylphenyl]methyl]-3-pyridin-4-ylguanidine	IC50	1 nM	US-9676721: Compounds and compositions for the inhibition of NAMPT
1-cyano-2-[[4-(1-methylindazol-6-yl)sulfonylphenyl]methyl]-3-pyridin-4-ylguanidine	IC50	1 nM	US-9676721: Compounds and compositions for the inhibition of NAMPT
1-cyano-3-pyridin-4-yl-2-[(4-quinolin-3-ylsulfonylphenyl)methyl]guanidine	IC50	1 nM	US-9676721: Compounds and compositions for the inhibition of NAMPT
CB-30685	IC50	1 nM
1-[4-(benzenesulfonyl)phenyl]-3-(imidazo[1,2-a]pyridin-6-ylmethyl)urea	IC50	1 nM	US-11279687: Compounds and compositions for the inhibition of NAMPT

ChEMBL bioactivities

5525 potent at pChembl≥5 of 5648 total, top 50 by pChembl (potency: 10 = 0.1 nM, 6 = 1 µM).

pChembl	Type	Value	Unit	Molecule
10.52	IC50	0.0301	nM	DAPORINAD
10.29	IC50	0.0509	nM	CHEMBL3753643
10.00	IC50	0.1	nM	CHEMBL5750961
9.82	IC50	0.15	nM	DAPORINAD
9.82	IC50	0.15	nM	CHEMBL5429026
9.81	IC50	0.155	nM	CHEMBL4544378
9.80	IC50	0.16	nM	CHEMBL5437893
9.76	IC50	0.174	nM	CHEMBL3260316
9.70	IC50	0.2	nM	CHEMBL3094250
9.70	Ki	0.2	nM	DAPORINAD
9.70	Ki	0.2	nM	CHEMBL4440516
9.64	IC50	0.23	nM	CHEMBL2417796
9.64	IC50	0.23	nM	CHEMBL5572833
9.52	IC50	0.3	nM	CHEMBL1801863
9.52	Ki	0.3	nM	DAPORINAD
9.52	IC50	0.3	nM	CHEMBL3094255
9.52	IC50	0.3	nM	CHEMBL5825361
9.52	IC50	0.3	nM	CHEMBL5816481
9.51	IC50	0.31	nM	CHEMBL123756
9.40	IC50	0.4	nM	CHEMBL3968268
9.38	IC50	0.412	nM	CHEMBL3260317
9.35	IC50	0.45	nM	CHEMBL1801864
9.34	IC50	0.461	nM	CHEMBL3260314
9.30	IC50	0.5	nM	CHEMBL1801864
9.30	IC50	0.5	nM	CHEMBL5774398
9.26	IC50	0.55	nM	CHEMBL1801934
9.25	IC50	0.56	nM	DAPORINAD
9.22	IC50	0.6	nM	CHEMBL3098518
9.22	IC50	0.6	nM	CHEMBL3916438
9.22	IC50	0.6	nM	CHEMBL5995645
9.20	IC50	0.632	nM	CHEMBL3260315
9.20	EC50	0.63	nM	CHEMBL5434442
9.15	IC50	0.7	nM	CHEMBL5982902
9.10	IC50	0.8	nM	CHEMBL5799317
9.10	IC50	0.8	nM	CHEMBL5998092
9.10	IC50	0.8	nM	CHEMBL5764220
9.10	IC50	0.79	nM	CHEMBL1801862
9.07	IC50	0.86	nM	CHEMBL3900725
9.05	IC50	0.9	nM	CHEMBL6005980
9.05	IC50	0.9	nM	CHEMBL5746218
9.05	IC50	0.9	nM	CHEMBL5748396
9.05	IC50	0.9	nM	CHEMBL5869571
9.05	IC50	0.9	nM	CHEMBL6054737
9.04	IC50	0.916	nM	CHEMBL3914799
9.02	IC50	0.946	nM	CHEMBL3919342
9.01	IC50	0.973	nM	CHEMBL3900838
9.00	IC50	1	nM	CHEMBL2420634
9.00	IC50	1	nM	CHEMBL2420633
9.00	IC50	1	nM	CHS-828
9.00	IC50	1	nM	DAPORINAD

PubChem BioAssay actives

1125 with measured affinity, of 2125 total; 50 most potent distinct compounds. Largely complementary to BindingDB; screening values are coarse (µM, 4 dp), so sub-nM hits tie at the floor.

Compound	Assay	Type	Value	Unit
(E)-N-[4-[1-[3-[bis(2-chloroethyl)amino]benzoyl]piperidin-4-yl]butyl]-3-pyridin-3-ylprop-2-enamide	2004628: Inhibition of recombinant human NAMPT preincubated for 5 mins followed by NAM addition measured for 15 mins by fluorescence based assay	ic50	0.0001	uM
2-[6-(4-chlorophenoxy)hexyl]-1-cyano-3-pyridin-4-ylguanidine	1799546: In Vitro Inhibition Assay from Article 10.1016/j.chembiol.2010.05.008: “Chemical proteomics identifies Nampt as the target of CB30865, an orphan cytotoxic compound.”	ic50	0.0001	uM
(E)-N-[4-(1-benzoylpiperidin-4-yl)butyl]-3-pyridin-3-ylprop-2-enamide	1799546: In Vitro Inhibition Assay from Article 10.1016/j.chembiol.2010.05.008: “Chemical proteomics identifies Nampt as the target of CB30865, an orphan cytotoxic compound.”	ic50	0.0001	uM
(E)-N-[5-[4-[[2-(1H-indol-3-yl)ethyl-propan-2-ylamino]methyl]anilino]pentyl]-3-pyridin-3-ylprop-2-enamide	1625940: Inhibition of NAMPT in human MCF7 cells assessed as decrease in NAD production after 24 hrs by NAD/NADH Glo assay	ic50	0.0002	uM
(E)-N-[4-[1-[2-[bis(2-chloroethyl)amino]benzoyl]piperidin-4-yl]butyl]-3-pyridin-3-ylprop-2-enamide	2004628: Inhibition of recombinant human NAMPT preincubated for 5 mins followed by NAM addition measured for 15 mins by fluorescence based assay	ic50	0.0002	uM
tert-butyl N-[2-[2-[2-oxo-2-[[3-[4-[4-[[(E)-3-pyridin-3-ylprop-2-enoyl]amino]butyl]piperidine-1-carbonyl]phenyl]methylamino]ethoxy]ethoxy]ethyl]carbamate	1515664: Displacement of fluorescent labelled OG488 from human full length FLAG-tagged NAMPT (1 to 491 residues) expressed in HEK293-6E cells in presence of PRPP by TR-FRET assay	ki	0.0002	uM
7-[[(cyanoamino)-(pyridin-4-ylamino)methylidene]amino]-N-cyclohexyl-N-(2-morpholin-4-ylethoxy)heptanamide	1057516: Inhibition of NAMPT in human HepG2 cells using [14C]-nicotinamide/PRPP as substrate assessed as formation of [14C]-nicotinamide mononucleotide after 1 hr by liquid scintillation counting analysis	ic50	0.0002	uM
4-[[2-[[4-(2-aminoethyl)piperazin-1-yl]methyl]-7-chloro-3-methyl-4-oxoquinazolin-6-yl]methyl-prop-2-ynylamino]-N-(pyridin-3-ylmethyl)benzamide	1799546: In Vitro Inhibition Assay from Article 10.1016/j.chembiol.2010.05.008: “Chemical proteomics identifies Nampt as the target of CB30865, an orphan cytotoxic compound.”	ic50	0.0002	uM
N-(3-imidazol-1-ylpropyl)-2-[3-methylbutyl-(2-phenoxyacetyl)amino]-1,3-thiazole-5-carboxamide	1137945: Inhibition of recombinant human C-terminally His-tagged NAMPT by TR-FRET assay in presence of PRPP	ic50	0.0002	uM
4-[[7-bromo-3-methyl-2-[(4-methylpiperazin-1-yl)methyl]-4-oxoquinazolin-6-yl]methyl-prop-2-ynylamino]-N-(pyridin-3-ylmethyl)benzamide	767963: Inhibition of NAMPT (unknown origin)	ic50	0.0002	uM
4-[[7-chloro-3-methyl-2-[(4-methylpiperazin-1-yl)methyl]-4-oxoquinazolin-6-yl]methyl-prop-2-ynylamino]-N-(pyridin-3-ylmethyl)benzamide	1799546: In Vitro Inhibition Assay from Article 10.1016/j.chembiol.2010.05.008: “Chemical proteomics identifies Nampt as the target of CB30865, an orphan cytotoxic compound.”	ic50	0.0002	uM
1-cyano-2-[6-[cyclohexyl(2-morpholin-4-ylethoxy)sulfamoyl]hexyl]-3-pyridin-4-ylguanidine	1057516: Inhibition of NAMPT in human HepG2 cells using [14C]-nicotinamide/PRPP as substrate assessed as formation of [14C]-nicotinamide mononucleotide after 1 hr by liquid scintillation counting analysis	ic50	0.0003	uM
4-[[2-[[4-(3-aminopropyl)piperazin-1-yl]methyl]-7-chloro-3-methyl-4-oxoquinazolin-6-yl]methyl-prop-2-ynylamino]-N-(pyridin-3-ylmethyl)benzamide	604933: Inhibition of nicotinamide phosphoribosyltransferase-catalyzed conversion of nicotinamide to nicotinamide mononucleotide	ic50	0.0003	uM
4-[(7-chloro-3-methyl-4-oxo-1,2,3-benzotriazin-6-yl)methyl-(3-methylbut-2-enyl)amino]-N-(pyridin-3-ylmethyl)benzamide	604933: Inhibition of nicotinamide phosphoribosyltransferase-catalyzed conversion of nicotinamide to nicotinamide mononucleotide	ic50	0.0004	uM
N-[[6-[2-(4-methyloxan-4-yl)acetyl]-6-azaspiro[2.5]octan-2-yl]methyl]-1,3-dihydropyrrolo[3,4-c]pyridine-2-carboxamide	1327638: Inhibition of NAMPT in human A2780 cells assessed as decrease in cell viability after 72 hrs by SRB assay	ic50	0.0004	uM
N-(3-imidazol-1-ylpropyl)-2-[(2-methoxyacetyl)-(3-methylbutyl)amino]-1,3-thiazole-5-carboxamide	1137945: Inhibition of recombinant human C-terminally His-tagged NAMPT by TR-FRET assay in presence of PRPP	ic50	0.0004	uM
2-[(2-cyclohexylacetyl)-[(4-fluorophenyl)methyl]amino]-N-(3-imidazol-1-ylpropyl)-1,3-thiazole-5-carboxamide	1137945: Inhibition of recombinant human C-terminally His-tagged NAMPT by TR-FRET assay in presence of PRPP	ic50	0.0005	uM
(2S,4R)-1-[(2S)-3,3-dimethyl-2-[[2-[2-[2-[2-[2-[[4-[[4-[4-(pyridin-3-ylmethylcarbamothioylamino)phenyl]sulfonylpiperazin-1-yl]methyl]benzoyl]amino]ethoxy]ethoxy]ethoxy]ethoxy]acetyl]amino]butanoyl]-4-hydroxy-N-[(1S)-1-[4-(4-methyl-1,3-thiazol-5-yl)phenyl]ethyl]pyrrolidine-2-carboxamide	2012074: PROTAC activity at VHL/NAMPT in human A2780 cells assessed as protein degradation	ec50	0.0006	uM
4-[(7-chloro-2,3-dimethyl-4-oxoquinazolin-6-yl)methyl-prop-2-ynylamino]-N-(pyridin-3-ylmethyl)benzamide	604933: Inhibition of nicotinamide phosphoribosyltransferase-catalyzed conversion of nicotinamide to nicotinamide mononucleotide	ic50	0.0006	uM
1-cyano-2-[[4-(3,5-difluorophenyl)sulfonylphenyl]methyl]-3-pyridin-4-ylguanidine	1060645: Inhibition of Nampt (unknown origin) using nicotinamide as substrate preincubated for 15 mins measured after 30 mins by mass spectrometry analysis	ic50	0.0006	uM
2-[[2-(3,6-dihydro-2H-pyridin-1-yl)acetyl]-[(4-fluorophenyl)methyl]amino]-N-(3-imidazol-1-ylpropyl)-1,3-thiazole-5-carboxamide	1137945: Inhibition of recombinant human C-terminally His-tagged NAMPT by TR-FRET assay in presence of PRPP	ic50	0.0006	uM
(3-methyloxetan-3-yl) (2S)-2-[(1,3-dihydropyrrolo[3,4-c]pyridine-2-carbonylamino)methyl]-6-azaspiro[2.5]octane-6-carboxylate	1327638: Inhibition of NAMPT in human A2780 cells assessed as decrease in cell viability after 72 hrs by SRB assay	ic50	0.0006	uM
4-[[7-chloro-2-(hydroxymethyl)-3-methyl-4-oxoquinazolin-6-yl]methyl-prop-2-ynylamino]-N-(pyridin-3-ylmethyl)benzamide	604933: Inhibition of nicotinamide phosphoribosyltransferase-catalyzed conversion of nicotinamide to nicotinamide mononucleotide	ic50	0.0008	uM
(3-methyloxetan-3-yl) 2-[[(1,1,3,3-tetradeuteriopyrrolo[3,4-c]pyridine-2-carbonyl)amino]methyl]-6-azaspiro[2.5]octane-6-carboxylate	1327638: Inhibition of NAMPT in human A2780 cells assessed as decrease in cell viability after 72 hrs by SRB assay	ic50	0.0010	uM
tert-butyl (2S)-2-[(1,3-dihydropyrrolo[3,4-c]pyridine-2-carbonylamino)methyl]-6-azaspiro[2.5]octane-6-carboxylate	1327638: Inhibition of NAMPT in human A2780 cells assessed as decrease in cell viability after 72 hrs by SRB assay	ic50	0.0010	uM
trans-(1S,2S)-N-[4-[(1,3-dioxoisoindol-2-yl)methyl]phenyl]-2-pyridin-3-ylcyclopropane-1-carboxamide	1370711: Inhibition of full length recombinant C-terminal His8-tagged human NAMPT using 15N-CONH2Nicotinamide as substrate preincubated for 15 mins followed by substrate addition measured after 90 mins by mass spectrometric analysis	ic50	0.0010	uM
4-[(7-bromo-2-methyl-4-oxo-3H-quinazolin-6-yl)methyl-prop-2-ynylamino]-N-(pyridin-3-ylmethyl)benzamide	2106995: Inhibition of N-terminal His-tagged human NAMPT	ic50	0.0010	uM
N-[4-(1-benzoylpiperidin-4-yl)phenyl]-1,3-dihydroisoindole-2-carboxamide	1454317: Inhibition of C-terminal His-tagged human recombinant NAMPT using FK866 or isoindoline urea-based Oregon green (488) probe incubated for 3 hrs by TR-FRET assay	ki	0.0010	uM
N-[[4-[3-(trifluoromethyl)phenyl]sulfonylphenyl]methyl]imidazo[1,2-a]pyrimidine-6-carboxamide	765316: Inhibition of C-terminal His-tagged NAMPT (unknown origin) expressed in Escherichia coli BL21 using nicotinamide as substrate preincubated for 15 mins before substrate addition measured after 30 mins by mass spectrometry-based assay	ic50	0.0010	uM
N-[[4-[(6-morpholin-4-yl-3-pyridinyl)sulfonyl]phenyl]methyl]imidazo[1,2-a]pyrimidine-6-carboxamide	765316: Inhibition of C-terminal His-tagged NAMPT (unknown origin) expressed in Escherichia coli BL21 using nicotinamide as substrate preincubated for 15 mins before substrate addition measured after 30 mins by mass spectrometry-based assay	ic50	0.0010	uM
(3S)-1-[2-(4-methylphenyl)pyrazolo[3,4-d]pyrimidin-4-yl]-N-[(4-methylsulfanylphenyl)methyl]piperidine-3-carboxamide	2106990: Activation of C-terminal 6His-tagged human wild type NAMPT using NAM and PRPP as substrate measured for 30 mins in presence of ATP by fluorescence based spectrometric analysis	ec50	0.0010	uM
(E)-N-[4-[1-[4-[bis(2-chloroethyl)amino]benzoyl]piperidin-4-yl]butyl]-3-pyridin-3-ylprop-2-enamide	2004628: Inhibition of recombinant human NAMPT preincubated for 5 mins followed by NAM addition measured for 15 mins by fluorescence based assay	ic50	0.0011	uM
(E)-N-[4-[1-[3-(aminomethyl)benzoyl]piperidin-4-yl]butyl]-3-pyridin-3-ylprop-2-enamide	1515664: Displacement of fluorescent labelled OG488 from human full length FLAG-tagged NAMPT (1 to 491 residues) expressed in HEK293-6E cells in presence of PRPP by TR-FRET assay	ki	0.0011	uM
7-[[(cyanoamino)-(pyridin-4-ylamino)methylidene]amino]-N-cyclohexyloxyheptanamide	1057516: Inhibition of NAMPT in human HepG2 cells using [14C]-nicotinamide/PRPP as substrate assessed as formation of [14C]-nicotinamide mononucleotide after 1 hr by liquid scintillation counting analysis	ic50	0.0011	uM
N-[[4-(3,5-difluorophenyl)sulfonylphenyl]methyl]imidazo[1,2-a]pyridine-6-carboxamide	1137989: Inhibition of NAMPT in human PC3 cells assessed as reduction in NAD level after 48 hrs by mass spectrometry	ec50	0.0011	uM
(3S)-N-(1-benzothiophen-5-ylmethyl)-1-[2-[4-(trifluoromethyl)phenyl]pyrazolo[3,4-d]pyrimidin-4-yl]piperidine-3-carboxamide	2106990: Activation of C-terminal 6His-tagged human wild type NAMPT using NAM and PRPP as substrate measured for 30 mins in presence of ATP by fluorescence based spectrometric analysis	ec50	0.0012	uM
4-[3-methylbut-2-enyl-[(3-methyl-4-oxoquinazolin-6-yl)methyl]amino]-N-(pyridin-3-ylmethyl)benzamide	604933: Inhibition of nicotinamide phosphoribosyltransferase-catalyzed conversion of nicotinamide to nicotinamide mononucleotide	ic50	0.0012	uM
1-(pyridin-3-ylmethyl)-3-[4-[2-(trifluoromethoxy)phenyl]sulfonylphenyl]urea	767963: Inhibition of NAMPT (unknown origin)	ic50	0.0012	uM
N-[[4-[3-(trifluoromethyl)phenyl]sulfonylphenyl]methyl]-1H-pyrazolo[3,4-b]pyridine-5-carboxamide	1137989: Inhibition of NAMPT in human PC3 cells assessed as reduction in NAD level after 48 hrs by mass spectrometry	ec50	0.0012	uM
4-[1-[2-[bis(2-chloroethyl)amino]benzoyl]piperidin-4-yl]butyl (E)-3-pyridin-3-ylprop-2-enoate	2004628: Inhibition of recombinant human NAMPT preincubated for 5 mins followed by NAM addition measured for 15 mins by fluorescence based assay	ic50	0.0013	uM
3-[(2E)-2-[(2E,4E)-5-[3,3-dimethyl-5-sulfo-1-(3-sulfopropyl)indol-1-ium-2-yl]penta-2,4-dienylidene]-3-methyl-3-[6-oxo-6-[2-[2-[2-oxo-2-[[3-[4-[4-[[(E)-3-pyridin-3-ylprop-2-enoyl]amino]butyl]piperidine-1-carbonyl]phenyl]methylamino]ethoxy]ethoxy]ethylamino]hexyl]-5-sulfoindol-1-yl]propane-1-sulfonate	1515664: Displacement of fluorescent labelled OG488 from human full length FLAG-tagged NAMPT (1 to 491 residues) expressed in HEK293-6E cells in presence of PRPP by TR-FRET assay	ki	0.0013	uM
4-[(2-chlorophenyl)methyl-(cyclopropylmethyl)amino]-N-(pyridin-3-ylmethyl)benzamide	604933: Inhibition of nicotinamide phosphoribosyltransferase-catalyzed conversion of nicotinamide to nicotinamide mononucleotide	ic50	0.0013	uM
4-[(2,3-dimethyl-4-oxoquinazolin-6-yl)methyl-(3-methylbut-2-enyl)amino]-N-(pyridin-3-ylmethyl)benzamide	604933: Inhibition of nicotinamide phosphoribosyltransferase-catalyzed conversion of nicotinamide to nicotinamide mononucleotide	ic50	0.0014	uM
N-[4-[1-[2-methyl-2-(4-methylpiperazin-1-yl)propanoyl]piperidin-4-yl]phenyl]-1,3-dihydroisoindole-2-carboxamide	1454317: Inhibition of C-terminal His-tagged human recombinant NAMPT using FK866 or isoindoline urea-based Oregon green (488) probe incubated for 3 hrs by TR-FRET assay	ki	0.0015	uM
(2S,4R)-1-[(2S)-3,3-dimethyl-2-[11-[[4-[4-[4-[[(E)-3-pyridin-3-ylprop-2-enoyl]amino]butyl]piperidine-1-carbonyl]benzoyl]amino]undecanoylamino]butanoyl]-4-hydroxy-N-[(1S)-1-[4-(4-methyl-1,3-thiazol-5-yl)phenyl]ethyl]pyrrolidine-2-carboxamide	2012073: Inhibition of NAMPT (unknown origin)	ic50	0.0015	uM
(2S,4R)-1-[(2S)-3,3-dimethyl-2-[4-[[4-[4-[4-[[(E)-3-pyridin-3-ylprop-2-enoyl]amino]butyl]piperidine-1-carbonyl]benzoyl]amino]butanoylamino]butanoyl]-4-hydroxy-N-[(1S)-1-[4-(4-methyl-1,3-thiazol-5-yl)phenyl]ethyl]pyrrolidine-2-carboxamide	2012073: Inhibition of NAMPT (unknown origin)	ic50	0.0015	uM
1-[4-[cyclopentyl-[(4-methoxyphenyl)methyl]sulfamoyl]phenyl]-3-(2-pyridin-3-ylethyl)urea	2264158: Inhibition of NAMPT (unknown origin) using NAM as substrate preincubated for 5 mins followed by substrate addition and measured after 15 mins by fluorescence based microtiter plate reader analysis	ic50	0.0015	uM
4-[[(E)-but-2-enyl]-[(2-chlorophenyl)methyl]amino]-N-(pyridin-3-ylmethyl)benzamide	604933: Inhibition of nicotinamide phosphoribosyltransferase-catalyzed conversion of nicotinamide to nicotinamide mononucleotide	ic50	0.0015	uM
N-[[6-(2,4-dimethyl-1,3-oxazole-5-carbonyl)-6-azaspiro[2.5]octan-2-yl]methyl]-1,3-dihydropyrrolo[3,4-c]pyridine-2-carboxamide	1327638: Inhibition of NAMPT in human A2780 cells assessed as decrease in cell viability after 72 hrs by SRB assay	ic50	0.0016	uM
N-[[6-(3,3-dimethylbutanoyl)-6-azaspiro[2.5]octan-2-yl]methyl]-1,3-dihydropyrrolo[3,4-c]pyridine-2-carboxamide	1327638: Inhibition of NAMPT in human A2780 cells assessed as decrease in cell viability after 72 hrs by SRB assay	ic50	0.0016	uM

CTD chemical–gene interactions

141 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
sodium arsenite	increases abundance, increases expression, increases stability, affects cotreatment	4
N-(4-(1-benzoylpiperidin-4-yl)butyl)-3-(pyridin-3-yl)acrylamide	affects binding, decreases activity, increases abundance, decreases expression, increases reaction	3
Cisplatin	affects response to substance, affects cotreatment, increases expression	3
Dinitrochlorobenzene	increases expression, affects binding	3
Lipopolysaccharides	decreases reaction, increases expression, affects response to substance, affects cotreatment	3
Rotenone	decreases activity, decreases expression, increases expression	3
Tobacco Smoke Pollution	affects expression, increases expression	3
Valproic Acid	affects cotreatment, decreases expression	3
Cyclosporine	increases expression	3
Cadmium Chloride	increases abundance, increases expression	3
Particulate Matter	increases abundance, increases expression, decreases expression	3
bisphenol A	affects expression, decreases expression	2
manganese chloride	affects cotreatment, increases abundance, increases expression	2
Rosiglitazone	affects expression, decreases reaction, increases expression	2
Resveratrol	increases acetylation, decreases reaction, increases activity, affects reaction, increases expression (+2 more)	2
Zoledronic Acid	increases expression	2
Air Pollutants	increases abundance, increases expression	2
Benzo(a)pyrene	increases expression	2
Dexamethasone	increases expression, decreases expression	2
Doxorubicin	decreases expression, affects expression	2
Estradiol	affects expression, increases abundance, increases reaction	2
Glucose	decreases reaction, increases secretion, decreases expression, increases expression	2
Manganese	increases expression, affects cotreatment, increases abundance	2
Nickel	increases expression	2
Testosterone	affects cotreatment, increases expression, decreases expression	2
Tetrachlorodibenzodioxin	increases expression	2
Dronabinol	increases expression	2
Thiram	decreases expression, increases expression	2
Tretinoin	increases expression	2
7,8-Dihydro-7,8-dihydroxybenzo(a)pyrene 9,10-oxide	decreases expression	2

ChEMBL screening assays

299 unique, capped per target: 299 binding

Representative assays (with source publication via chembl_document):

Assay ID	Type	Description	Source paper
CHEMBL1763209	Binding	Inhibition of human NAmPRTase by spectrophotometric analysis	Design, synthesis and X-ray crystallographic study of NAmPRTase inhibitors as anti-cancer agents. — *Eur J Med Chem*

Cellosaurus cell lines

3 cell lines: 3 cancer cell line

First 10 cell lines (id-ordered, not curated):

Cellosaurus	Name	Category	Sex
CVCL_D1XP	Abcam A-549 NAMPT KO	Cancer cell line	Male
CVCL_D2C0	Abcam HCT 116 NAMPT KO	Cancer cell line	Male
CVCL_D2NQ	Abcam THP-1 NAMPT KO	Cancer cell line	Male

Clinical trials (associated diseases)

Via MONDO — disease-level, not drug-specific.

Predicted chemistry — Sugi Predict

The predicted patent-compound landscape for NAMPT across ~30M SureChEMBL compounds — explore on Sugi Predict.