NCKAP5

Summary

NCKAP5 (NCK associated protein 5, HGNC:29847) is a protein-coding gene on chromosome 2q21.2, encoding Nck-associated protein 5 (O14513).

Predicted to be involved in microtubule bundle formation and microtubule depolymerization. Predicted to be active in microtubule plus-end.

Source: NCBI Gene 344148 — RefSeq curated summary.

At a glance

• GWAS associations: 28
• Clinical variants (ClinVar): 356 total
• MANE Select transcript: NM_207363

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:29847
Approved symbol	NCKAP5
Name	NCK associated protein 5
Location	2q21.2
Locus type	gene with protein product
Status	Approved
Aliases	NAP5, ERIH1, ERIH2
Ensembl gene	ENSG00000176771
Ensembl biotype	protein_coding
OMIM	608789
Entrez	344148

Gene structure

Transcript identifiers

Ensembl transcripts: 7 — 6 protein_coding, 1 protein_coding_CDS_not_defined

ENST00000358991, ENST00000409213, ENST00000409261, ENST00000427594, ENST00000473859, ENST00000639875, ENST00000640590

RefSeq mRNA: 2 — MANE Select: NM_207363 NM_207363, NM_207481

CCDS: CCDS46417, CCDS46418

Canonical transcript exons

ENST00000409261 — 20 exons

Exon	Start	End
ENSE00001369250	132731737	132732051
ENSE00001374947	132728816	132728952
ENSE00001385533	132773816	132773894
ENSE00001389334	132725627	132725759
ENSE00001423426	133559050	133559117
ENSE00001528776	132781940	132785718
ENSE00001528778	132790023	132790205
ENSE00001528779	132796628	132796729
ENSE00001528781	132860492	132860611
ENSE00001528782	132868936	132868974
ENSE00001528783	132878848	132878916
ENSE00001582178	133568216	133568463
ENSE00001585426	133517458	133517587
ENSE00001589129	132671788	132673305
ENSE00001685730	133129978	133130111
ENSE00001703692	132963720	132963869
ENSE00001724301	132994152	132994239
ENSE00002478772	133303037	133303110
ENSE00003661755	132781052	132781229
ENSE00003788236	133213716	133213779

Expression profiles

Bgee: expression breadth ubiquitous, 132 present calls, max score 93.28.

FANTOM5 (CAGE): breadth broad, TPM avg 3.1412 / max 514.4643, expressed in 613 samples.

FANTOM5 promoters (9 alternative TSS)

Promoter ID	TPM avg	Samples expressed
30724	1.9016	456
30716	0.3907	139
30725	0.3566	120
30722	0.1749	64
30723	0.1542	53
30715	0.0741	35
30721	0.0482	19
30726	0.0309	11
30727	0.0100	3

Top tissues by expression

138 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
corpus callosum	UBERON:0002336	93.28	gold quality
cerebellar vermis	UBERON:0004720	89.83	gold quality
ventricular zone	UBERON:0003053	89.74	gold quality
quadriceps femoris	UBERON:0001377	88.27	gold quality
cortical plate	UBERON:0005343	88.00	gold quality
sural nerve	UBERON:0015488	85.03	gold quality
male germ line stem cell (sensu Vertebrata) in testis	CL:0000089 ∩ UBERON:0000473	83.90	gold quality
right lung	UBERON:0002167	83.60	gold quality
ganglionic eminence	UBERON:0004023	83.58	gold quality
stromal cell of endometrium	CL:0002255	79.06	gold quality
lung	UBERON:0002048	78.45	gold quality
tonsil	UBERON:0002372	77.11	gold quality
upper lobe of left lung	UBERON:0008952	76.22	gold quality
C1 segment of cervical spinal cord	UBERON:0006469	75.90	gold quality
spinal cord	UBERON:0002240	75.89	gold quality
colonic epithelium	UBERON:0000397	75.36	gold quality
substantia nigra	UBERON:0002038	75.36	gold quality
calcaneal tendon	UBERON:0003701	74.89	gold quality
putamen	UBERON:0001874	73.58	gold quality
amygdala	UBERON:0001876	73.04	gold quality
temporal lobe	UBERON:0001871	72.85	gold quality
Ammon’s horn	UBERON:0001954	72.83	gold quality
esophagus mucosa	UBERON:0002469	72.70	gold quality
adult mammalian kidney	UBERON:0000082	71.42	gold quality
caudate nucleus	UBERON:0001873	71.19	gold quality
kidney	UBERON:0002113	71.07	gold quality
liver	UBERON:0002107	70.80	gold quality
placenta	UBERON:0001987	70.79	gold quality
hypothalamus	UBERON:0001898	69.96	gold quality
primary visual cortex	UBERON:0002436	69.83	gold quality

Single-cell (SCXA)

Detected in 7 experiment(s), a significant marker in 7.

Experiment	Marker?	Max mean expression
E-ANND-2	yes	5984.60
E-GEOD-98556	yes	443.98
E-HCAD-35	yes	88.63
E-HCAD-25	yes	62.95
E-CURD-119	yes	61.17
E-ANND-3	yes	6.84
E-GEOD-130148	yes	5.33

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

135 targeting NCKAP5, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-29A-3P	100.00	73.11	1835
HSA-MIR-29B-3P	100.00	73.18	1833
HSA-MIR-29C-3P	100.00	73.15	1833
HSA-MIR-3613-3P	100.00	76.36	7965
HSA-MIR-3163	100.00	77.23	8605
HSA-MIR-340-5P	100.00	72.50	4437
HSA-MIR-656-3P	100.00	72.15	2788
HSA-MIR-1277-5P	100.00	73.95	5056
HSA-MIR-4668-3P	100.00	68.74	2635
HSA-MIR-4533	100.00	69.48	2758
HSA-MIR-548C-3P	99.99	74.01	7587
HSA-MIR-4789-3P	99.99	70.75	2484
HSA-MIR-4534	99.99	66.58	1907
HSA-MIR-186-5P	99.99	70.83	3707
HSA-MIR-5696	99.98	72.36	4487
HSA-MIR-4775	99.98	75.00	6394
HSA-MIR-25-3P	99.98	74.60	1817
HSA-MIR-32-5P	99.98	75.21	1964
HSA-MIR-363-3P	99.98	74.72	1821
HSA-MIR-367-3P	99.98	74.83	1819
HSA-MIR-92A-3P	99.98	75.21	1960
HSA-MIR-92B-3P	99.98	75.25	1955
HSA-MIR-19A-3P	99.98	75.33	2762
HSA-MIR-19B-3P	99.98	75.44	2754
HSA-MIR-27A-3P	99.98	72.13	2955
HSA-MIR-27B-3P	99.98	72.13	2955
HSA-MIR-9985	99.98	72.11	2939
HSA-MIR-590-3P	99.96	74.34	6478
HSA-MIR-1468-3P	99.96	72.74	3797
HSA-MIR-3658	99.96	73.87	4379

Cross-species orthologs

3 orthologs

Organism	Symbol	Gene ID
mus_musculus	Nckap5	ENSMUSG00000049690
rattus_norvegicus	Nckap5	ENSRNOG00000021553
drosophila_melanogaster	CG42663	FBGN0261545

Paralogs (1): NCKAP5L (ENSG00000167566)

Protein

Protein identifiers

Nck-associated protein 5 — O14513 (reviewed: O14513)

Alternative names: Peripheral clock protein

All UniProt accessions (5): O14513, A0A1W2PNT1, A0A1W2PS86, C9JYL7, H7C187

UniProt curated annotations — full annotation on UniProt →

Subunit / interactions. Interacts with the SH3-containing region of the adapter protein NCK.

Tissue specificity. Expressed in fetal and adult brain, leukocytes and fetal fibroblasts.

Isoforms (4)

UniProt ID	Names	Canonical?
O14513-1	1, Peripheral clock protein 2, ERIH2	yes
O14513-2	2, Peripheral clock protein 1, ERIH1
O14513-3	3
O14513-4	4

RefSeq proteins (2): NP_997246, NP_997364 (=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR026163	Nckap5l	Family
IPR032769	NCKAP5_C	Domain

Pfam: PF15246

UniProt features (41 total): compositionally biased region 15, region of interest 8, sequence variant 7, splice variant 6, sequence conflict 3, chain 1, coiled-coil region 1

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-O14513-F1	43.93	0.09

Function

Pathways and Gene Ontology

Reactome pathways

0 pathways

MSigDB gene sets: 186 (showing top): RORA1_01, TGACCTY_ERR1_Q2, HNF1_Q6, CAGCTG_AP4_Q5, CEBPB_01, CEBP_Q2, GOBP_MICROTUBULE_DEPOLYMERIZATION, RGTTAMWNATT_HNF1_01, NF1_Q6_01, GATA6_01, WTGAAAT_UNKNOWN, TCF11_01, GRE_C, RYTAAWNNNTGAY_UNKNOWN, HP1SITEFACTOR_Q6

GO Biological Process (2): microtubule bundle formation (GO:0001578), microtubule depolymerization (GO:0007019)

GO Molecular Function (1): protein binding (GO:0005515)

GO Cellular Component (1): microtubule plus-end (GO:0035371)

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
microtubule cytoskeleton organization	1
microtubule polymerization or depolymerization	1
protein depolymerization	1
supramolecular fiber organization	1
binding	1
microtubule end	1

Protein interactions and networks

STRING

562 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
NCKAP5	NCK1	P16333	745
NCKAP5	OR2T27	Q8NH04	418
NCKAP5	ALG1L2	C9J202	373
NCKAP5	CYP4F11	Q9HBI6	361
NCKAP5	DCAF5	Q96JK2	359
NCKAP5	ADGB	Q8N7X0	351
NCKAP5	C22orf42	Q6IC83	349
NCKAP5	CACNG3	O60359	323
NCKAP5	SPATA31H1	Q68DN1	316
NCKAP5	NAT9	Q9BTE0	315
NCKAP5	GLIPR1	P48060	312
NCKAP5	CAND2	O75155	300
NCKAP5	ZNF517	Q6ZMY9	290
NCKAP5	ZNF578	Q96N58	290
NCKAP5	NKAIN3	Q8N8D7	288

IntAct

13 interactions, top by confidence:

A	B	Type	Score
NCK1	NCKAP5	psi-mi:“MI:0915”(physical association)	0.560
NCKAP5	Dlg4	psi-mi:“MI:0407”(direct interaction)	0.440
ABL1	NCKAP5	psi-mi:“MI:0915”(physical association)	0.400
NCKAP5	FYN	psi-mi:“MI:0915”(physical association)	0.400
GRB2	NCKAP5	psi-mi:“MI:0915”(physical association)	0.400
NCKAP5	KHDRBS1	psi-mi:“MI:0915”(physical association)	0.400
APBB1	SSPOP	psi-mi:“MI:0914”(association)	0.350
NCKAP5	KIF3C	psi-mi:“MI:0914”(association)	0.350
DISC1	NCKAP5	psi-mi:“MI:0915”(physical association)	0.000
VAV2	NCKAP5	psi-mi:“MI:0915”(physical association)	0.000
NCKAP5	APC	psi-mi:“MI:0915”(physical association)	0.000
NRIP1	NCKAP5	psi-mi:“MI:0915”(physical association)	0.000

BioGRID (35): NCKAP5 (Affinity Capture-RNA), NCKAP5 (Affinity Capture-MS), KHDRBS1 (Proximity Label-MS), NCKAP5 (Proximity Label-MS), CEP350 (Affinity Capture-MS), KNSTRN (Affinity Capture-MS), KIF3C (Affinity Capture-MS), ANKRD26 (Affinity Capture-MS), TRAF3 (Affinity Capture-MS), TRIM37 (Affinity Capture-MS), MAEA (Affinity Capture-MS), KIFAP3 (Affinity Capture-MS), FBXO45 (Affinity Capture-MS), NEURL4 (Affinity Capture-MS), NCK1 (Affinity Capture-MS)

ESM2 similar proteins: A0A087WXM9, A0A2K1JJ00, A0JM83, A4IGL8, E1BC15, E9Q5F9, O14513, O35923, O60673, O88491, P46013, P97929, Q14B71, Q28DZ0, Q29RT4, Q3MHH3, Q3TNU4, Q3ZBP0, Q4QY64, Q4V7J0, Q5DTT3, Q5E9A0, Q5F2C3, Q5RD08, Q5VWN6, Q5VYV7, Q61493, Q69YH5, Q6NS59, Q703I1, Q80U59, Q86XD8, Q8IXS0, Q8IYL3, Q8L7I1, Q8N7Z5, Q8NFU7, Q8TEP8, Q92628, Q96BU1

Diamond homologs: O14513, Q6GQX2, Q9HCH0

SIGNOR signaling

0 interactions.

Enriched among interaction partners

Reactome pathways and GO biological processes over-represented among this gene’s 13 IntAct physical interaction partners (hypergeometric vs the genome-wide background, BH-FDR, gene-set size 15–500, ranked by fold). A functional readout of the neighbourhood — distinct from this gene’s own memberships above, and biased toward well-studied / hub proteins, so read it as themes rather than proof.

Reactome pathways:

Pathway	Partners	Fold	FDR
FCGR3A-mediated phagocytosis	5	93.6×	2e-07

Disease & clinical

Clinical variants and AI predictions

ClinVar

356 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	279
Likely benign	32
Benign	13

Top pathogenic / likely-pathogenic (0)

SpliceAI

4562 predictions. Top by Δscore:

Variant	Effect	Δscore
2:132673303:TTT:T	acceptor_gain	1.0000
2:132673304:TT:T	acceptor_gain	1.0000
2:132673305:TC:T	acceptor_loss	1.0000
2:132673306:C:CC	acceptor_gain	1.0000
2:132673306:CTGCA:C	acceptor_loss	1.0000
2:132673307:T:A	acceptor_loss	1.0000
2:132773892:TACC:T	acceptor_loss	1.0000
2:132773895:C:A	acceptor_loss	1.0000
2:132773895:C:CC	acceptor_gain	1.0000
2:132773896:T:G	acceptor_loss	1.0000
2:132860487:CATA:C	donor_loss	1.0000
2:132860488:ATACC:A	donor_loss	1.0000
2:132860489:TACCT:T	donor_loss	1.0000
2:132860490:ACC:A	donor_loss	1.0000
2:132963714:TCTTA:T	donor_loss	1.0000
2:132963715:CTTAC:C	donor_loss	1.0000
2:132963716:TTACC:T	donor_loss	1.0000
2:132963717:TACCT:T	donor_loss	1.0000
2:132963718:ACC:A	donor_loss	1.0000
2:132963719:C:A	donor_loss	1.0000
2:132963870:C:CC	acceptor_gain	1.0000
2:132999423:T:TA	donor_gain	1.0000
2:133129972:CAATA:C	donor_loss	1.0000
2:133129974:ATAC:A	donor_loss	1.0000
2:133129975:TACCT:T	donor_loss	1.0000
2:133130006:T:C	donor_gain	1.0000
2:133130107:TCATG:T	acceptor_gain	1.0000
2:133130108:CATG:C	acceptor_gain	1.0000
2:133130108:CATGC:C	acceptor_gain	1.0000
2:133130109:ATG:A	acceptor_gain	1.0000

AlphaMissense

12521 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
2:132860607:A:G	L231P	0.999
2:132868949:A:G	L225P	0.999
2:132868953:C:G	A224P	0.998
2:132868970:G:T	A218D	0.998
2:132868971:C:G	A218P	0.998
2:132878855:A:G	L214P	0.998
2:132782372:A:G	I1480T	0.997
2:132860586:A:G	L238S	0.997
2:132868946:A:G	L226P	0.997
2:132868958:A:T	V222D	0.997
2:132868961:A:T	V221D	0.997
2:132732012:C:T	G1723E	0.996
2:132782909:A:G	I1301T	0.996
2:133303076:A:G	L35P	0.996
2:132732005:A:C	F1725L	0.995
2:132732005:A:T	F1725L	0.995
2:132732007:A:G	F1725L	0.995
2:132732020:A:C	S1720R	0.995
2:132732020:A:T	S1720R	0.995
2:132732022:T:G	S1720R	0.995
2:132782372:A:C	I1480S	0.995
2:132782372:A:T	I1480N	0.995
2:132782909:A:C	I1301S	0.995
2:132860565:A:G	L245S	0.995
2:132868964:T:G	Q220P	0.995
2:132878855:A:T	L214H	0.995
2:132963724:A:G	L192P	0.995
2:132732006:A:G	F1725S	0.994
2:132994216:A:G	L122P	0.994
2:132732019:C:A	G1721W	0.993

dbSNP variants (sampled 300 via entrez): RS1000002190 (2:133190097 T>C), RS1000002414 (2:133335190 T>C), RS1000004422 (2:132838402 T>C,G), RS1000011114 (2:132825808 A>G), RS1000011810 (2:132707883 G>C), RS1000013729 (2:133200775 T>C), RS1000015201 (2:133512537 G>A,C), RS1000015209 (2:132887348 T>TATCTATC,TATCTATCC,TATCTATCTATCC,TATCTATCTATCTATCC,TATCTATCTATCTATCTATCC), RS1000015273 (2:133112251 G>A), RS1000018337 (2:133077796 C>A), RS1000025548 (2:133552426 T>G), RS1000030939 (2:133163697 T>C), RS1000032663 (2:133511117 C>T), RS1000034555 (2:133397648 G>A), RS1000035376 (2:133600121 G>T)

Disease associations

OMIM: gene MIM:608789 | disease phenotypes:

GenCC curated gene-disease

Mondo (2): primary ovarian failure (MONDO:0005387), primary amenorrhea (MONDO:1060208)

Orphanet (1): NON RARE IN EUROPE: Primary ovarian failure (Orphanet:619)

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

28 associations (top):

Study	Trait	p-value
GCST000817_1	Height	2.000000e-12
GCST000821_14	Bipolar disorder and schizophrenia	7.000000e-07
GCST001451_1	Glaucoma (primary open-angle)	4.000000e-07
GCST001841_5	Palmitoleic acid (16:1n-7) levels	4.000000e-08
GCST001860_9	Multiple sclerosis	7.000000e-06
GCST001971_2	Hypersomnia (HLA-DQB1*06:02 negative)	1.000000e-07
GCST002775_2	Alzheimer’s disease (survival time)	1.000000e-06
GCST003814_25	Selective IgA deficiency	8.000000e-06
GCST004570_17	Iron status biomarkers (iron levels)	7.000000e-07
GCST005023_16	Initial pursuit acceleration	6.000000e-06
GCST005790_85	Rosacea symptom severity	5.000000e-06
GCST008891_3	Cognitive performance (processing speed)	4.000000e-06
GCST009188_2	Lingual gyrus volume	4.000000e-06
GCST009462_36	Optic disc size	3.000000e-08
GCST010254_2	Diastolic blood pressure x dichotomous lifestyle risk score interaction (2df test)	4.000000e-06
GCST010255_2	Diastolic blood pressure x dichotomous lifestyle risk score interaction (1df test)	7.000000e-07
GCST010274_4	Gout (combined type)	5.000000e-07
GCST010320_96	PR interval	3.000000e-09
GCST010321_194	PR interval	8.000000e-10
GCST010397_26	Gut microbiota (bacterial taxa, rank normal transformation method)	1.000000e-06
GCST010698_72	Subcortical volume (min-P)	5.000000e-14
GCST010699_25	Brain morphology (min-P)	2.000000e-09
GCST010700_51	Cortical thickness (MOSTest)	3.000000e-10
GCST010701_74	Cortical surface area (MOSTest)	4.000000e-09
GCST010702_64	Subcortical volume (MOSTest)	1.000000e-11
GCST010703_142	Brain morphology (MOSTest)	5.000000e-08
GCST011741_68	LDL cholesterol levels in HIV infection	4.000000e-06
GCST011981_4	Homeostasis model assessment of insulin resistance	3.000000e-06

EFO canonical traits (12, from GWAS)

EFO ID	Trait name
EFO:0000714	survival time
EFO:0008434	initial pursuit acceleration
EFO:0009180	rosacea severity measurement
EFO:0004363	information processing speed
EFO:0006336	diastolic blood pressure
EFO:0010724	lifestyle measurement
EFO:0004462	PR interval
EFO:0007874	gut microbiome measurement
EFO:0004346	neuroimaging measurement
EFO:0004840	cortical thickness
EFO:0004611	low density lipoprotein cholesterol measurement
EFO:0004501	HOMA-IR

MeSH disease descriptors (1)

Descriptor	Name	Tree numbers
D016649	Primary Ovarian Insufficiency	C12.050.351.500.056.630.750; C12.100.250.056.630.750; C19.391.630.750

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

36 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Valproic Acid	decreases methylation, increases expression, decreases expression	4
Benzo(a)pyrene	decreases expression, decreases methylation, affects methylation	3
Aflatoxin B1	affects expression, decreases methylation	2
aristolochic acid I	decreases expression	1
urushiol	increases expression	1
methyleugenol	decreases expression	1
pirinixic acid	affects binding, decreases expression, increases activity	1
bisphenol A	affects methylation, affects cotreatment, decreases methylation	1
trichostatin A	increases expression	1
zinc chromate	decreases expression, increases abundance	1
benzo(e)pyrene	increases methylation	1
aflatoxin B2	increases methylation	1
chromium hexavalent ion	decreases expression, increases abundance	1
CGP 52608	affects binding, increases reaction	1
2-palmitoylglycerol	increases expression	1
Sunitinib	decreases expression	1
Zoledronic Acid	increases expression	1
Fulvestrant	affects cotreatment, decreases methylation	1
Acetaminophen	decreases expression	1
Allergens	increases expression	1
Calcitriol	increases expression	1
Doxorubicin	decreases expression	1
Folic Acid	decreases expression	1
Methapyrilene	increases methylation	1
N-Nitrosopyrrolidine	decreases expression	1
Nickel	decreases expression	1
Silicon Dioxide	decreases expression	1
Tetrachlorodibenzodioxin	increases expression	1
Dronabinol	increases expression	1
Tobacco Smoke Pollution	increases expression	1

Clinical trials (associated diseases)

76 trials via MONDO — disease-level, not drug-specific.

Trial	Phase	Status	Title
NCT00417066	PHASE4	COMPLETED	Flexible GnRH Antagonist vs Flare up GnRH Agonist Protocol in Poor Responders
NCT00732693	PHASE4	COMPLETED	Evaluation of Physiologic and Standard Sex Steroid Replacement Regimens in Women With Premature Ovarian Failure
NCT00837616	PHASE4	COMPLETED	Estrogen Dosing in Turner Syndrome: Pharmacology and Metabolism
NCT01853501	PHASE4	UNKNOWN	Effects of ADSC Therapy in Women With POF
NCT02783937	PHASE4	COMPLETED	Filgrastim for Premature Ovarian Insufficiency
NCT03535480	PHASE4	UNKNOWN	Autologous Bone Marrow Stem Cell Ovarian Transplantation to Restore Ovarian Function in Premature Ovarian Failure
NCT00140998	PHASE3	COMPLETED	Estrogen Treatment (Oral vs. Patches) in Turner Syndrome
NCT00001951	PHASE2	COMPLETED	Hormone Replacement in Young Women With Premature Ovarian Failure
NCT00370019	PHASE2	WITHDRAWN	Effects of an Estrogen Replacement Therapy Skin Patch on Ovulation in Women With Premature Ovarian Failure
NCT00429494	PHASE2	COMPLETED	GnRH Analogue for Ovarian Function Preservation in Hematopoietic Stem Cell Transplantation Patients
NCT03816852	PHASE2	SUSPENDED	The Safety and Efficiency Study of Mesenchymal Stem Cell (19#iSCLife®-POI) in Premature Ovarian Insufficiency
NCT04536467	PHASE2	UNKNOWN	Prevention of Chemotherapy-Induced Ovarian Failure With Goserelin in Premenopausal Lymphoma Patients
NCT06117982	PHASE2	COMPLETED	The Impact of Granulocyte Colony Stimulating Factor on Premature Ovarian Insufficiency
NCT02912104	PHASE1	COMPLETED	A Therapeutic Trial of Human Amniotic Epithelial Cells Transplantation for Primary Ovarian Failure
NCT03178695	PHASE1	COMPLETED	Inovium Ovarian Rejuvenation Trials
NCT04815213	PHASE1	ACTIVE_NOT_RECRUITING	The Use of Expandeded Mesenchymal Stromal Cells (MSC) in Premature Ovarian Failure (POF) in Adult Humans
NCT05138367	PHASE1	COMPLETED	Effects of UCA-PSCs in Women With POF
NCT06132542	PHASE1	UNKNOWN	Autologous ADMSC Transplantation in Patients With POI
NCT00948857	PHASE2/PHASE3	TERMINATED	Dehydroepiandrosterone (DHEA) Treatment and Premature Ovarian Failure (POF)
NCT04031456	PHASE2/PHASE3	RECRUITING	Autologous PRP Infusion May Restore Ovarian Function and May Promote Folliculogenesis in POI Patients
NCT02043743	PHASE1/PHASE2	UNKNOWN	Autologous Stem Cells Transplantation in Patients With Idiopathic and Drug Induced Premature Ovarian Failure
NCT02062931	PHASE1/PHASE2	UNKNOWN	Autologous Mesenchymal Stem Cells Transplantation In Women With Premature Ovarian Failure
NCT02151890	PHASE1/PHASE2	COMPLETED	Pregnancy After Stem Cell Transplantation in Premature Ovarian Failure
NCT02372474	PHASE1/PHASE2	COMPLETED	It is a Real The First Baby Of Autologous Stem Cell Therapy in Premature Ovarian Failure
NCT02603744	PHASE1/PHASE2	UNKNOWN	Autologous Adipose Derived Mesenchymal Stromal Cells Transplantation in Women With Premature Ovarian Failure (POF)
NCT02644447	PHASE1/PHASE2	COMPLETED	Transplantation of HUC-MSCs With Injectable Collagen Scaffold for POF
NCT03069209	PHASE1/PHASE2	UNKNOWN	Autologous Bone Marrow-Derived Stem Cell Transplantation in Patients With Premature Ovarian Failure (POF)
NCT03985462	PHASE1/PHASE2	WITHDRAWN	Very Small Embryonic-like Stem Cells for Ovary
NCT04009473	PHASE1/PHASE2	UNKNOWN	Stem Cell Therapy and Growth Factor Ovarian in Vitro Activation
NCT04071574	PHASE1/PHASE2	COMPLETED	Comparative Study on the Efficacy of Ovarian Stimulation Protocols on the Success Rate of ICSI in Female Infertility
NCT04922398	PHASE1/PHASE2	UNKNOWN	Ovarian Injection of PRP (Platelet -Rich Plasma) Vs Normal Saline in Premature Ovarian Insufficiency
NCT05462379	PHASE1/PHASE2	ACTIVE_NOT_RECRUITING	Autologous Heterotopic Fresh Ovarian Graft in Woman With LACC Eligible for Pelvic Radiotherapy Treatment.
NCT06202547	PHASE1/PHASE2	UNKNOWN	Intra-ovarian Injection of MSC-EVs in Idiopathic Premature Ovarian Failure
NCT01129947	EARLY_PHASE1	WITHDRAWN	The Use of DHEA in Women With Premature Ovarian Failure
NCT05522634	EARLY_PHASE1	UNKNOWN	A Clinical Study of Chinese Herbal Compound TJAOA101 in the Treatment of Premature Ovarian Insufficiency
NCT07308327	EARLY_PHASE1	ACTIVE_NOT_RECRUITING	The Influence of Gut Microbiota on Ovarian Function: A Single-center, Randomized,Double Blind, Parallel-controlled, Exploratory Clinical Trial
NCT00001275	Not specified	COMPLETED	Ovarian Follicle Function in Patients With Primary Ovarian Failure
NCT00001306	Not specified	COMPLETED	Steroid Therapy in Autoimmune Premature Ovarian Failure
NCT00006156	Not specified	COMPLETED	Feasibility Study for Development of an Early Test for Ovarian Failure
NCT00119925	Not specified	UNKNOWN	‘SPRING’-Study: Subfertility Guidelines: Patient Related Implementation in the Netherlands Among Gynaecologists