NKD2

Summary

NKD2 (NKD inhibitor of Wnt signaling pathway 2, HGNC:17046) is a protein-coding gene on chromosome 5p15.33, encoding Protein naked cuticle homolog 2 (Q969F2). Cell autonomous antagonist of the canonical Wnt signaling pathway.

This gene encodes a member of a family of proteins that function as negative regulators of Wnt receptor signaling through interaction with Dishevelled family members. The encoded protein participates in the delivery of transforming growth factor alpha-containing vesicles to the cell membrane. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene.

Source: NCBI Gene 85409 — RefSeq curated summary.

At a glance

• GWAS associations: 11
• Clinical variants (ClinVar): 132 total — 2 pathogenic
• MANE Select transcript: NM_033120

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:17046
Approved symbol	NKD2
Name	NKD inhibitor of Wnt signaling pathway 2
Location	5p15.33
Locus type	gene with protein product
Status	Approved
Aliases	Naked2
Ensembl gene	ENSG00000145506
Ensembl biotype	protein_coding
OMIM	607852
Entrez	85409

Gene structure

Transcript identifiers

Ensembl transcripts: 13 — 10 protein_coding, 3 retained_intron

ENST00000274150, ENST00000296849, ENST00000513296, ENST00000519933, ENST00000523688, ENST00000866687, ENST00000866688, ENST00000866689, ENST00000866690, ENST00000866691, ENST00000866692, ENST00000866693, ENST00000963996

RefSeq mRNA: 2 — MANE Select: NM_033120 NM_001271082, NM_033120

CCDS: CCDS3859, CCDS59486

Canonical transcript exons

ENST00000296849 — 10 exons

Exon	Start	End
ENSE00000970802	1032152	1032212
ENSE00000970805	1033372	1033499
ENSE00000970807	1034235	1034330
ENSE00001010728	1009481	1009560
ENSE00001213812	1037805	1038943
ENSE00001322803	1009179	1009214
ENSE00001426375	1008802	1009082
ENSE00003626421	1035389	1035473
ENSE00003636222	1036257	1036384
ENSE00003680154	1034756	1034903

Expression profiles

Bgee: expression breadth ubiquitous, 130 present calls, max score 95.65.

FANTOM5 (CAGE): breadth broad, TPM avg 2.6299 / max 253.9987, expressed in 722 samples.

FANTOM5 promoters (2 alternative TSS)

Promoter ID	TPM avg	Samples expressed
55519	2.6009	721
55518	0.0290	9

Top tissues by expression

135 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
upper lobe of left lung	UBERON:0008952	95.65	gold quality
right lung	UBERON:0002167	91.11	gold quality
lung	UBERON:0002048	90.52	gold quality
spleen	UBERON:0002106	87.72	gold quality
lower esophagus mucosa	UBERON:0035834	86.72	gold quality
metanephros cortex	UBERON:0010533	86.05	gold quality
skin of abdomen	UBERON:0001416	83.35	gold quality
esophagus mucosa	UBERON:0002469	82.75	gold quality
zone of skin	UBERON:0000014	82.74	gold quality
skin of leg	UBERON:0001511	82.36	gold quality
left adrenal gland cortex	UBERON:0035825	82.06	gold quality
right testis	UBERON:0004534	81.91	gold quality
left testis	UBERON:0004533	81.22	gold quality
left adrenal gland	UBERON:0001234	81.13	gold quality
testis	UBERON:0000473	80.82	gold quality
right adrenal gland	UBERON:0001233	79.58	gold quality
esophagus	UBERON:0001043	79.40	gold quality
placenta	UBERON:0001987	79.26	gold quality
cortex of kidney	UBERON:0001225	79.17	gold quality
prostate gland	UBERON:0002367	78.75	gold quality
right adrenal gland cortex	UBERON:0035827	78.75	gold quality
male germ line stem cell (sensu Vertebrata) in testis	CL:0000089 ∩ UBERON:0000473	78.54	silver quality
primordial germ cell in gonad	CL:0000670 ∩ UBERON:0000991	78.26	gold quality
heart left ventricle	UBERON:0002084	77.95	gold quality
adrenal gland	UBERON:0002369	77.75	gold quality
mucosa of transverse colon	UBERON:0004991	77.33	gold quality
muscle layer of sigmoid colon	UBERON:0035805	77.14	gold quality
right frontal lobe	UBERON:0002810	76.83	gold quality
right atrium auricular region	UBERON:0006631	76.78	gold quality
apex of heart	UBERON:0002098	76.59	gold quality

Single-cell (SCXA)

Detected in 1 experiment(s), a significant marker in 0.

Experiment	Marker?	Max mean expression
E-ANND-3	no	2.17

Regulation

Is transcription factor: no

Upstream regulators (CollecTRI, top): HOXC8

miRNA regulators (miRDB)

5 targeting NKD2, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-4447	99.85	67.81	2900
HSA-MIR-657	99.48	66.02	848
HSA-MIR-329-5P	99.27	68.11	1597
HSA-MIR-6090	91.01	62.65	222
HSA-MIR-6774-3P	89.14	65.20	68

Literature-anchored findings (GeneRIF, showing 17)

• NKD2 represents a candidate target of 5p amplifications in soft tissue sarcomas and might play a crucial role during the progression of this disease. (PMID:16752383)
• Naked2 acts as a cargo recognition and targeting (CaRT) protein to ensure proper delivery, tethering, and fusion of TGF-alpha-containing vesicles to a distinct region at the basolateral surface of polarized epithelial cells. (PMID:17553928)
• identify an EGFR-independent action of TGF-alpha, in which it protects Naked2 from proteasomal degradation, thus ensuring its delivery to the basolateral surface of polarized epithelial cells (PMID:18757723)
• NKD2 antagonizes Wnt signaling: myristoylated NKD2 interacts with Dvl-1 at the plasma membrane, and this interaction leads to their mutual ubiquitin-mediated proteasomal degradation. (PMID:20177058)
• NKD2 is frequently methylated in human breast cancer, and the expression of NKD2 is regulated by promoter region methylation. (PMID:26124080)
• NKD2 methylation is associated with cell differentiation, TNM stage and distant metastasis significantly (all P < 0.05), and the overall survival time is longer in NKD2 unmethylated group compared to NKD2 methylated group (P < 0.05). (PMID:26396173)
• NKD2 regulates osteosarcoma cell proliferation and apoptosis by inhibiting the Wnt signaling.MiR-130b targets NKD2 and regulates the Wnt signaling to promote proliferation and inhibit apoptosis of osteosarcoma cells. (PMID:26902120)
• curcumin significantly inhibited the proliferation of colorectal cancer cells and upregulated the expression of NKD2 in SW620 colorectal cancer cells. (PMID:26985708)
• ZFAS1 over-expression confers an oncogenic function in gastric cancer and this function is partly dependent on repressing KLF2 and NKD2 (PMID:27246976)
• NKD2 is frequently methylated in human esophageal cancer, and the expression of NKD2 is regulated by promoter region methylation. NKD2 suppresses esophageal cancer progression by inhibiting Wnt signaling both in vitro and in vivo. (PMID:27374455)
• NKD2 is the key molecular marker to study the progression of osteosarcoma development, and it may be used for better prognosis of the disease in early stage (PMID:27424978)
• Reduced expression of NKD2 correlated with hyperactivation of the Wnt/beta-catenin pathway and doxorubicin resistance in hepatocellular carcinoma cells (PMID:29126834)
• The experiments in vitro suggested that knockdown of ZFAS1 repressed bladder cancer cell proliferation via up-regulating KLF2 and NKD2 expression, and inhibited cell migration and invasion via down-regulating ZEB1 and ZEB2 expression. (PMID:29678899)
• NKD2 phosphorylation by PKA promotes cell-surface delivery of TGFalpha and increased EGFR activation. (PMID:30941853)
• LINC00922 regulates epithelial-mesenchymal transition, invasive and migratory capacities in breast cancer through promoting NKD2 methylation. (PMID:33045317)
• NKD2 mediates stimulation-dependent ORAI1 trafficking to augment Ca(2+) entry in T cells. (PMID:34433025)
• NKD2 Trigger NF-kappaB Signaling Pathway and Facilitates Thyroid Cancer Cell Proliferation. (PMID:36820951)

Cross-species orthologs

6 orthologs

Organism	Symbol	Gene ID
danio_rerio	nkd3	ENSDARG00000013174
danio_rerio	nkd2a	ENSDARG00000055271
mus_musculus	Nkd2	ENSMUSG00000021567
rattus_norvegicus	Nkd2	ENSRNOG00000016103
drosophila_melanogaster	nkd	FBGN0002945
drosophila_melanogaster	PIP82	FBGN0024943

Paralogs (1): NKD1 (ENSG00000140807)

Protein

Protein identifiers

Protein naked cuticle homolog 2 — Q969F2 (reviewed: Q969F2)

All UniProt accessions (1): Q969F2

UniProt curated annotations — full annotation on UniProt →

Function. Cell autonomous antagonist of the canonical Wnt signaling pathway. May activate a second Wnt signaling pathway that controls planar cell polarity. Required for processing of TGFA and for targeting of TGFA to the basolateral membrane of polarized epithelial cells.

Subunit / interactions. Interacts with DVL1, DVL2, DVL3 and PPP2R3A. Interacts with RNF25 and TGFA (via cytoplasmic domain).

Subcellular location. Cell membrane. Cytoplasm. Cytoplasmic vesicle.

Tissue specificity. Expressed in kidney, lung, pancreas and spleen.

Post-translational modifications. Ubiquitinated, leading to rapid proteasomal degradation. Interaction with TGFA interferes with RNF25 binding and protects against ubiquitination mediated by RNF25.

Domain organisation. The N-terminal domain comprising the first 217 amino acid residues is mostly unstructured.

Similarity. Belongs to the NKD family.

Isoforms (2)

UniProt ID	Names	Canonical?
Q969F2-1	1	yes
Q969F2-2	2

RefSeq proteins (2): NP_001258011, NP_149111* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR002048	EF_hand_dom	Domain
IPR011992	EF-hand-dom_pair	Homologous_superfamily
IPR040140	Nkd-like	Family

UniProt features (22 total): region of interest 6, compositionally biased region 4, binding site 4, splice variant 2, initiator methionine 1, chain 1, lipid moiety-binding region 1, domain 1, sequence variant 1, mutagenesis site 1

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q969F2-F1	56.15	0.03

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Ligand- & substrate-binding residues (4): 132; 134; 138; 143

Post-translational modifications (1): 2

Mutagenesis-validated functional residues (1):

Position	Phenotype
2	abrogates myristoylation and membrane association and impairs delivery of tgfa to the cell surface.

Function

Pathways and Gene Ontology

Reactome pathways

1 pathways

ID	Pathway
R-HSA-9943962	CHD6, CHD7, CHD8, CHD9 subfamily

MSigDB gene sets: 148 (showing top): GOBP_POSITIVE_REGULATION_OF_PROTEIN_MATURATION, GOBP_REGULATION_OF_PROTEASOMAL_UBIQUITIN_DEPENDENT_PROTEIN_CATABOLIC_PROCESS, GOBP_VESICLE_ORGANIZATION, MODULE_418, GOBP_MEMBRANE_FUSION, GRAESSMANN_APOPTOSIS_BY_DOXORUBICIN_DN, GRAESSMANN_RESPONSE_TO_MC_AND_DOXORUBICIN_DN, GOBP_POSITIVE_REGULATION_OF_PROTEIN_LOCALIZATION, GOBP_POSITIVE_REGULATION_OF_PROTEIN_CATABOLIC_PROCESS, GOBP_MACROMOLECULE_CATABOLIC_PROCESS, GOBP_VESICLE_MEDIATED_TRANSPORT, GOBP_REGULATION_OF_WNT_SIGNALING_PATHWAY, GOBP_PROTEIN_LOCALIZATION_TO_CELL_PERIPHERY, GOBP_POSITIVE_REGULATION_OF_PROTEIN_LOCALIZATION_TO_CELL_PERIPHERY, MARTINEZ_RB1_TARGETS_UP

GO Biological Process (9): exocytosis (GO:0006887), positive regulation of protein processing (GO:0010954), Wnt signaling pathway (GO:0016055), negative regulation of Wnt signaling pathway (GO:0030178), positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436), Golgi vesicle fusion to target membrane (GO:0048210), protein localization to plasma membrane (GO:0072659), negative regulation of canonical Wnt signaling pathway (GO:0090090), positive regulation of protein localization to plasma membrane (GO:1903078)

GO Molecular Function (8): calcium ion binding (GO:0005509), growth factor binding (GO:0019838), ubiquitin protein ligase binding (GO:0031625), myosin heavy chain binding (GO:0032036), ATPase binding (GO:0051117), molecular adaptor activity (GO:0060090), protein binding (GO:0005515), metal ion binding (GO:0046872)

GO Cellular Component (8): cytoplasm (GO:0005737), plasma membrane (GO:0005886), basolateral plasma membrane (GO:0016323), lateral plasma membrane (GO:0016328), cytoplasmic vesicle (GO:0031410), exocytic vesicle (GO:0070382), cell periphery (GO:0071944), membrane (GO:0016020)

Reactome top-level categories

Rollup of top-1 pathways:

Category	Pathways
CHD chromatin remodelers	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
cellular anatomical structure	4
binding	2
vesicle-mediated transport	1
secretion by cell	1
vesicle fusion to plasma membrane	1
protein processing	1
positive regulation of proteolysis	1
regulation of protein processing	1
positive regulation of protein maturation	1
cell surface receptor signaling pathway	1
negative regulation of signal transduction	1
Wnt signaling pathway	1
regulation of Wnt signaling pathway	1
regulation of proteasomal ubiquitin-dependent protein catabolic process	1
proteasome-mediated ubiquitin-dependent protein catabolic process	1
positive regulation of proteasomal protein catabolic process	1
positive regulation of ubiquitin-dependent protein catabolic process	1
vesicle fusion	1
Golgi vesicle transport	1
protein localization to membrane	1
protein localization to cell periphery	1
negative regulation of Wnt signaling pathway	1
canonical Wnt signaling pathway	1
regulation of canonical Wnt signaling pathway	1
protein localization to plasma membrane	1
regulation of protein localization to plasma membrane	1
positive regulation of protein localization to cell periphery	1
positive regulation of protein localization to membrane	1
metal ion binding	1
protein binding	1
ubiquitin-like protein ligase binding	1
myosin binding	1
enzyme binding	1
molecular_function	1
cation binding	1
intracellular anatomical structure	1
membrane	1
cell periphery	1
basal plasma membrane	1
plasma membrane region	1

Protein interactions and networks

STRING

656 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
NKD2	DVL1	O14640	929
NKD2	CTNNB1	P35222	651
NKD2	WNT1	P04628	633
NKD2	TGFA	P01135	578
NKD2	PPP2R3A	Q06190	562
NKD2	DAAM1	Q9Y4D1	532
NKD2	AXIN2	Q9Y2T1	531
NKD2	HNF4A	P41235	510
NKD2	AXIN1	O15169	472
NKD2	RNF25	Q96BH1	464
NKD2	KPNA4	O00629	452
NKD2	ENO4	A6NNW6	436
NKD2	DVL3	Q92997	434
NKD2	APCDD1	Q8J025	412
NKD2	DVL2	O14641	409
NKD2	SFRP1	Q8N474	409

IntAct

32 interactions, top by confidence:

A	B	Type	Score
YWHAG	BLTP3B	psi-mi:“MI:2364”(proximity)	0.640
NKD2	TGFA	psi-mi:“MI:0915”(physical association)	0.570
TGFA	NKD2	psi-mi:“MI:0915”(physical association)	0.570
NKD2		psi-mi:“MI:0915”(physical association)	0.540
NKD2		psi-mi:“MI:0195”(covalent binding)	0.540
YWHAZ	BLTP3B	psi-mi:“MI:0914”(association)	0.530
NKD2	RNF25	psi-mi:“MI:0915”(physical association)	0.520
RCHY1	NKD2	psi-mi:“MI:0915”(physical association)	0.510
NKD2	DVL1	psi-mi:“MI:0915”(physical association)	0.400
NKD2	FXR1	psi-mi:“MI:0915”(physical association)	0.370
NKD2	FXR2	psi-mi:“MI:0915”(physical association)	0.370
NKD2	TSC1	psi-mi:“MI:0915”(physical association)	0.370
FUS	NKD2	psi-mi:“MI:0915”(physical association)	0.370
NKD2	CDKN1A	psi-mi:“MI:0915”(physical association)	0.370
GRB2	NKD2	psi-mi:“MI:0915”(physical association)	0.370
NKD2	VDR	psi-mi:“MI:0915”(physical association)	0.370
ANAPC11	NKD2	psi-mi:“MI:0915”(physical association)	0.370
WWOX	NKD2	psi-mi:“MI:0915”(physical association)	0.370
YWHAE	DEPDC5	psi-mi:“MI:0914”(association)	0.350
TNFRSF1B	MAP3K7	psi-mi:“MI:0914”(association)	0.350
NKD2	YWHAQ	psi-mi:“MI:0914”(association)	0.350
SLC37A1	ESYT2	psi-mi:“MI:0914”(association)	0.350
YWHAB	E2F8	psi-mi:“MI:2364”(proximity)	0.270
YWHAE	E2F8	psi-mi:“MI:2364”(proximity)	0.270
YWHAH	E2F8	psi-mi:“MI:2364”(proximity)	0.270
YWHAG	E2F8	psi-mi:“MI:2364”(proximity)	0.270

BioGRID (57): YWHAE (Affinity Capture-MS), YWHAZ (Affinity Capture-MS), C6orf211 (Affinity Capture-MS), PLS1 (Affinity Capture-MS), UBE2D2 (Affinity Capture-MS), UBE2E3 (Affinity Capture-MS), YWHAZ (Affinity Capture-MS), UBE2D2 (Affinity Capture-MS), YWHAG (Affinity Capture-MS), YWHAE (Affinity Capture-MS), YWHAB (Affinity Capture-MS), C6orf211 (Affinity Capture-MS), PLS1 (Affinity Capture-MS), PMVK (Affinity Capture-MS), NKD2 (Biochemical Activity)

ESM2 similar proteins: A4D2P6, A5PJV8, A6NFD8, D4AE48, O00268, O00287, O35274, O35779, O43566, P04198, P12755, P55199, Q08DA0, Q0D2I5, Q2KJ58, Q504T8, Q5XKK7, Q60698, Q61976, Q6NZ67, Q6P582, Q6R891, Q6T4P5, Q7Z6J2, Q80YR4, Q86UD0, Q86UK7, Q8BXL9, Q8CEG5, Q8R4T5, Q8TF61, Q8VCG9, Q969F2, Q969G9, Q96HZ4, Q96SB3, Q99PV5, Q9BQ61, Q9BUN5, Q9BZE9

Diamond homologs: A4ZNR4, A4ZNR5, Q08AA9, Q16HE8, Q29DJ1, Q2TJA6, Q8VE28, Q969F2, Q969G9, Q99MH6, Q9VVV9, P42325, Q16982, Q75K28, P62760, P62761, P62762, P62763, P62764, Q4R5F7, Q5RD22

SIGNOR signaling

3 interactions.

A	Effect	B	Mechanism
RNF25	“down-regulates quantity by destabilization”	NKD2	polyubiquitination
TGFA	“up-regulates quantity by stabilization”	NKD2	binding
PKA	“up-regulates quantity by stabilization”	NKD2	phosphorylation

Enriched among interaction partners

Reactome pathways and GO biological processes over-represented among this gene’s 27 IntAct physical interaction partners (hypergeometric vs the genome-wide background, BH-FDR, gene-set size 15–500, ranked by fold). A functional readout of the neighbourhood — distinct from this gene’s own memberships above, and biased toward well-studied / hub proteins, so read it as themes rather than proof.

Reactome pathways:

Pathway	Partners	Fold	FDR
Activation of BAD and translocation to mitochondria	6	182.7×	5e-11
Chk1/Chk2(Cds1) mediated inactivation of Cyclin B:Cdk1 complex	6	161.2×	7e-11
SARS-CoV-1 targets host intracellular signalling and regulatory pathways	6	161.2×	7e-11
Activation of BH3-only proteins	6	119.2×	4e-10
RHO GTPases activate PKNs	6	76.1×	7e-09
Intrinsic Pathway for Apoptosis	6	70.3×	9e-09
FOXO-mediated transcription	5	67.2×	2e-07
SARS-CoV-1-host interactions	6	42.2×	2e-07

GO biological processes:

GO term	Partners	Fold	FDR
protein targeting	5	70.5×	3e-06
intracellular protein localization	6	24.1×	2e-05

Disease & clinical

Clinical variants and AI predictions

ClinVar

132 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	2
Likely pathogenic	0
Uncertain significance	101
Likely benign	14
Benign	3

Top pathogenic / likely-pathogenic (2)

Variant ID	HGVS	Classification
394581	GRCh37/hg19 5p15.33(chr5:22149-4163847)x1	Pathogenic
831255	NC_000005.10:g.(?218346)(1295046_?)del	Pathogenic

SpliceAI

2093 predictions. Top by Δscore:

Variant	Effect	Δscore
5:1009443:C:CA	acceptor_gain	1.0000
5:1009448:C:CA	acceptor_gain	1.0000
5:1009449:G:A	acceptor_gain	1.0000
5:1032211:GG:G	donor_gain	1.0000
5:1032212:GG:G	donor_gain	1.0000
5:1033500:G:GG	donor_gain	1.0000
5:1034326:GGGAG:G	donor_gain	1.0000
5:1034327:GGAGG:G	donor_gain	1.0000
5:1034331:G:T	donor_loss	1.0000
5:1034902:GG:G	donor_gain	1.0000
5:1034903:GG:G	donor_gain	1.0000
5:1036385:G:GG	donor_gain	1.0000
5:1036386:T:G	donor_loss	1.0000
5:1009078:GCACG:G	donor_gain	0.9900
5:1009081:CGG:C	donor_loss	0.9900
5:1009082:GGTGA:G	donor_loss	0.9900
5:1009084:TGAGC:T	donor_loss	0.9900
5:1009159:C:CA	acceptor_gain	0.9900
5:1009161:C:CA	acceptor_gain	0.9900
5:1009444:G:A	acceptor_gain	0.9900
5:1009557:GCAG:G	donor_gain	0.9900
5:1009561:GT:G	donor_loss	0.9900
5:1009562:T:G	donor_loss	0.9900
5:1032210:AGGGT:A	donor_loss	0.9900
5:1032213:G:GG	donor_gain	0.9900
5:1032214:T:TC	donor_loss	0.9900
5:1032215:GA:G	donor_loss	0.9900
5:1032216:AGTG:A	donor_loss	0.9900
5:1032900:G:GT	donor_gain	0.9900
5:1033497:GAC:G	donor_gain	0.9900

AlphaMissense

2950 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
5:1034287:T:C	F128S	0.998
5:1034286:T:C	F128L	0.997
5:1034288:C:A	F128L	0.997
5:1034288:C:G	F128L	0.997
5:1034847:T:C	L173P	0.997
5:1036329:A:C	R244S	0.997
5:1036329:A:T	R244S	0.997
5:1036340:T:C	L248P	0.997
5:1036346:T:C	L250P	0.997
5:1034280:T:A	W126R	0.996
5:1034280:T:C	W126R	0.996
5:1036328:G:C	R244T	0.996
5:1034853:T:A	V175D	0.995
5:1036324:C:A	R243S	0.995
5:1034282:G:C	W126C	0.994
5:1034282:G:T	W126C	0.994
5:1034769:T:C	L147P	0.994
5:1034781:T:A	I151N	0.994
5:1034847:T:A	L173Q	0.994
5:1036328:G:T	R244I	0.994
5:1034769:T:A	L147H	0.993
5:1036336:T:C	Y247H	0.993
5:1036349:C:A	A251D	0.993
5:1036325:G:C	R243P	0.992
5:1036351:G:T	G252W	0.992
5:1034293:T:C	L130P	0.991
5:1036336:T:G	Y247D	0.991
5:1036352:G:A	G252E	0.991
5:1036375:T:C	F260L	0.991
5:1036377:C:A	F260L	0.991

dbSNP variants (sampled 300 via entrez): RS1000112320 (5:1029590 G>A,C,T), RS1000168849 (5:1039438 G>A,C,T), RS1000184663 (5:1028647 G>A), RS1000202239 (5:1008457 G>A,C), RS1000252795 (5:1010022 G>T), RS1000362582 (5:1035920 GGTGGCTGGGTGGCTGGGGT>G), RS1000401555 (5:1013509 C>T), RS1000467057 (5:1017856 C>T), RS1000552595 (5:1029396 A>G), RS1000596820 (5:1009197 G>A,C), RS1000644386 (5:1010255 T>C), RS1000862290 (5:1019451 C>T), RS1000988176 (5:1033187 C>G,T), RS1001027226 (5:1037279 G>C), RS1001036840 (5:1035283 TTAA>T)

Disease associations

OMIM: gene MIM:607852 | disease phenotypes: MIM:613989, MIM:178500

GenCC curated gene-disease

Mondo (3): dyskeratosis congenita, autosomal dominant 2 (MONDO:0013521), idiopathic pulmonary fibrosis (MONDO:0800504), interstitial lung disease 2 (MONDO:0800497)

Orphanet (2): Idiopathic pulmonary fibrosis (Orphanet:2032), Acute interstitial pneumonia (Orphanet:79126)

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

11 associations (top):

Study	Trait	p-value
GCST002500_41	QT interval	8.000000e-06
GCST002553_8	Pancreatic cancer	1.000000e-13
GCST004621_150	Red cell distribution width	5.000000e-09
GCST004744_73	Lung adenocarcinoma	1.000000e-07
GCST004748_44	Lung cancer	8.000000e-07
GCST004749_102	Lung cancer in ever smokers	1.000000e-07
GCST006804_120	Red cell distribution width	7.000000e-16
GCST006804_124	Red cell distribution width	2.000000e-15
GCST90002391_25	Mean corpuscular hemoglobin concentration	1.000000e-10
GCST90002404_90	Red cell distribution width	1.000000e-32
GCST90002404_91	Red cell distribution width	8.000000e-13

EFO canonical traits (3, from GWAS)

EFO ID	Trait name
EFO:0004682	QT interval
EFO:0009188	Red cell distribution width
EFO:0004528	mean corpuscular hemoglobin concentration

MeSH disease descriptors (1)

Descriptor	Name	Tree numbers
D054990	Idiopathic Pulmonary Fibrosis	C08.381.483.652.500

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

50 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Tetrachlorodibenzodioxin	increases expression	5
Benzo(a)pyrene	increases expression, increases methylation	4
Silicon Dioxide	increases expression, decreases expression	3
Valproic Acid	affects expression, increases expression	3
Arsenic	affects methylation, affects cotreatment, increases abundance, increases expression	2
Cisplatin	affects expression, affects cotreatment, increases expression	2
Smoke	increases expression	2
Aflatoxin B1	increases expression	2
Particulate Matter	increases abundance, increases expression	2
aristolochic acid I	increases expression	1
FR900359	decreases phosphorylation	1
methyleugenol	increases expression	1
propionaldehyde	increases expression	1
beta-lapachone	decreases expression, increases expression	1
shikonin	decreases expression	1
tris(1,3-dichloro-2-propyl)phosphate	increases expression	1
2-amino-9H-pyrido(2,3-b)indole	increases expression	1
sodium arsenite	affects cotreatment, increases abundance, increases expression	1
butyraldehyde	increases expression	1
manganese chloride	increases abundance, increases expression, affects cotreatment	1
pentanal	increases expression	1
entinostat	increases expression	1
abrine	increases expression	1
jinfukang	increases expression, affects cotreatment	1
Temozolomide	affects response to substance	1
Decitabine	affects expression	1
Sunitinib	increases expression	1
Arsenic Trioxide	increases expression	1
Leflunomide	increases expression	1
Acetaminophen	increases expression	1

Cellosaurus cell lines

1 cell lines: 1 cancer cell line

First 10 cell lines (id-ordered, not curated):

Cellosaurus	Name	Category	Sex
CVCL_D8RD	Ubigene HCT 116 NKD2 KO	Cancer cell line	Male

Clinical trials (associated diseases)

300 trials via MONDO — disease-level, not drug-specific.

Trial	Phase	Status	Title
NCT00625079	PHASE4	WITHDRAWN	Pulmonary Hypertension Secondary to Idiopathic Pulmonary Fibrosis And Treatment With Sildenafil
NCT00625469	PHASE4	WITHDRAWN	Pulmonary Arterial Hypertension Secondary to Idiopathic Pulmonary Fibrosis and Treatment With Bosentan
NCT00637065	PHASE4	UNKNOWN	Bosentan in Pulmonary Hypertension in Interstitial Lung Disease Treatment Study
NCT01321996	PHASE4	TERMINATED	68Ga-DOTA-NOC PET/CT in Patients With Idiopathic Pulmonary Fibrosis
NCT01382368	PHASE4	UNKNOWN	Acute Effect of Sildenafil on Exercise Tolerance and Functional Capacity in COPD, IPF and Post Pneumonectomy Patients
NCT02579603	PHASE4	COMPLETED	Safety, Tolerability and PK of Nintedanib in Combination With Pirfenidone in IPF
NCT02598193	PHASE4	COMPLETED	Safety and Tolerability Study of Pirfenidone in Combination With Nintedanib in Participants With Idiopathic Pulmonary Fibrosis (IPF)
NCT02606877	PHASE4	COMPLETED	A Study to Compare the Amount of Nintedanib and Pirfenidone in the Blood When Nintedanib and Pirfenidone Are Given Separately or in Combination
NCT02788474	PHASE4	COMPLETED	Effect of Nintedanib on Biomarkers of Extracellular Matrix Turnover in Patients With Idiopathic Pulmonary Fibrosis and Limited Forced Vital Capacity Impairment
NCT03503188	PHASE4	COMPLETED	Digital Auscultation Test - IPF Data Collection
NCT03717012	PHASE4	TERMINATED	Study of Pulmonary Rehabilitation in Patients With Idiopathic Pulmonary Fibrosis (IPF)
NCT03939520	PHASE4	COMPLETED	Management of Progressive Disease in Idiopathic Pulmonary Fibrosis
NCT00047645	PHASE3	COMPLETED	A Study of the Safety and Efficacy Interferon-Gamma 1b in Patients With Idiopathic Pulmonary Fibrosis (IPF)
NCT00075998	PHASE3	TERMINATED	The INSPIRE Trial: A Study of Interferon Gamma-1b for Idiopathic Pulmonary Fibrosis (IPF)
NCT00076635	PHASE3	TERMINATED	An Open-Label Study of the Safety of Interferon Gamma-1b in Patients With IPF
NCT00105183	PHASE3	COMPLETED	EZ-2053 in the Prophylaxis of Acute Pulmonary Allograft Rejection
NCT00203697	PHASE3	UNKNOWN	Minocycline Therapy for Lung Scarring in Patients With Idiopathic Pulmonary Fibrosis - a Pilot Study
NCT00287716	PHASE3	COMPLETED	Three-Arm Study of the Safety and Efficacy of Pirfenidone in Patients With Idiopathic Pulmonary Fibrosis
NCT00287729	PHASE3	COMPLETED	Safety and Efficacy of Pirfenidone in Patients With Idiopathic Pulmonary Fibrosis
NCT00391443	PHASE3	COMPLETED	BUILD 3: Bosentan Use in Interstitial Lung Disease
NCT00600028	PHASE3	COMPLETED	Treatment of Chronic Cough in Idiopathic Pulmonary Fibrosis With Thalidomide
NCT00631475	PHASE3	COMPLETED	Open Label Extension Study in Patients With Idiopathic Pulmonary Fibrosis Who Completed Protocol AC-052-321/ BUILD 3 / NCT00391443
NCT00662038	PHASE3	COMPLETED	Open-Label Study of the Long Term Safety of Pirfenidone in Patients With Idiopathic Pulmonary Fibrosis (IPF)
NCT00768300	PHASE3	TERMINATED	(ARTEMIS-IPF) Randomized, Placebo-Controlled Study to Evaluate Safety and Effectiveness of Ambrisentan in IPF
NCT00879229	PHASE3	TERMINATED	ARTEMIS-PH - Study of Ambrisentan in Subjects With Pulmonary Hypertension Associated With Idiopathic Pulmonary Fibrosis
NCT00957242	PHASE3	TERMINATED	AntiCoagulant Effectiveness in Idiopathic Pulmonary Fibrosis
NCT01366209	PHASE3	COMPLETED	Efficacy and Safety of Pirfenidone in Patients With Idiopathic Pulmonary Fibrosis (IPF)
NCT01619085	PHASE3	COMPLETED	Extension Trial of the Long Term Safety of BIBF 1120 in Patients With Idiopathic Pulmonary Fibrosis
NCT01777737	PHASE3	TERMINATED	Study to Test the Validity of the Treatment of Idiopathic Pulmonary Fibrosis With Cotrimoxazole
NCT01979952	PHASE3	COMPLETED	Nintedanib Twice Daily vs Placebo in Patients Diagnosed With Idiopathic Pulmonary Fibrosis (IPF)
NCT02460588	PHASE3	COMPLETED	Cyclophosphamide for Acute Exacerbation of Idiopathic Pulmonary Fibrosis
NCT02739165	PHASE3	COMPLETED	Clinical Study of ART-123 for the Treatment of Acute Exacerbation of Idiopathic Pulmonary Fibrosis
NCT02759120	PHASE3	TERMINATED	CleanUP IPF for the Pulmonary Trials Cooperative
NCT02802345	PHASE3	COMPLETED	Efficacy and Safety of Nintedanib Co-administered With Sildenafil in Idiopathic Pulmonary Fibrosis Patients With Advanced Lung Function Impairment
NCT03208933	PHASE3	COMPLETED	Open-label Study to Assess the Effectiveness of Pirfenidone in Participants With Idiopathic Pulmonary Fibrosis (IPF).
NCT03711162	PHASE3	TERMINATED	A Clinical Study to Test How Effective and Safe GLPG1690 is for Subjects With Idiopathic Pulmonary Fibrosis (IPF) When Used Together With Standard of Care
NCT03733444	PHASE3	TERMINATED	A Clinical Study to Test How Effective and Safe GLPG1690 is for Participants With Idiopathic Pulmonary Fibrosis (IPF) When Used Together With Standard of Care
NCT03955146	PHASE3	TERMINATED	Zephyrus I: Evaluation of Efficacy and Safety of Pamrevlumab in Participants With Idiopathic Pulmonary Fibrosis (IPF)
NCT04300920	PHASE3	COMPLETED	Prospective Treatment Efficacy in IPF Using Genotype for Nac Selection (PRECISIONS) Trial
NCT04419558	PHASE3	TERMINATED	Zephyrus II: Efficacy and Safety Study of Pamrevlumab in Participants With Idiopathic Pulmonary Fibrosis (IPF)