NKX6-2

Summary

NKX6-2 (NK6 homeobox 2, HGNC:19321) is a protein-coding gene on chromosome 10q26.3, encoding Homeobox protein Nkx-6.2 (Q9C056). Transcription factor with repressor activity involved in the regulation of axon-glial interactions at myelin paranodes in oligodendrocytes.

Enables sequence-specific double-stranded DNA binding activity. Predicted to be involved in cell differentiation; regulation of DNA-templated transcription; and regulation of myelination. Predicted to act upstream of or within several processes, including central nervous system myelination; pancreatic A cell differentiation; and regulation of oligodendrocyte differentiation. Predicted to be located in chromatin. Predicted to be active in nucleus. Implicated in spastic ataxia 8.

Source: NCBI Gene 84504 — RefSeq curated summary.

At a glance

• Gene–disease (curated): spastic ataxia 8, autosomal recessive, with hypomyelinating leukodystrophy (Strong, GenCC)
• GWAS associations: 1
• Clinical variants (ClinVar): 187 total — 11 pathogenic, 9 likely-pathogenic
• Phenotypes (HPO): 56
• MANE Select transcript: NM_177400

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:19321
Approved symbol	NKX6-2
Name	NK6 homeobox 2
Location	10q26.3
Locus type	gene with protein product
Status	Approved
Aliases	NKX6B, GTX, NKX6.1
Ensembl gene	ENSG00000148826
Ensembl biotype	protein_coding
OMIM	605955
Entrez	84504

Gene structure

Transcript identifiers

Ensembl transcripts: 2 — 1 protein_coding, 1 protein_coding_CDS_not_defined

ENST00000368592, ENST00000441365

RefSeq mRNA: 1 — MANE Select: NM_177400 NM_177400

CCDS: CCDS7670

Canonical transcript exons

ENST00000368592 — 3 exons

Exon	Start	End
ENSE00000987628	132785280	132785452
ENSE00001447507	132783181	132785170
ENSE00001447509	132785543	132786147

Expression profiles

Bgee: expression breadth ubiquitous, 101 present calls, max score 97.65.

FANTOM5 (CAGE): breadth tissue_specific, TPM avg 1.4987 / max 192.1006, expressed in 96 samples.

FANTOM5 promoters (1 alternative TSS)

Promoter ID	TPM avg	Samples expressed
112084	1.4987	96

Top tissues by expression

129 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
C1 segment of cervical spinal cord	UBERON:0006469	97.65	gold quality
substantia nigra	UBERON:0002038	93.85	gold quality
putamen	UBERON:0001874	93.21	gold quality
Ammon’s horn	UBERON:0001954	92.92	gold quality
primary visual cortex	UBERON:0002436	92.24	gold quality
apex of heart	UBERON:0002098	90.33	gold quality
temporal lobe	UBERON:0001871	89.99	gold quality
amygdala	UBERON:0001876	89.99	gold quality
hypothalamus	UBERON:0001898	88.84	gold quality
caudate nucleus	UBERON:0001873	88.53	gold quality
Brodmann (1909) area 9	UBERON:0013540	87.58	gold quality
nucleus accumbens	UBERON:0001882	86.19	gold quality
corpus callosum	UBERON:0002336	84.48	gold quality
male germ line stem cell (sensu Vertebrata) in testis	CL:0000089 ∩ UBERON:0000473	83.80	gold quality
dorsolateral prefrontal cortex	UBERON:0009834	82.94	gold quality
superior frontal gyrus	UBERON:0002661	82.78	gold quality
cerebral cortex	UBERON:0000956	82.77	gold quality
sural nerve	UBERON:0015488	81.15	gold quality
frontal cortex	UBERON:0001870	81.09	gold quality
prefrontal cortex	UBERON:0000451	80.74	gold quality
right frontal lobe	UBERON:0002810	80.69	gold quality
brain	UBERON:0000955	79.47	gold quality
anterior cingulate cortex	UBERON:0009835	79.12	gold quality
primordial germ cell in gonad	CL:0000670 ∩ UBERON:0000991	76.07	gold quality
right hemisphere of cerebellum	UBERON:0014890	73.90	gold quality
lower esophagus mucosa	UBERON:0035834	73.51	gold quality
cerebellum	UBERON:0002037	73.02	gold quality
cerebellar cortex	UBERON:0002129	72.73	gold quality
cerebellar hemisphere	UBERON:0002245	72.17	gold quality
hindlimb stylopod muscle	UBERON:0004252	71.63	gold quality

Single-cell (SCXA)

Detected in 2 experiment(s), a significant marker in 1.

Experiment	Marker?	Max mean expression
E-HCAD-56	yes	434.72
E-ANND-3	no	2.32

Regulation

Is transcription factor: yes

Downstream targets (CollecTRI)

5 targets.

Target	Regulation
IGF1	Activation
MBP
NKX6-2
PLP1
WNT1

JASPAR motifs

Motif	Name	Family
MA0675.1	NKX6-2	NK
MA0675.2	NKX6-2	NK

JASPAR matrix evidence (PMIDs): PMID:18585359

Upstream regulators (CollecTRI, top): CREB1, NKX6-2

miRNA regulators (miRDB)

15 targeting NKX6-2, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-5692A	100.00	74.40	6850
HSA-MIR-548AW	99.99	72.57	3559
HSA-MIR-520D-5P	99.98	73.34	4883
HSA-MIR-524-5P	99.98	73.43	4882
HSA-MIR-1468-3P	99.96	72.74	3797
HSA-MIR-544A	99.84	68.66	1965
HSA-MIR-3121-3P	99.82	71.96	3630
HSA-MIR-548AJ-5P	99.78	71.12	3085
HSA-MIR-548F-5P	99.78	71.02	3093
HSA-MIR-548G-5P	99.78	71.12	3085
HSA-MIR-548X-5P	99.78	71.12	3085
HSA-MIR-3682-3P	99.58	67.63	865
HSA-MIR-32-3P	99.36	68.20	2517
HSA-MIR-2276-3P	98.76	67.75	1384
HSA-MIR-4772-3P	98.04	65.60	1203

Literature-anchored findings (GeneRIF, showing 8)

• NKX6-2 mutations should be considered in the differential diagnosis of spastic ataxia and hypomyelination. (PMID:28575651)
• This study showed that the finding of individuals with a severe neurodevelopemental phenotype with hypomyelination associated with biallelic mutations in NKX6-2 provides direct evidence of the relevant role of NKX6-2 in CNS development in humans. (PMID:28969374)
• Using whole-exome or whole-genome sequencing, we identified the previously reported c.196delC and c.487C>G variants in NKX6-2 in 3 and 2 unrelated index cases, respectively; the novel c.608G>A variant was identified in a sixth patient. All variants were homozygous in affected family members only. (PMID:29388673)
• Genetic and phenotypic characterization of NKX6-2-related spastic ataxia and hypomyelination. (PMID:31509304)
• Expanding the clinical and neuroimaging features of NKX6-2-related hereditary spastic ataxia type 8. (PMID:32004679)
• A homozygous missense variant in the homeobox domain of the NKX6-2 results in progressive spastic ataxia type 8 associated with lower limb weakness and neurological manifestations. (PMID:32246862)
• NK6 Homeobox 2 Regulated Gastrokin-2 Suppresses Gastric Cancer Cell Proliferation and Invasion via Akt Signaling Pathway. (PMID:33009998)
• One-step Reprogramming of Human Fibroblasts into Oligodendrocyte-like Cells by SOX10, OLIG2, and NKX6.2. (PMID:33770499)

Cross-species orthologs

10 orthologs

Organism	Symbol	Gene ID
danio_rerio	nkx6.2	ENSDARG00000104735
mus_musculus	Nkx6-2	ENSMUSG00000041309
rattus_norvegicus	Nkx6-2	ENSRNOG00000017748
drosophila_melanogaster	NK7.1	FBGN0024321
drosophila_melanogaster	HGTX	FBGN0040318
drosophila_melanogaster	scro	FBGN0287186
caenorhabditis_elegans	ceh-9	WBGENE00000434
caenorhabditis_elegans		WBGENE00000447
caenorhabditis_elegans		WBGENE00000450
caenorhabditis_elegans		WBGENE00000584

Paralogs (13): NKX3-2 (ENSG00000109705), NKX2-3 (ENSG00000119919), NKX2-4 (ENSG00000125816), NKX2-2 (ENSG00000125820), NKX2-8 (ENSG00000136327), NKX2-1 (ENSG00000136352), NKX6-1 (ENSG00000163623), NKX6-3 (ENSG00000165066), NKX3-1 (ENSG00000167034), NKX2-6 (ENSG00000180053), NKX2-5 (ENSG00000183072), NKX1-2 (ENSG00000229544), NKX1-1 (ENSG00000235608)

Protein

Protein identifiers

Homeobox protein Nkx-6.2 — Q9C056 (reviewed: Q9C056)

Alternative names: Homeobox protein NK-6 homolog B

All UniProt accessions (1): Q9C056

UniProt curated annotations — full annotation on UniProt →

Function. Transcription factor with repressor activity involved in the regulation of axon-glial interactions at myelin paranodes in oligodendrocytes. Binds to the consensus DNA sequence 5’-(A/T)TTAATGA-3’. In oligodendrocytes, binds to MBP and PLP1 promoter regions.

Subcellular location. Nucleus.

Tissue specificity. Highest expression in brain.

Disease relevance. Spastic ataxia 8, autosomal recessive, with hypomyelinating leukodystrophy (SPAX8) [MIM:617560] An autosomal recessive neurodegenerative disorder characterized by early-onset hypotonia which progresses to a pyramidal syndrome with ataxia, spasticity, hyperreflexia, weakness and loss of ambulation. Brain imaging shows cerebellar atrophy and hypomyelinating leukodystrophy. The disease is caused by variants affecting the gene represented in this entry.

RefSeq proteins (1): NP_796374* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR000047	HTH_motif	Conserved_site
IPR001356	HD	Domain
IPR009057	Homeodomain-like_sf	Homologous_superfamily
IPR017970	Homeobox_CS	Conserved_site
IPR020479	HD_metazoa	Domain
IPR050394	Homeobox_NK-like	Family

Pfam: PF00046

UniProt features (9 total): region of interest 3, sequence variant 3, chain 1, DNA-binding region 1, compositionally biased region 1

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q9C056-F1	66.25	0.22

Function

Pathways and Gene Ontology

Reactome pathways

0 pathways

MSigDB gene sets: 194 (showing top): GOBP_NEGATIVE_REGULATION_OF_CELL_DEVELOPMENT, BENPORATH_ES_WITH_H3K27ME3, MYOGENIN_Q6, GOBP_POSITIVE_REGULATION_OF_CELL_FATE_COMMITMENT, GOBP_NEGATIVE_REGULATION_OF_GLIOGENESIS, GCANCTGNY_MYOD_Q6, GOBP_NEGATIVE_REGULATION_OF_GLIAL_CELL_DIFFERENTIATION, GOBP_POSITIVE_REGULATION_OF_GLIAL_CELL_DIFFERENTIATION, GOBP_GLIAL_CELL_DEVELOPMENT, GOBP_NEUROGENESIS, GOBP_REGULATION_OF_MYELINATION, GOBP_REGULATION_OF_NERVOUS_SYSTEM_DEVELOPMENT, GOBP_POSITIVE_REGULATION_OF_NERVOUS_SYSTEM_DEVELOPMENT, GOBP_NEGATIVE_REGULATION_OF_NERVOUS_SYSTEM_DEVELOPMENT, GOBP_NEUROMUSCULAR_PROCESS_CONTROLLING_BALANCE

GO Biological Process (18): pancreatic A cell differentiation (GO:0003310), regulation of DNA-templated transcription (GO:0006355), regulation of transcription by RNA polymerase II (GO:0006357), negative regulation of cell fate commitment (GO:0010454), positive regulation of cell fate commitment (GO:0010455), spinal cord motor neuron cell fate specification (GO:0021520), central nervous system myelination (GO:0022010), cell differentiation (GO:0030154), regulation of myelination (GO:0031641), negative regulation of DNA-templated transcription (GO:0045892), positive regulation of oligodendrocyte differentiation (GO:0048714), negative regulation of oligodendrocyte differentiation (GO:0048715), neuromuscular process controlling balance (GO:0050885), negative regulation of transcription by RNA polymerase II (GO:0000122), endocrine pancreas development (GO:0031018), cell fate commitment (GO:0045165), neuron fate commitment (GO:0048663), oligodendrocyte differentiation (GO:0048709)

GO Molecular Function (7): RNA polymerase II cis-regulatory region sequence-specific DNA binding (GO:0000978), DNA-binding transcription factor activity, RNA polymerase II-specific (GO:0000981), DNA-binding transcription repressor activity, RNA polymerase II-specific (GO:0001227), DNA binding (GO:0003677), DNA-binding transcription factor activity (GO:0003700), sequence-specific double-stranded DNA binding (GO:1990837), sequence-specific DNA binding (GO:0043565)

GO Cellular Component (2): chromatin (GO:0000785), nucleus (GO:0005634)

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
regulation of DNA-templated transcription	3
cell fate commitment	3
RNA polymerase II transcription regulatory region sequence-specific DNA binding	3
DNA-templated transcription	2
transcription by RNA polymerase II	2
regulation of cell fate commitment	2
myelination	2
cellular developmental process	2
oligodendrocyte differentiation	2
regulation of oligodendrocyte differentiation	2
regulation of transcription by RNA polymerase II	2
endocrine pancreas development	1
enteroendocrine cell differentiation	1
regulation of gene expression	1
regulation of RNA biosynthetic process	1
negative regulation of cell differentiation	1
positive regulation of cell differentiation	1
spinal cord motor neuron differentiation	1
neuron fate specification	1
oligodendrocyte development	1
axon ensheathment in central nervous system	1
regulation of cellular process	1
regulation of nervous system development	1
negative regulation of RNA biosynthetic process	1
positive regulation of glial cell differentiation	1
negative regulation of glial cell differentiation	1
musculoskeletal movement	1
neuromuscular process	1
negative regulation of DNA-templated transcription	1
pancreas development	1
endocrine system development	1
anatomical structure development	1
cell differentiation	1
neuron differentiation	1
central nervous system development	1
glial cell differentiation	1
cis-regulatory region sequence-specific DNA binding	1
chromatin	1
DNA-binding transcription factor activity	1
negative regulation of transcription by RNA polymerase II	1

Protein interactions and networks

STRING

1442 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
NKX6-2	NEUROG3	Q9Y4Z2	875
NKX6-2	ISL1	P20663	870
NKX6-2	SLC2A2	P11168	833
NKX6-2	FOXA2	Q9Y261	822
NKX6-2	NEUROD1	Q13562	779
NKX6-2	PTF1A	Q7RTS3	755
NKX6-2	RFX6	Q8HWS3	753
NKX6-2	OLIG2	Q13516	738
NKX6-2	TLE3	Q04726	735
NKX6-2	GCG	P01275	728
NKX6-2	HNF1A	P20823	725
NKX6-2	SLIT1	O75093	721
NKX6-2	INS	P01308	712
NKX6-2	SST	P01166	710
NKX6-2	SLIT3	O75094	678

IntAct

2 interactions, top by confidence:

A	B	Type	Score
CNGA1	WWC1	psi-mi:“MI:0914”(association)	0.350

BioGRID (1): NKX6-2 (Affinity Capture-MS)

ESM2 similar proteins: A1YEY5, A1YFA5, A1YFI3, A1YG57, A1YGK7, A2D5K9, A2D5Y4, A2T733, A2T748, A2T7F3, A2T7P4, O95096, P02830, P04476, P09021, P09024, P09067, P09629, P09631, P18864, P20719, P23459, P23463, P31268, P31269, P35453, P42586, P43697, P56915, P70217, P81068, P97334, Q02591, Q1KKX0, Q1KKX1, Q1KKY0, Q1KKY1, Q1KL17, Q2HJ67, Q5EU41

Diamond homologs: A0JPN1, A1YG85, A5PKG8, A6NJ46, A6NMT0, A7MB54, A9L937, B0VXK3, D2KQB0, E7FDX5, M0R6D8, O08686, O13023, O35762, O42365, O43364, O43711, O55144, O88181, O93366, O93367, O93590, P0C1T1, P10035, P14652, P14837, P20009, P28468, P31245, P31246, P31261, P31314, P42583, P42584, P43120, P43345, P43688, P50219, P52945, P52950

SIGNOR signaling

0 interactions.

Disease & clinical

Clinical variants and AI predictions

ClinVar

187 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	11
Likely pathogenic	9
Uncertain significance	101
Likely benign	53
Benign	6

Top pathogenic / likely-pathogenic (20)

Variant ID	HGVS	Classification
1323367	NM_177400.3(NKX6-2):c.119del (p.Phe40fs)	Pathogenic
1344692	NM_177400.3(NKX6-2):c.571C>T (p.Gln191Ter)	Pathogenic
1344694	NM_177400.3(NKX6-2):c.598C>T (p.Arg200Trp)	Pathogenic
1369670	NM_177400.3(NKX6-2):c.216del (p.Gly74fs)	Pathogenic
1700622	NM_177400.3(NKX6-2):c.516C>G (p.Tyr172Ter)	Pathogenic
3655573	NM_177400.3(NKX6-2):c.568_569dup (p.Ser190fs)	Pathogenic
430622	NM_177400.3(NKX6-2):c.121A>T (p.Lys41Ter)	Pathogenic
430623	NM_177400.3(NKX6-2):c.487C>G (p.Leu163Val)	Pathogenic
627615	NM_177400.3(NKX6-2):c.565G>T (p.Glu189Ter)	Pathogenic
627617	NM_177400.3(NKX6-2):c.599G>A (p.Arg200Gln)	Pathogenic
627618	NM_177400.3(NKX6-2):c.606delinsTA (p.Lys202fs)	Pathogenic
1344690	NM_177400.3(NKX6-2):c.301C>A (p.Arg101Ser)	Likely pathogenic
1344693	NM_177400.3(NKX6-2):c.592A>G (p.Asn198Asp)	Likely pathogenic
1943272	NM_177400.3(NKX6-2):c.406+1G>T	Likely pathogenic
2503419	NM_177400.3(NKX6-2):c.287_288dup (p.Ala97fs)	Likely pathogenic
2844277	NM_177400.3(NKX6-2):c.217_235del (p.Gly73fs)	Likely pathogenic
4278252	NM_177400.3(NKX6-2):c.161_162insA (p.Gly55fs)	Likely pathogenic
4278253	NM_177400.3(NKX6-2):c.161delinsAA (p.Leu54fs)	Likely pathogenic
504099	NM_177400.3(NKX6-2):c.234del (p.Leu79fs)	Likely pathogenic
627616	NM_177400.3(NKX6-2):c.589C>T (p.Gln197Ter)	Likely pathogenic

SpliceAI

435 predictions. Top by Δscore:

Variant	Effect	Δscore
10:132785276:TCA:T	donor_loss	1.0000
10:132785278:A:C	donor_loss	1.0000
10:132785279:CC:C	donor_loss	1.0000
10:132785448:CGGGG:C	acceptor_gain	1.0000
10:132785449:GGGG:G	acceptor_gain	1.0000
10:132785450:GGG:G	acceptor_gain	1.0000
10:132785451:GG:G	acceptor_gain	1.0000
10:132785451:GGCTG:G	acceptor_loss	1.0000
10:132785453:C:CC	acceptor_gain	1.0000
10:132785453:CTGCA:C	acceptor_loss	1.0000
10:132785456:C:CT	acceptor_gain	1.0000
10:132785457:A:T	acceptor_gain	1.0000
10:132785538:CTCA:C	donor_loss	1.0000
10:132785539:TCA:T	donor_loss	1.0000
10:132785540:CAC:C	donor_loss	1.0000
10:132785541:A:AC	donor_gain	1.0000
10:132785541:AC:A	donor_gain	1.0000
10:132785542:C:CC	donor_gain	1.0000
10:132785542:CC:C	donor_gain	1.0000
10:132785542:CCCG:C	donor_gain	1.0000
10:132785542:CCCGG:C	donor_gain	1.0000
10:132784981:T:TA	donor_gain	0.9900
10:132785166:CAGAC:C	acceptor_gain	0.9900
10:132785171:C:CG	acceptor_loss	0.9900
10:132785274:GCTCA:G	donor_loss	0.9900
10:132785278:A:AC	donor_gain	0.9900
10:132785279:C:CC	donor_gain	0.9900
10:132785541:ACC:A	donor_gain	0.9900
10:132785542:CCC:C	donor_gain	0.9900
10:132785167:AGAC:A	acceptor_gain	0.9800

AlphaMissense

1765 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
10:132785140:G:T	R204S	1.000
10:132785154:C:G	R199P	1.000
10:132785155:G:T	R199S	1.000
10:132785156:G:C	N198K	1.000
10:132785156:G:T	N198K	1.000
10:132785157:T:A	N198I	1.000
10:132785157:T:C	N198S	1.000
10:132785157:T:G	N198T	1.000
10:132785158:T:C	N198D	1.000
10:132785158:T:G	N198H	1.000
10:132785159:C:A	Q197H	1.000
10:132785159:C:G	Q197H	1.000
10:132785162:G:C	F196L	1.000
10:132785162:G:T	F196L	1.000
10:132785163:A:C	F196C	1.000
10:132785163:A:G	F196S	1.000
10:132785164:A:C	F196V	1.000
10:132785164:A:G	F196L	1.000
10:132785164:A:T	F196I	1.000
10:132785165:C:A	W195C	1.000
10:132785165:C:G	W195C	1.000
10:132785167:A:G	W195R	1.000
10:132785167:A:T	W195R	1.000
10:132785280:C:A	K193N	1.000
10:132785280:C:G	K193N	1.000
10:132785299:A:C	M187R	1.000
10:132785299:A:G	M187T	1.000
10:132785305:A:G	L185P	1.000
10:132785314:G:T	A182D	1.000
10:132785317:A:G	L181P	1.000

dbSNP variants (sampled 300 via entrez): RS1000395627 (10:132784468 C>G), RS1000820788 (10:132785099 C>T), RS1001413785 (10:132787690 T>A,C), RS1001487283 (10:132787816 G>A,T), RS1001530547 (10:132787571 GCCCC>G,GCCC), RS1001558226 (10:132787841 GC>G), RS1001671537 (10:132783387 C>A,G), RS1002071584 (10:132782812 G>A), RS1003719798 (10:132783868 G>A,C), RS1003888707 (10:132786079 G>A,C,T), RS1003905137 (10:132786469 G>A), RS1003973854 (10:132786598 G>A,C), RS1003991676 (10:132786053 AGCGCGGG>A,AGCGCGGGGCGCGGG,AGCGCGGGGCGCGGGGCGCGGG), RS1004891095 (10:132786948 C>T), RS1004909212 (10:132784488 G>A)

Disease associations

OMIM: gene MIM:605955 | disease phenotypes: MIM:617560

GenCC curated gene-disease

Disease	Classification	Inheritance
spastic ataxia 8, autosomal recessive, with hypomyelinating leukodystrophy	Strong	Autosomal recessive

Mondo (1): spastic ataxia 8, autosomal recessive, with hypomyelinating leukodystrophy (MONDO:0033043)

Orphanet (1): NKX6-2-related autosomal recessive hypomyelinating leukodystrophy (Orphanet:527497)

HPO phenotypes

56 total (30 of 56 shown, HPO-id order):

HPO	Term
HP:0000007	Autosomal recessive inheritance
HP:0000212	Gingival overgrowth
HP:0000218	High palate
HP:0000276	Long face
HP:0000414	Bulbous nose
HP:0000473	Torticollis
HP:0000486	Strabismus
HP:0000571	Hypometric saccades
HP:0000639	Nystagmus
HP:0000664	Synophrys
HP:0000668	Hypodontia
HP:0000678	Dental crowding
HP:0001007	Hirsutism
HP:0001249	Intellectual disability
HP:0001250	Seizure
HP:0001251	Ataxia
HP:0001252	Hypotonia
HP:0001257	Spasticity
HP:0001260	Dysarthria
HP:0001263	Global developmental delay
HP:0001270	Motor delay
HP:0001272	Cerebellar atrophy
HP:0001288	Gait disturbance
HP:0001290	Generalized hypotonia
HP:0001332	Dystonia
HP:0001347	Hyperreflexia
HP:0002007	Frontal bossing
HP:0002059	Cerebral atrophy
HP:0002070	Limb ataxia
HP:0002078	Truncal ataxia

GWAS associations

1 associations (top):

Study	Trait	p-value
GCST012361_3	Relative brain age	5.000000e-08

EFO canonical traits (1, from GWAS)

EFO ID	Trait name
EFO:0010602	brain age measurement

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

23 total (human), top 23 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
ammonium 2,3,3,3-tetrafluoro-2-(heptafluoropropoxy)-propanoate	affects cotreatment, increases expression	1
aminomethylphosphonic acid (AMPA)	decreases expression	1
butyraldehyde	increases expression	1
perfluorooctanoic acid	affects cotreatment, increases expression	1
ferrous chloride	increases expression	1
perfluorooctane sulfonic acid	increases expression, affects cotreatment	1
ICG 001	decreases expression	1
Poly(amidoamine)	decreases expression	1
perfluorobutanesulfonic acid	affects cotreatment, increases expression	1
NSC668394	increases expression	1
4-(4-((5-(4,5-dimethyl-2-nitrophenyl)-2-furanyl)methylene)-4,5-dihydro-3-methyl-5-oxo-1H-pyrazol-1-yl)benzoic acid	decreases expression	1
Air Pollutants	increases abundance, increases expression	1
Benzo(a)pyrene	increases methylation	1
Estradiol	affects expression	1
Phthalic Acids	decreases methylation	1
Silicon Dioxide	increases expression	1
Triclosan	decreases expression	1
Valproic Acid	increases methylation	1
2,4-Dichlorophenoxyacetic Acid	decreases expression	1
Gold Compounds	decreases expression	1
Asbestos, Crocidolite	decreases methylation	1
Asbestos, Amosite	decreases methylation	1
Particulate Matter	increases abundance, increases expression	1

Cellosaurus cell lines

3 cell lines: 3 embryonic stem cell

First 10 cell lines (id-ordered, not curated):

Cellosaurus	Name	Category	Sex
CVCL_A4R2	SEES3-1V human NKX6-2, clone1	Embryonic stem cell	Male
CVCL_A4R3	SEES3-1V human NKX6-2, clone2	Embryonic stem cell	Male
CVCL_A4R4	SEES3-1V human NKX6-2, clone3	Embryonic stem cell	Male

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.