NOTO

Summary

NOTO (notochord homeobox, HGNC:31839) is a protein-coding gene on chromosome 2p13.2, encoding Homeobox protein notochord (A8MTQ0). Transcription regulator acting downstream of both FOXA2 and Brachyury (T) during notochord development.

Enables sequence-specific double-stranded DNA binding activity. Predicted to be involved in brain development; neuron differentiation; and regulation of transcription by RNA polymerase II. Predicted to act upstream of or within several processes, including embryonic organ development; motile cilium assembly; and regulation of cilium assembly. Predicted to be located in chromatin. Predicted to be active in nucleus.

Source: NCBI Gene 344022 — RefSeq curated summary.

At a glance

• GWAS associations: 2
• Clinical variants (ClinVar): 49 total
• Transcription factor: yes — 15 downstream targets (CollecTRI)
• MANE Select transcript: NM_001134462

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:31839
Approved symbol	NOTO
Name	notochord homeobox
Location	2p13.2
Locus type	gene with protein product
Status	Approved
Ensembl gene	ENSG00000214513
Ensembl biotype	protein_coding
OMIM	620695
Entrez	344022

Gene structure

Transcript identifiers

Ensembl transcripts: 1 — 1 protein_coding

ENST00000398468

RefSeq mRNA: 1 — MANE Select: NM_001134462 NM_001134462

CCDS: CCDS46335

Canonical transcript exons

ENST00000398468 — 3 exons

Exon	Start	End
ENSE00001533249	73210771	73212513
ENSE00001533251	73208400	73208614
ENSE00001533254	73202574	73203048

Expression profiles

Bgee: expression breadth tissue_specific, 4 present calls, max score 48.77.

FANTOM5 (CAGE): breadth tissue_specific, TPM avg 0.2564 / max 45.7923, expressed in 60 samples.

FANTOM5 promoters (1 alternative TSS)

Promoter ID	TPM avg	Samples expressed
20941	0.2564	60

Top tissues by expression

116 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
stromal cell of endometrium	CL:0002255	48.77	gold quality
duodenum	UBERON:0002114	43.13	silver quality
colonic epithelium	UBERON:0000397	41.54	gold quality
mucosa of transverse colon	UBERON:0004991	40.62	silver quality
bone marrow	UBERON:0002371	38.64	gold quality
bone marrow cell	CL:0002092	38.01	gold quality
skeletal muscle tissue	UBERON:0001134	37.69	gold quality
muscle tissue	UBERON:0002385	37.68	gold quality
ganglionic eminence	UBERON:0004023	37.16	gold quality
ventricular zone	UBERON:0003053	36.48	gold quality
cortical plate	UBERON:0005343	36.47	gold quality
calcaneal tendon	UBERON:0003701	36.38	gold quality
rectum	UBERON:0001052	35.74	silver quality
right coronary artery	UBERON:0001625	35.44	gold quality
sural nerve	UBERON:0015488	35.30	gold quality
apex of heart	UBERON:0002098	35.17	gold quality
leukocyte	CL:0000738	34.80	gold quality
blood	UBERON:0000178	34.54	gold quality
monocyte	CL:0000576	34.42	gold quality
liver	UBERON:0002107	33.97	gold quality
mucosa of stomach	UBERON:0001199	33.86	gold quality
cerebellum	UBERON:0002037	33.54	gold quality
uterine cervix	UBERON:0000002	33.44	gold quality
cerebellar cortex	UBERON:0002129	33.37	gold quality
stomach	UBERON:0000945	33.33	gold quality
cerebellar hemisphere	UBERON:0002245	33.22	gold quality
smooth muscle tissue	UBERON:0001135	33.08	gold quality
right hemisphere of cerebellum	UBERON:0014890	33.01	gold quality
body of stomach	UBERON:0001161	32.57	gold quality
endometrium	UBERON:0001295	32.36	gold quality

Single-cell (SCXA)

Detected in 1 experiment(s), a significant marker in 1.

Experiment	Marker?	Max mean expression
E-ANND-3	yes	2.63

Regulation

Is transcription factor: yes

Downstream targets (CollecTRI)

15 targets.

Target	Regulation
ADAM2
ALG3
BTK
CAT
CCR4
CD74
ENO2
EOMES
LCK
NOTO
SUPT7L
TOP2B
TPM1
USP21
WT1

JASPAR motifs

Motif	Name	Family
MA0710.1	NOTO	NK
MA0710.2	NOTO	NK

JASPAR matrix evidence (PMIDs): PMID:18585360

Upstream regulators (CollecTRI, top): AP1, NFKB, NOTO

miRNA regulators (miRDB)

10 targeting NOTO, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-LET-7F-2-3P	99.98	70.98	2588
HSA-MIR-1185-1-3P	99.98	71.04	2593
HSA-MIR-1185-2-3P	99.98	71.04	2593
HSA-MIR-145-5P	99.92	71.13	1836
HSA-MIR-5195-3P	99.92	70.92	1877
HSA-MIR-4493	99.90	66.48	977
HSA-MIR-8080	99.82	67.52	1342
HSA-MIR-4316	99.37	65.75	1360
HSA-MIR-10B-3P	99.04	66.98	988
HSA-MIR-554	95.20	66.98	341

Cross-species orthologs

5 orthologs

Organism	Symbol	Gene ID
danio_rerio	noto	ENSDARG00000021201
mus_musculus	Noto	ENSMUSG00000068302
rattus_norvegicus	Noto	ENSRNOG00000037863
drosophila_melanogaster	CG18599	FBGN0038592
caenorhabditis_elegans	ceh-5	WBGENE00000430

Paralogs (1): GSX1 (ENSG00000169840)

Protein

Protein identifiers

Homeobox protein notochord — A8MTQ0 (reviewed: A8MTQ0)

All UniProt accessions (1): A8MTQ0

UniProt curated annotations — full annotation on UniProt →

Function. Transcription regulator acting downstream of both FOXA2 and Brachyury (T) during notochord development. Required for node morphogenesis. Is essential for cilia formation in the posterior notochord (PNC) and for left-right patterning; acts upstream of FOXJ1 and RFX3 in this process and is required for the expression of various components important for axonemal assembly and function. Plays a role in regulating axial versus paraxial cell fate. Activates the transcription of ciliary proteins C11orf97 homolog, FAM183B and SPACA9 in the embryonic ventral node.

Subcellular location. Nucleus.

RefSeq proteins (1): NP_001127934* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR001356	HD	Domain
IPR009057	Homeodomain-like_sf	Homologous_superfamily
IPR050877	EMX-VAX-Noto_Homeobox_TFs	Family

Pfam: PF00046

UniProt features (9 total): compositionally biased region 3, region of interest 2, sequence variant 2, chain 1, DNA-binding region 1

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-A8MTQ0-F1	68.69	0.26

Function

Pathways and Gene Ontology

Reactome pathways

1 pathways

ID	Pathway
R-HSA-9796292	Formation of axial mesoderm

MSigDB gene sets: 54 (showing top): GOBP_MORPHOGENESIS_OF_AN_EPITHELIUM, GOBP_EPITHELIUM_DEVELOPMENT, GOBP_NEUROGENESIS, GOBP_REGULATION_OF_CELLULAR_COMPONENT_BIOGENESIS, GOBP_DORSAL_VENTRAL_PATTERN_FORMATION, GOBP_SPECIFICATION_OF_SYMMETRY, GOBP_ANIMAL_ORGAN_MORPHOGENESIS, GOBP_REGULATION_OF_CELL_PROJECTION_ORGANIZATION, GOBP_EMBRYONIC_HEART_TUBE_DEVELOPMENT, GOBP_EMBRYONIC_ORGAN_MORPHOGENESIS, GOBP_HEART_MORPHOGENESIS, GOBP_EMBRYONIC_PATTERN_SPECIFICATION, GOBP_CILIUM_ORGANIZATION, GOBP_ORGANELLE_ASSEMBLY, GOBP_HEAD_DEVELOPMENT

GO Biological Process (11): heart looping (GO:0001947), regulation of transcription by RNA polymerase II (GO:0006357), central nervous system development (GO:0007417), brain development (GO:0007420), embryonic pattern specification (GO:0009880), dorsal/ventral pattern formation (GO:0009953), neuron differentiation (GO:0030182), notochord development (GO:0030903), motile cilium assembly (GO:0044458), regulation of cilium assembly (GO:1902017), determination of left/right symmetry (GO:0007368)

GO Molecular Function (5): RNA polymerase II cis-regulatory region sequence-specific DNA binding (GO:0000978), DNA-binding transcription factor activity, RNA polymerase II-specific (GO:0000981), sequence-specific double-stranded DNA binding (GO:1990837), DNA binding (GO:0003677), protein binding (GO:0005515)

GO Cellular Component (2): chromatin (GO:0000785), nucleus (GO:0005634)

Reactome top-level categories

Rollup of top-1 pathways:

Category	Pathways
Gastrulation	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
cilium assembly	2
RNA polymerase II transcription regulatory region sequence-specific DNA binding	2
embryonic heart tube morphogenesis	1
determination of heart left/right asymmetry	1
regulation of DNA-templated transcription	1
transcription by RNA polymerase II	1
nervous system development	1
system development	1
central nervous system development	1
animal organ development	1
head development	1
pattern specification process	1
embryo development	1
regionalization	1
cell differentiation	1
generation of neurons	1
embryonic organ development	1
regulation of plasma membrane bounded cell projection assembly	1
regulation of organelle assembly	1
determination of bilateral symmetry	1
left/right pattern formation	1
cis-regulatory region sequence-specific DNA binding	1
chromatin	1
DNA-binding transcription factor activity	1
regulation of transcription by RNA polymerase II	1
double-stranded DNA binding	1
sequence-specific DNA binding	1
nucleic acid binding	1
binding	1
chromosome	1
cellular anatomical structure	1
intracellular membrane-bounded organelle	1

Protein interactions and networks

STRING

502 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
NOTO	PRAMEF18	Q5VWM3	447
NOTO	FOXA2	Q9Y261	394
NOTO	PRADC1	Q9BSG0	370
NOTO	HECTD3	Q5T447	369
NOTO	KLRG2	A4D1S0	347
NOTO	MCIDAS	D6RGH6	337
NOTO	FOXJ1	Q92949	336
NOTO	TBX6	O95947	325
NOTO	CHRD	Q9H2X0	320
NOTO	MRPL45	Q9BRJ2	320
NOTO	PALD1	Q9ULE6	319
NOTO	ACSM4	P0C7M7	310
NOTO	RFX3	P48380	308
NOTO	PTCD3	Q96EY7	298
NOTO	MRPL46	Q9H2W6	298

IntAct

103 interactions, top by confidence:

A	B	Type	Score
NOTO	KRTAP6-1	psi-mi:“MI:0915”(physical association)	0.560
NOTO	KRTAP19-7	psi-mi:“MI:0915”(physical association)	0.560
NOTO	FAM9B	psi-mi:“MI:0915”(physical association)	0.560
NOTO	TTC23	psi-mi:“MI:0915”(physical association)	0.560
NOTO	APOBEC1	psi-mi:“MI:0915”(physical association)	0.560
NOTO	NKX2-4	psi-mi:“MI:0915”(physical association)	0.560
NOTO	KRTAP5-6	psi-mi:“MI:0915”(physical association)	0.560
NOTO	LDLRAP1	psi-mi:“MI:0915”(physical association)	0.560
NOTO	IP6K3	psi-mi:“MI:0915”(physical association)	0.560
NOTO	CHAF1A	psi-mi:“MI:0915”(physical association)	0.560
NOTO	LRP10	psi-mi:“MI:0915”(physical association)	0.560
NOTO	BTF3	psi-mi:“MI:0915”(physical association)	0.560
NOTO	POU4F2	psi-mi:“MI:0915”(physical association)	0.560
NOTO	CEP19	psi-mi:“MI:0915”(physical association)	0.560
NOTO	FOXD2	psi-mi:“MI:0915”(physical association)	0.560
NOTO	KRT34	psi-mi:“MI:0915”(physical association)	0.560
NOTO	HNRNPK	psi-mi:“MI:0915”(physical association)	0.560
KRTAP6-3	NOTO	psi-mi:“MI:0915”(physical association)	0.560
NOTO	ANKRD11	psi-mi:“MI:0915”(physical association)	0.560
NOTO	MAGED1	psi-mi:“MI:0915”(physical association)	0.560
NOTO	CCDC120	psi-mi:“MI:0915”(physical association)	0.560
NOTO	GLYCTK	psi-mi:“MI:0915”(physical association)	0.560
NOTO	BAG3	psi-mi:“MI:0915”(physical association)	0.560
NOTO	FOXH1	psi-mi:“MI:0915”(physical association)	0.560
NOTO	EIPR1	psi-mi:“MI:0915”(physical association)	0.560
NOTO	MEIS2	psi-mi:“MI:0915”(physical association)	0.560

BioGRID (35): NOTO (Two-hybrid), NOTO (Two-hybrid), NOTO (Two-hybrid), NOTO (Two-hybrid), NOTO (Two-hybrid), NOTO (Two-hybrid), NOTO (Two-hybrid), NOTO (Two-hybrid), NOTO (Two-hybrid), NOTO (Two-hybrid), NOTO (Two-hybrid), NOTO (Two-hybrid), NOTO (Two-hybrid), NOTO (Two-hybrid), NOTO (Two-hybrid)

ESM2 similar proteins: A1YEV8, A1YF08, A1YG25, A1YG85, A2RU54, A2T711, A2T756, A8MTQ0, O14813, O15522, O35160, O35602, O43763, O70218, P28360, P42580, P43687, P50223, P52945, P52946, P52947, P70118, P70354, P81062, Q06348, Q2VL79, Q2VL84, Q2VL85, Q2VL87, Q2VL88, Q61663, Q62066, Q62782, Q6XYB7, Q7YRX0, Q96IS3, Q99811, Q9DED6, Q9ER42, Q9GK08

Diamond homologs: A1A546, A1L2P5, A6NNA5, A6YP92, A8DT10, A8MTQ0, G5EC89, G5ECT8, O09113, O14813, O15266, O35085, O35137, O35690, O35750, O42115, O42201, O42370, O42567, O43365, O60902, O70137, O93353, O93590, O95076, O97039, P02831, P09027, P0DMV5, P18488, P20269, P23759, P23760, P24610, P31249, P31316, P31357, P47239, P50901, P56407

SIGNOR signaling

0 interactions.

Enriched among interaction partners

Reactome pathways and GO biological processes over-represented among this gene’s 32 IntAct physical interaction partners (hypergeometric vs the genome-wide background, BH-FDR, gene-set size 15–500, ranked by fold). A functional readout of the neighbourhood — distinct from this gene’s own memberships above, and biased toward well-studied / hub proteins, so read it as themes rather than proof.

Reactome pathways:

Pathway	Partners	Fold	FDR
Keratinization	5	16.4×	6e-04

Disease & clinical

Clinical variants and AI predictions

ClinVar

49 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	44
Likely benign	4
Benign	0

Top pathogenic / likely-pathogenic (0)

SpliceAI

438 predictions. Top by Δscore:

Variant	Effect	Δscore
2:73208618:G:GT	donor_gain	1.0000
2:73205735:GCT:G	donor_gain	0.9900
2:73208398:AG:A	acceptor_gain	0.9900
2:73208399:GG:G	acceptor_gain	0.9900
2:73208562:TGGGG:T	donor_gain	0.9900
2:73210764:A:G	acceptor_gain	0.9900
2:73210765:TTATA:T	acceptor_loss	0.9900
2:73210766:TATA:T	acceptor_loss	0.9900
2:73210768:TA:T	acceptor_loss	0.9900
2:73210770:G:GT	acceptor_loss	0.9900
2:73210770:GGT:G	acceptor_gain	0.9900
2:73210770:GGTGA:G	acceptor_gain	0.9900
2:73208610:ACCAG:A	donor_loss	0.9800
2:73208611:CCAG:C	donor_loss	0.9800
2:73208612:CAGGT:C	donor_loss	0.9800
2:73208613:AGGTG:A	donor_loss	0.9800
2:73208614:GG:G	donor_loss	0.9800
2:73208615:G:GA	donor_loss	0.9800
2:73208616:T:A	donor_loss	0.9800
2:73210769:A:AG	acceptor_gain	0.9800
2:73210770:G:GG	acceptor_gain	0.9800
2:73208618:G:T	donor_gain	0.9700
2:73202977:GC:G	donor_gain	0.9600
2:73208397:TAGGG:T	acceptor_loss	0.9600
2:73208398:A:C	acceptor_loss	0.9600
2:73208399:GGGTT:G	acceptor_gain	0.9600
2:73210763:A:AG	acceptor_gain	0.9600
2:73203626:GCTCT:G	donor_gain	0.9500
2:73208398:A:AG	acceptor_gain	0.9500
2:73208399:G:GG	acceptor_gain	0.9500

AlphaMissense

1589 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
2:73208504:T:C	F163L	0.999
2:73208506:T:A	F163L	0.999
2:73208506:T:G	F163L	0.999
2:73208540:T:C	F175L	0.999
2:73208542:T:A	F175L	0.999
2:73208542:T:G	F175L	0.999
2:73210783:T:C	F204L	0.999
2:73210785:C:A	F204L	0.999
2:73210785:C:G	F204L	0.999
2:73208529:T:C	L171S	0.998
2:73210784:T:C	F204S	0.997
2:73210789:A:G	N206D	0.997
2:73208505:T:C	F163S	0.996
2:73208505:T:G	F163C	0.996
2:73210782:G:C	W203C	0.996
2:73210782:G:T	W203C	0.996
2:73210790:A:G	N206S	0.996
2:73210793:G:C	R207P	0.996
2:73208541:T:C	F175S	0.995
2:73208541:T:G	F175C	0.995
2:73210780:T:A	W203R	0.995
2:73210780:T:C	W203R	0.995
2:73210792:C:A	R207S	0.995
2:73208601:T:C	L195P	0.994
2:73210784:T:G	F204C	0.994
2:73210790:A:C	N206T	0.994
2:73210791:C:A	N206K	0.994
2:73210791:C:G	N206K	0.994
2:73210797:G:C	R208S	0.994
2:73210797:G:T	R208S	0.994

dbSNP variants (sampled 300 via entrez): RS1000285024 (2:73206984 G>A), RS1000387681 (2:73207398 G>C,T), RS1000713925 (2:73208203 C>T), RS1000902692 (2:73211799 A>G), RS1001286465 (2:73205475 G>A), RS1001926724 (2:73208605 A>T), RS1001938402 (2:73210781 G>A,T), RS1001979042 (2:73208972 G>A), RS1002101800 (2:73202275 G>C), RS1002263111 (2:73201908 CTCAAATCAAA>C,CTCAAATCAAATCAAA,CTCAAATCAAATCAAATCAAA), RS1002288778 (2:73204161 C>G,T), RS1002307386 (2:73210543 C>T), RS1002424612 (2:73204400 C>T), RS1002907415 (2:73209202 G>A), RS1002929802 (2:73210104 A>G)

Disease associations

OMIM: gene MIM:620695 | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

2 associations (top):

Study	Trait	p-value
GCST005316_336	Intelligence (MTAG)	2.000000e-10
GCST006269_1111	General cognitive ability	4.000000e-10

EFO canonical traits (1, from GWAS)

EFO ID	Trait name
EFO:0004337	intelligence

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

6 total (human), top 6 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
CGP 52608	affects binding, increases reaction	1
nutlin 3	affects cotreatment, increases expression	1
Benzo(a)pyrene	affects methylation	1
Dactinomycin	affects cotreatment, increases expression	1
Asbestos, Crocidolite	decreases methylation	1
Asbestos, Amosite	decreases methylation	1

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.