NSMCE3

Summary

NSMCE3 (NSE3 component of SMC5/6 complex, HGNC:7677) is a protein-coding gene on chromosome 15q13.1, encoding Non-structural maintenance of chromosomes element 3 homolog (Q96MG7). Component of the SMC5-SMC6 complex, a complex involved in repair of DNA double-strand breaks by homologous recombination. It is a common-essential gene (DepMap: required in 90.7% of cancer cell lines).

The protein encoded by this gene is part of the SMC5-6 chromatin reorganizing complex and is a member of the MAGE superfamily. This is an intronless gene.

Source: NCBI Gene 56160 — RefSeq curated summary.

At a glance

• Gene–disease (curated): lung disease, immunodeficiency, and chromosome breakage syndrome; (Moderate, GenCC)
• Clinical variants (ClinVar): 16 total — 2 pathogenic
• Phenotypes (HPO): 21
• Cancer dependency (DepMap): dependent in 90.7% of screened cell lines (common-essential)
• MANE Select transcript: NM_138704

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:7677
Approved symbol	NSMCE3
Name	NSE3 component of SMC5/6 complex
Location	15q13.1
Locus type	gene with protein product
Status	Approved
Aliases	HCA4, MAGEG1, MAGEL3, NSE3
Ensembl gene	ENSG00000185115
Ensembl biotype	protein_coding
OMIM	608243
Entrez	56160

Gene structure

Transcript identifiers

Ensembl transcripts: 1 — 1 protein_coding

ENST00000332303

RefSeq mRNA: 1 — MANE Select: NM_138704 NM_138704

CCDS: CCDS10023

Canonical transcript exons

ENST00000332303 — 1 exons

Exon	Start	End
ENSE00001314245	29264989	29269822

Expression profiles

Bgee: expression breadth ubiquitous, 133 present calls, max score 82.07.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 35.6084 / max 542.8948, expressed in 1814 samples.

FANTOM5 promoters (2 alternative TSS)

Promoter ID	TPM avg	Samples expressed
149062	28.0299	1813
149061	7.5785	1677

Top tissues by expression

133 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
islet of Langerhans	UBERON:0000006	82.07	gold quality
granulocyte	CL:0000094	81.97	gold quality
primordial germ cell in gonad	CL:0000670 ∩ UBERON:0000991	81.74	gold quality
leukocyte	CL:0000738	78.47	gold quality
stromal cell of endometrium	CL:0002255	78.35	gold quality
prefrontal cortex	UBERON:0000451	78.23	gold quality
monocyte	CL:0000576	78.09	gold quality
lymph node	UBERON:0000029	77.82	gold quality
hindlimb stylopod muscle	UBERON:0004252	77.74	gold quality
male germ line stem cell (sensu Vertebrata) in testis	CL:0000089 ∩ UBERON:0000473	77.63	gold quality
hypothalamus	UBERON:0001898	77.06	gold quality
placenta	UBERON:0001987	76.93	gold quality
smooth muscle tissue	UBERON:0001135	76.92	gold quality
skeletal muscle tissue	UBERON:0001134	76.79	gold quality
right adrenal gland cortex	UBERON:0035827	76.62	gold quality
left adrenal gland	UBERON:0001234	76.53	gold quality
bone marrow cell	CL:0002092	76.34	gold quality
adrenal gland	UBERON:0002369	76.32	gold quality
right adrenal gland	UBERON:0001233	76.30	gold quality
left adrenal gland cortex	UBERON:0035825	76.29	gold quality
bone marrow	UBERON:0002371	75.97	gold quality
ventricular zone	UBERON:0003053	75.97	gold quality
calcaneal tendon	UBERON:0003701	75.68	gold quality
muscle tissue	UBERON:0002385	75.67	gold quality
frontal cortex	UBERON:0001870	75.62	gold quality
Brodmann (1909) area 9	UBERON:0013540	75.54	gold quality
cortical plate	UBERON:0005343	75.48	gold quality
adenohypophysis	UBERON:0002196	75.44	gold quality
dorsolateral prefrontal cortex	UBERON:0009834	75.42	gold quality
cerebral cortex	UBERON:0000956	75.31	gold quality

Single-cell (SCXA)

Detected in 1 experiment(s), a significant marker in 0.

Experiment	Marker?	Max mean expression
E-ANND-3	no	0.23

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

68 targeting NSMCE3, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-8485	100.00	77.57	4731
HSA-MIR-190A-3P	100.00	80.35	5520
HSA-MIR-200B-3P	100.00	73.31	2693
HSA-MIR-200C-3P	100.00	73.35	2685
HSA-MIR-429	100.00	73.44	2698
HSA-MIR-4775	99.98	75.00	6394
HSA-MIR-4803	99.98	71.99	3117
HSA-MIR-548P	99.98	72.25	3784
HSA-MIR-590-3P	99.96	74.34	6478
HSA-MIR-548AJ-3P	99.96	73.38	5345
HSA-MIR-548X-3P	99.96	73.38	5345
HSA-MIR-302E	99.96	70.74	2669
HSA-MIR-551B-5P	99.96	71.28	3493
HSA-MIR-144-3P	99.94	73.98	2698
HSA-MIR-548J-3P	99.94	72.61	4881
HSA-MIR-101-3P	99.94	75.03	2230
HSA-MIR-548AE-3P	99.93	72.66	4867
HSA-MIR-548AH-3P	99.93	72.54	4872
HSA-MIR-548AM-3P	99.93	72.54	4872
HSA-MIR-548AQ-3P	99.93	72.66	4867
HSA-MIR-497-5P	99.92	71.83	2674
HSA-MIR-15A-5P	99.90	72.80	2787
HSA-MIR-15B-5P	99.90	72.78	2798
HSA-MIR-16-5P	99.90	72.80	2780
HSA-MIR-195-5P	99.90	72.81	2805
HSA-MIR-302A-3P	99.89	71.23	1777
HSA-MIR-302B-3P	99.89	71.23	1777
HSA-MIR-302C-3P	99.89	71.20	1778
HSA-MIR-302D-3P	99.89	71.25	1777
HSA-MIR-424-5P	99.89	71.90	2641

Functional genomics

DepMap (CRISPR cell-line fitness): dependent in 90.7% of screened cell lines, common-essential.

Literature-anchored findings (GeneRIF, showing 3)

• gene expression, imprinting, and chromosome mapping of NDNL2 (PMID:11782285)
• The four non-SMC components of the human complex were identified and characterized and it was demonstrated that the MAGEG1 protein is part of this complex. (PMID:18086888)
• NSMCE3 (also known as NDNL2) gene encodes a subunit of the SMC5/6 complex that is essential for DNA damage response and chromosome segregation (PMID:27427983)

Cross-species orthologs

2 orthologs

Organism	Symbol	Gene ID
mus_musculus	Nscme3l	ENSMUSG00000100937
rattus_norvegicus	Mageb10	ENSRNOG00000055506

Paralogs (37): MAGEC2 (ENSG00000046774), TRO (ENSG00000067445), MAGEB2 (ENSG00000099399), MAGED2 (ENSG00000102316), MAGEB4 (ENSG00000120289), MAGEA9 (ENSG00000123584), MAGEA10 (ENSG00000124260), MAGEA4 (ENSG00000147381), MAGED4 (ENSG00000154545), MAGEC1 (ENSG00000155495), MAGEA8 (ENSG00000156009), MAGEC3 (ENSG00000165509), MAGEB6 (ENSG00000176746), MAGEB18 (ENSG00000176774), MAGEF1 (ENSG00000177383), MAGEB10 (ENSG00000177689), MAGED1 (ENSG00000179222), NDN (ENSG00000182636), MAGEB17 (ENSG00000182798), MAGEA2B (ENSG00000183305), MAGEA11 (ENSG00000185247), MAGEE2 (ENSG00000186675), MAGED4B (ENSG00000187243), MAGEH1 (ENSG00000187601), MAGEB5 (ENSG00000188408), MAGEB16 (ENSG00000189023), MAGEA6 (ENSG00000197172), MAGEA1 (ENSG00000198681), MAGEB3 (ENSG00000198798), MAGEE1 (ENSG00000198934), MAGEA12 (ENSG00000213401), MAGEB1 (ENSG00000214107), MAGEA3 (ENSG00000221867), MAGEB6B (ENSG00000232030), MAGEL2 (ENSG00000254585), MAGEA9B (ENSG00000267978), MAGEA2 (ENSG00000268606)

Protein

Protein identifiers

Non-structural maintenance of chromosomes element 3 homolog — Q96MG7 (reviewed: Q96MG7)

Alternative names: Hepatocellular carcinoma-associated protein 4, MAGE-G1 antigen, Melanoma-associated antigen G1, Necdin-like protein 2

All UniProt accessions (1): Q96MG7

UniProt curated annotations — full annotation on UniProt →

Function. Component of the SMC5-SMC6 complex, a complex involved in repair of DNA double-strand breaks by homologous recombination. The complex may promote sister chromatid homologous recombination by recruiting the SMC1-SMC3 cohesin complex to double-strand breaks. The complex is required for telomere maintenance via recombination in ALT (alternative lengthening of telomeres) cell lines and mediates sumoylation of shelterin complex (telosome) components which is proposed to lead to shelterin complex disassembly in ALT-associated PML bodies (APBs). In vitro enhances ubiquitin ligase activity of NSMCE1. Proposed to act through recruitment and/or stabilization of the Ubl-conjugating enzyme (E2) at the E3:substrate complex. May be a growth suppressor that facilitates the entry of the cell into cell cycle arrest.

Subunit / interactions. Component of the SMC5-SMC6 complex which consists at least of SMC5, SMC6, NSMCE2, NSMCE1, NSMCE4A or EID3 and NSMCE3. NSMCE1, NSMCE4A or EID3 and NSMCE3 probably form a subcomplex that bridges the head domains of the SMC5:SMC6 heterodimer. Interacts with PJA1. Interacts with E2F1 (via C-terminus). Interacts with NGFR (via C-terminus). Interacts with NSMCE1. Interacts with NSMCE4. Interacts with SMC6. Interacts with EID3.

Subcellular location. Cytoplasm. Nucleus. Chromosome. Telomere.

Tissue specificity. Ubiquitous.

Disease relevance. Lung disease, immunodeficiency, and chromosome breakage syndrome (LICS) [MIM:617241] An autosomal recessive chromosome breakage syndrome associated with severe, fatal lung disease in early childhood, following viral pneumonia. LICS is characterized by combined T and B-cell immunodeficiency. Some patients may have mild dysmorphic features. The disease is caused by variants affecting the gene represented in this entry.

RefSeq proteins (1): NP_619649* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR002190	MHD_dom	Domain
IPR037445	MAGE	Family
IPR041898	MAGE_WH1	Homologous_superfamily
IPR041899	MAGE_WH2	Homologous_superfamily

Pfam: PF01454

UniProt features (35 total): helix 10, mutagenesis site 6, strand 5, region of interest 3, modified residue 3, sequence variant 2, turn 2, compositionally biased region 2, chain 1, domain 1

Structure

Experimental structures (PDB)

5 structures.

PDB	Method	Resolution (Å)
5WY5	X-RAY DIFFRACTION	2.92
5HVQ	X-RAY DIFFRACTION	2.92
9LWI	ELECTRON MICROSCOPY	3.12
9LWJ	ELECTRON MICROSCOPY	7.19
9LWL	ELECTRON MICROSCOPY	7.25

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q96MG7-F1	76.08	0.45

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Post-translational modifications (3): 57, 60, 64

Mutagenesis-validated functional residues (6):

Position	Phenotype
96–97	decreases interaction with nsmce1, no effect on interaction with nsmce4a, abolishes in vitro promotion of nsmce1 ubiquit
180	abolishes interaction with eid3.
181	abolishes interaction with eid3.
185	abolishes interaction with eid3.
266	abolishes interaction with eid3.
270	abolishes interaction with eid3.

Function

Pathways and Gene Ontology

Reactome pathways

1 pathways

ID	Pathway
R-HSA-3108214	SUMOylation of DNA damage response and repair proteins

MSigDB gene sets: 215 (showing top): GOBP_CHROMOSOME_ORGANIZATION, GOBP_RESPONSE_TO_NITROGEN_COMPOUND, GOBP_CELLULAR_RESPONSE_TO_UV, GOBP_CELLULAR_RESPONSE_TO_LIGHT_STIMULUS, chr15q13, GOBP_TELOMERE_ORGANIZATION, GOBP_REGULATION_OF_TELOMERE_MAINTENANCE, GOBP_PEPTIDYL_LYSINE_MODIFICATION, WTGAAAT_UNKNOWN, SCHAEFFER_PROSTATE_DEVELOPMENT_48HR_UP, GOBP_PROTEIN_SUMOYLATION, GOBP_RESPONSE_TO_UV, GOBP_DNA_DAMAGE_RESPONSE, GOBP_RESPONSE_TO_RADIATION, GOBP_POST_TRANSLATIONAL_PROTEIN_MODIFICATION

GO Biological Process (14): negative regulation of transcription by RNA polymerase II (GO:0000122), double-strand break repair via homologous recombination (GO:0000724), DNA repair (GO:0006281), protein sumoylation (GO:0016925), positive regulation of protein ubiquitination (GO:0031398), regulation of telomere maintenance (GO:0032204), cellular response to UV (GO:0034644), cellular response to radiation (GO:0071478), cellular response to hydroxyurea (GO:0072711), chromatin looping (GO:0140588), DNA recombination (GO:0006310), DNA damage response (GO:0006974), regulation of macromolecule metabolic process (GO:0060255), regulation of primary metabolic process (GO:0080090)

GO Molecular Function (2): protein dimerization activity (GO:0046983), protein binding (GO:0005515)

GO Cellular Component (6): chromosome, telomeric region (GO:0000781), nucleus (GO:0005634), nucleoplasm (GO:0005654), cytoplasm (GO:0005737), Smc5-Smc6 complex (GO:0030915), chromosome (GO:0005694)

Reactome top-level categories

Rollup of top-1 pathways:

Category	Pathways
SUMO E3 ligases SUMOylate target proteins	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
DNA metabolic process	2
regulation of metabolic process	2
cellular anatomical structure	2
regulation of transcription by RNA polymerase II	1
transcription by RNA polymerase II	1
negative regulation of DNA-templated transcription	1
recombinational repair	1
double-strand break repair	1
DNA damage response	1
peptidyl-lysine modification	1
protein modification by small protein conjugation	1
protein ubiquitination	1
regulation of protein ubiquitination	1
positive regulation of protein modification by small protein conjugation or removal	1
telomere maintenance	1
regulation of chromosome organization	1
regulation of DNA metabolic process	1
response to UV	1
cellular response to light stimulus	1
response to radiation	1
cellular response to abiotic stimulus	1
response to hydroxyurea	1
cellular response to nitrogen compound	1
chromatin organization	1
cellular response to stress	1
macromolecule metabolic process	1
primary metabolic process	1
protein binding	1
binding	1
chromosomal region	1
intracellular membrane-bounded organelle	1
nuclear lumen	1
intracellular anatomical structure	1
condensed chromosome	1
SUMO ligase complex	1
intracellular membraneless organelle	1

Protein interactions and networks

STRING

818 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
NSMCE3	SMC6	Q96SB8	994
NSMCE3	SMC5	Q8IY18	978
NSMCE3	NSMCE2	Q96MF7	926
NSMCE3	NSMCE4A	Q9NXX6	834
NSMCE3	CSAG1	Q6PB30	815
NSMCE3	RAD21	O60216	775
NSMCE3	NPAS4	Q8IUM7	771
NSMCE3	APBA2	Q99767	743
NSMCE3	NSMCE1	Q8WV22	673
NSMCE3	EID3	Q8N140	630
NSMCE3	ENO2	P09104	623
NSMCE3	EID2B	Q96D98	554
NSMCE3	SLF2	Q8IX21	512
NSMCE3	SLF1	Q9BQI6	465
NSMCE3	MAGEA3	P43357	438

IntAct

66 interactions, top by confidence:

A	B	Type	Score
NSMCE3	NSMCE1	psi-mi:“MI:0915”(physical association)	0.970
NSMCE3	NSMCE1	psi-mi:“MI:0407”(direct interaction)	0.970
NSMCE1	NSMCE3	psi-mi:“MI:0407”(direct interaction)	0.970
NSMCE3	NSMCE1	psi-mi:“MI:0914”(association)	0.970
NSMCE1	NSMCE3	psi-mi:“MI:0915”(physical association)	0.970
NSMCE1	NSMCE3	psi-mi:“MI:0403”(colocalization)	0.970
PSMC3	PSMD9	psi-mi:“MI:0914”(association)	0.940
SMC6	SMC5	psi-mi:“MI:0914”(association)	0.860
EID3	NSMCE1	psi-mi:“MI:0915”(physical association)	0.830
NSMCE4A	NSMCE3	psi-mi:“MI:0915”(physical association)	0.820
NSMCE3	EID3	psi-mi:“MI:0915”(physical association)	0.820
EID3	NSMCE3	psi-mi:“MI:0915”(physical association)	0.820
NSMCE3	EID3	psi-mi:“MI:0914”(association)	0.820
NSMCE3	NSMCE4A	psi-mi:“MI:0915”(physical association)	0.820
SMC6	NSMCE3	psi-mi:“MI:0915”(physical association)	0.770
NSMCE1	SMC5	psi-mi:“MI:0914”(association)	0.760
NSMCE1	SMC5	psi-mi:“MI:0915”(physical association)	0.760
EID3	SMC5	psi-mi:“MI:0915”(physical association)	0.740

BioGRID (109): NDNL2 (Affinity Capture-MS), NDNL2 (Affinity Capture-MS), NDNL2 (Affinity Capture-MS), NDNL2 (Affinity Capture-MS), NDNL2 (Affinity Capture-MS), NDNL2 (Co-fractionation), NDNL2 (Co-fractionation), SMC5 (Co-fractionation), SMC6 (Co-fractionation), NDNL2 (Affinity Capture-MS), NSMCE1 (Co-crystal Structure), NDNL2 (Affinity Capture-MS), NDNL2 (Affinity Capture-MS), NDNL2 (Affinity Capture-MS), NDNL2 (Affinity Capture-MS)

ESM2 similar proteins: A2AWP8, A4FUF0, A4Q9F4, A5PJM7, D4ABL6, O43189, O94888, O95267, P21580, Q29RM4, Q49A26, Q4R8W3, Q4V8I4, Q5BIM1, Q5R448, Q5R5M3, Q5R7T2, Q5REY7, Q5RKH0, Q5T6S3, Q5TAQ9, Q5U2M6, Q5XI70, Q5ZLS7, Q60769, Q6DDJ3, Q6DJB3, Q6GR08, Q6RFZ7, Q6ZN54, Q6ZPY2, Q7Z6G3, Q80US4, Q86W50, Q8CIW5, Q8N7N5, Q8NHH1, Q8TBP0, Q922P9, Q96MG7

Diamond homologs: A0A0J9YX57, A1A5P9, A2A368, A2A9R3, A6NCF6, A6QLI5, A8MXT2, O15479, O15480, O15481, O60732, P25233, P43355, P43356, P43357, P43358, P43360, P43361, P43362, P43363, P43364, P43365, P43366, Q12816, Q4R998, Q5PPP4, Q5RFC2, Q6AY37, Q6ITT4, Q6PCZ4, Q8BQR7, Q8N7X4, Q8TD90, Q8TD91, Q96JG8, Q96LZ2, Q96M61, Q96MG7, Q99608, Q9BE18

SIGNOR signaling

2 interactions.

A	Effect	B	Mechanism
NSMCE3	“form complex”	SMC5/6	binding
NSMCE3	“up-regulates activity”	NSMCE1	binding

Enriched among interaction partners

Reactome pathways and GO biological processes over-represented among this gene’s 43 IntAct physical interaction partners (hypergeometric vs the genome-wide background, BH-FDR, gene-set size 15–500, ranked by fold). A functional readout of the neighbourhood — distinct from this gene’s own memberships above, and biased toward well-studied / hub proteins, so read it as themes rather than proof.

Reactome pathways:

Pathway	Partners	Fold	FDR
SUMOylation of DNA damage response and repair proteins	7	35.3×	2e-07

GO biological processes:

GO term	Partners	Fold	FDR
regulation of telomere maintenance	6	140.4×	3e-10
protein sumoylation	6	54.0×	7e-08
double-strand break repair via homologous recombination	8	34.7×	5e-09
DNA damage response	8	11.9×	1e-05

Disease & clinical

Clinical variants and AI predictions

ClinVar

16 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	2
Likely pathogenic	0
Uncertain significance	5
Likely benign	9
Benign	0

Top pathogenic / likely-pathogenic (2)

Variant ID	HGVS	Classification
2672599	GRCh37/hg19 15q13.1-13.3(chr15:29488634-31342785)x1	Pathogenic
625271	Single allele	Pathogenic

SpliceAI

108 predictions. Top by Δscore:

Variant	Effect	Δscore
15:29268922:T:A	donor_gain	0.9000
15:29268784:C:CT	donor_gain	0.8600
15:29268785:C:CT	donor_gain	0.8500
15:29268913:TAAGA:T	donor_gain	0.8400
15:29268914:AAGAA:A	donor_gain	0.8400
15:29268783:T:C	donor_gain	0.8200
15:29268755:AGAC:A	donor_gain	0.7700
15:29268477:A:AC	donor_gain	0.7400
15:29268478:C:CC	donor_gain	0.7400
15:29268858:CAGTA:C	donor_gain	0.6000
15:29268843:T:C	donor_gain	0.5600
15:29268914:A:AC	donor_gain	0.5600
15:29269122:T:A	donor_gain	0.5500
15:29265638:T:TG	acceptor_gain	0.5200
15:29268863:CTGCG:C	donor_gain	0.4600
15:29269190:G:A	donor_gain	0.4600
15:29265639:C:G	acceptor_gain	0.4500
15:29268876:T:TA	donor_gain	0.4400
15:29268862:A:AC	donor_gain	0.4300
15:29268863:C:CC	donor_gain	0.4300
15:29268910:A:AC	donor_gain	0.4300
15:29268911:C:CC	donor_gain	0.4300
15:29269320:C:CT	acceptor_gain	0.4200
15:29265639:C:CT	acceptor_gain	0.4100
15:29269232:CAGGG:C	acceptor_gain	0.4100
15:29265640:A:T	acceptor_gain	0.3900
15:29268702:C:CA	donor_gain	0.3900
15:29269072:T:TA	donor_gain	0.3700
15:29269320:C:T	acceptor_gain	0.3700
15:29268737:A:C	donor_gain	0.3500

AlphaMissense

1983 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
15:29269292:G:C	F138L	0.999
15:29269292:G:T	F138L	0.999
15:29269294:A:G	F138L	0.999
15:29268915:A:G	L264P	0.998
15:29268915:A:T	L264H	0.998
15:29268958:A:G	W250R	0.998
15:29268958:A:T	W250R	0.998
15:29269290:C:T	G139E	0.998
15:29268903:G:T	A268D	0.997
15:29268908:A:C	F266L	0.997
15:29268908:A:T	F266L	0.997
15:29268910:A:G	F266L	0.997
15:29268926:C:A	K260N	0.997
15:29268926:C:G	K260N	0.997
15:29268955:C:G	G251R	0.997
15:29269155:C:T	G184E	0.997
15:29268872:C:A	W278C	0.996
15:29268872:C:G	W278C	0.996
15:29268874:A:G	W278R	0.996
15:29268874:A:T	W278R	0.996
15:29268904:C:G	A268P	0.996
15:29268956:C:A	W250C	0.996
15:29268956:C:G	W250C	0.996
15:29269156:C:G	G184R	0.996
15:29269156:C:T	G184R	0.996
15:29269431:A:G	L92P	0.996
15:29268948:C:G	R253P	0.995
15:29268954:C:T	G251D	0.995
15:29269058:G:C	F216L	0.995
15:29269058:G:T	F216L	0.995

dbSNP variants (sampled 300 via entrez): RS1000691089 (15:29268185 C>A,T), RS1000806596 (15:29267929 C>T), RS1001059176 (15:29269628 G>A), RS1001202139 (15:29269955 G>A,C,T), RS1001551060 (15:29267509 G>A,C,T), RS1001585702 (15:29271579 GACATTGTATAGAAGA>G,GACATTGTATAGAAGAACATTGTATAGAAGA), RS1002000851 (15:29267264 G>A), RS1002703425 (15:29270218 G>C), RS1002818548 (15:29269927 G>C), RS1003153342 (15:29267196 G>A,C), RS1003224733 (15:29266267 C>T), RS1003431578 (15:29265472 C>G), RS1003510477 (15:29266897 A>G), RS1003546922 (15:29271612 G>A), RS1003662995 (15:29271355 A>G)

Disease associations

OMIM: gene MIM:608243 | disease phenotypes:

GenCC curated gene-disease

Disease	Classification	Inheritance
lung disease, immunodeficiency, and chromosome breakage syndrome;	Moderate	Autosomal recessive

ClinGen Gene-Disease Validity (1)

Expert-panel classifications — Definitive > Strong > Moderate > Limited > Disputed > Refuted.

Disease	Classification	Inheritance
lung disease, immunodeficiency, and chromosome breakage syndrome;	Limited	AR

Mondo (2): intellectual disability (MONDO:0001071), lung disease, immunodeficiency, and chromosome breakage syndrome; (MONDO:0014984)

Orphanet (1): NON RARE IN EUROPE: Unexplained intellectual disability (Orphanet:319658)

HPO phenotypes

21 total (21 of 21 shown, HPO-id order):

HPO	Term
HP:0000007	Autosomal recessive inheritance
HP:0000260	Wide anterior fontanel
HP:0000316	Hypertelorism
HP:0000778	Hypoplasia of the thymus
HP:0000964	Eczematoid dermatitis
HP:0001518	Small for gestational age
HP:0001531	Failure to thrive in infancy
HP:0002514	Cerebral calcification
HP:0002972	Reduced delayed hypersensitivity
HP:0003212	Increased circulating IgE concentration
HP:0003496	Increased circulating IgM level
HP:0005280	Depressed nasal bridge
HP:0005415	Decreased CD8+ T cell proportion
HP:0008936	Axial hypotonia
HP:0011133	Increased sensitivity to ionizing radiation
HP:0011342	Mild global developmental delay
HP:0011800	Midface retrusion
HP:0011946	Bronchiolitis obliterans
HP:0011968	Feeding difficulties
HP:0031402	Reduced antigen-specific T cell proliferation
HP:0032218	Decreased CD4+ T cell proportion

GWAS associations

0 associations (top):

MeSH disease descriptors (1)

Descriptor	Name	Tree numbers
D008607	Intellectual Disability	C10.597.606.360; C23.888.592.604.646; F01.700.687; F03.625.539

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

14 total (human), top 14 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
aristolochic acid I	increases expression	1
TAK-243	increases sumoylation	1
di-n-butylphosphoric acid	affects expression	1
Sunitinib	increases expression	1
Air Pollutants	decreases expression, increases abundance	1
Arsenic	affects methylation	1
Dietary Carbohydrates	increases expression	1
Enzyme Inhibitors	decreases activity, increases O-linked glycosylation	1
Rotenone	increases expression	1
Smoke	decreases expression	1
Cyclosporine	decreases expression	1
Sodium Selenite	increases expression	1
Cadmium Chloride	decreases expression	1
Particulate Matter	decreases expression, increases abundance	1

Clinical trials (associated diseases)

197 trials via MONDO — disease-level, not drug-specific.

Trial	Phase	Status	Title
NCT05657860	PHASE4	COMPLETED	Guanfacine Extended Release for the Reduction of Aggression and Self-injurious Behavior Associated With Prader-Willi Syndrome
NCT05744479	PHASE4	RECRUITING	Metformin for Antipsychotic-induced Weight Gain in Adults With Intellectual Disability
NCT06107829	PHASE4	WITHDRAWN	Valbenazine Treatment of Tardive Dyskinesia in Adults With Intellectual/Developmental Disabilities
NCT06997198	PHASE4	NOT_YET_RECRUITING	Deutetrabenazine Treatment for Tardive Dyskinesia in Intellectual/Developmental Disabilities
NCT02270736	PHASE3	COMPLETED	Clinical Study to Investigate the Efficacy and Safety of NT 201 Compared to Placebo in the Treatment of Chronic Troublesome Drooling Associated With Neurological Disorders and/or Intellectual Disability
NCT02304302	PHASE2	COMPLETED	Down Syndrome Memantine Follow-up Study
NCT03862950	PHASE2	COMPLETED	A Trial of Metformin in Individuals With Fragile X Syndrome (Met)
NCT04529226	PHASE2	UNKNOWN	Study to Compare Clozapine vs Treatment as Usual in People With Intellectual Disability & Treatment-resistant Psychosis
NCT04821856	PHASE2	COMPLETED	Evaluation of the Effectiveness of Cannabidiol in Treating Severe Behavioural Problems in Children and Adolescents With Intellectual Disability
NCT05273320	PHASE1	COMPLETED	Clinical Trial of Nabilone for Aggression in Adults With Intellectual and Developmental Disabilities
NCT05301361	PHASE1	ENROLLING_BY_INVITATION	Sensitivity of the NIH Toolbox to Stimulant Treatment in Intellectual Disabilities
NCT06016764	PHASE1	COMPLETED	Use of MRI and cTBS for Catatonia in Autism
NCT06586827	PHASE1	COMPLETED	Impact of Competency-Based Training and Technical Assistance Employment Outcomes of Individuals With ID/DD
NCT07531940	PHASE1	NOT_YET_RECRUITING	Escalating Doses of Memantine in Down Syndrome (MEDS-123)
NCT03479476	PHASE2/PHASE3	COMPLETED	A Trial of Metformin in Individuals With Fragile X Syndrome
NCT02616796	PHASE1/PHASE2	COMPLETED	Effects of Social Gaze Training on Brain and Behavior in Fragile X Syndrome
NCT06860672	EARLY_PHASE1	RECRUITING	Clinical Trial of the Dual Vector Base Editor for the Treatment of the CHD3-R1025W Mutation
NCT00597948	Not specified	COMPLETED	Healthy Lifestyles for People With Intellectual Disabilities
NCT01087320	Not specified	RECRUITING	Genome Medical Sequencing for Gene Discovery
NCT01652963	Not specified	UNKNOWN	Picture-based Computerised Assessment and Training of Cognitive Behaviour Therapy Skills
NCT01695395	Not specified	COMPLETED	Mental Health Care Provision for Adults With Intellectual Disability and a Mental Disorder
NCT01867554	Not specified	COMPLETED	Research and Characterization of New Genes Involved in Intellectual Disability
NCT01915381	Not specified	COMPLETED	Improving Adherence Healthy Lifestyle With a Smartphone Application Based on Adults With Intellectual Disabilities
NCT01988623	Not specified	COMPLETED	Pivotal Response Treatment for Individuals With Intellectual Disabilities
NCT02099773	Not specified	COMPLETED	Support Staff-client Interactions With Augmentative and Alternative Communication
NCT02136849	Not specified	COMPLETED	Inter-regional Project of the Great Western Exploration Approach for Exome Molecular Causes Severe Intellectual Disability Isolated or Syndromic
NCT02225041	Not specified	COMPLETED	Sedation Strategy and Cognitive Outcome After Critical Illness in Early Childhood
NCT02414438	Not specified	COMPLETED	Establishing the Clinical Utility of First StepDx PLUS and NextStepDx PLUS Study
NCT02451761	Not specified	COMPLETED	Apparently Balanced Chromosomal Translocation/ Next-generation Sequencing/ Intellectual Disability
NCT02461420	Not specified	ACTIVE_NOT_RECRUITING	Mapping the Genotype, Phenotype, and Natural History of Phelan-McDermid Syndrome
NCT02461459	Not specified	ACTIVE_NOT_RECRUITING	Autism Spectrum Disorder (ASD) and Intellectual Disability (ID) Determinants in Tuberous Sclerosis Complex (TSC)
NCT02486081	Not specified	COMPLETED	Development and Application-Smart Football for Movement Evaluation and Training in the Special Education Population
NCT02504502	Not specified	COMPLETED	Enhancing Genomic Laboratory Reports to Enhance Communication and Empower Patients
NCT02513277	Not specified	COMPLETED	Diabetes Screening & Prevention for People With Learning (Intellectual) Disabilities:STOP Diabetes Study
NCT02561754	Not specified	COMPLETED	Weight Management for Adolescents With IDD
NCT02591446	Not specified	COMPLETED	Transcranial Magnetic Stimulation Studies in Autism Spectrum Disorders
NCT02714868	Not specified	COMPLETED	Evaluation of Project TEAM (Teens Making Environmental and Activity Modifications)
NCT02721394	Not specified	UNKNOWN	FCT With Young Children With ID in the UK: A Feasibility Project V.1
NCT02746614	Not specified	COMPLETED	Psychomotor Therapy Effects in Adaptive Behavior and Motor Proficiency in Intellectual Disability
NCT02836405	Not specified	COMPLETED	TMS for the Investigation of Brain Plasticity in Autism Spectrum Disorders