NSUN5

Summary

NSUN5 (NOP2/Sun RNA methyltransferase 5, HGNC:16385) is a protein-coding gene on chromosome 7q11.23, encoding 28S rRNA (cytosine-C(5))-methyltransferase (Q96P11). S-adenosyl-L-methionine-dependent methyltransferase that specifically methylates the C(5) position of cytosine 3782 (m5C3782) in 28S rRNA. m5C3782 promotes protein translation without affecting ribosome biogenesis and fidelity.

This gene encodes a member of an evolutionarily conserved family of proteins that may function as methyltransferases. This gene is located in a larger region of chromosome 7 that is deleted in Williams-Beuren syndrome, a multisystem developmental disorder. There are two pseudogenes for this gene located in the same region of chromosome 7. Alternative splicing results in multiple transcript variants encoding different isoforms.

Source: NCBI Gene 55695 — RefSeq curated summary.

At a glance

• GWAS associations: 1
• Clinical variants (ClinVar): 96 total
• Druggable target: yes
• MANE Select transcript: NM_148956

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:16385
Approved symbol	NSUN5
Name	NOP2/Sun RNA methyltransferase 5
Location	7q11.23
Locus type	gene with protein product
Status	Approved
Aliases	NOL1R, p120(NOL1), FLJ10267, NSUN5A, Ynl022cL
Ensembl gene	ENSG00000130305
Ensembl biotype	protein_coding
OMIM	615732
Entrez	55695

Gene structure

Transcript identifiers

Ensembl transcripts: 14 — 11 protein_coding, 2 retained_intron, 1 nonsense_mediated_decay

ENST00000252594, ENST00000310326, ENST00000428206, ENST00000438747, ENST00000455763, ENST00000471461, ENST00000478977, ENST00000856074, ENST00000933355, ENST00000933356, ENST00000933357, ENST00000933358, ENST00000951094, ENST00000951095

RefSeq mRNA: 4 — MANE Select: NM_148956 NM_001168347, NM_001168348, NM_018044, NM_148956

CCDS: CCDS55118, CCDS55119, CCDS5546, CCDS5547

Canonical transcript exons

ENST00000438747 — 10 exons

Exon	Start	End
ENSE00000689434	73307583	73307757
ENSE00001486089	73302516	73303529
ENSE00001869419	73308698	73308826
ENSE00002430652	73304230	73304408
ENSE00003543493	73303600	73303740
ENSE00003564366	73304747	73304862
ENSE00003576176	73308431	73308553
ENSE00003617018	73304959	73305097
ENSE00003621571	73307394	73307502
ENSE00003647683	73303826	73304036

Expression profiles

Bgee: expression breadth ubiquitous, 142 present calls, max score 90.60.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 7.8443 / max 64.1790, expressed in 1700 samples.

FANTOM5 promoters (2 alternative TSS)

Promoter ID	TPM avg	Samples expressed
84283	7.3462	1677
204476	0.4981	278

Top tissues by expression

142 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
granulocyte	CL:0000094	90.60	gold quality
blood	UBERON:0000178	90.23	gold quality
mucosa of transverse colon	UBERON:0004991	89.78	gold quality
gastrocnemius	UBERON:0001388	89.66	gold quality
bone element	UBERON:0001474	89.53	gold quality
bone marrow	UBERON:0002371	89.53	gold quality
muscle of leg	UBERON:0001383	89.02	gold quality
skeletal muscle organ	UBERON:0014892	88.96	gold quality
spleen	UBERON:0002106	88.76	gold quality
hindlimb stylopod muscle	UBERON:0004252	88.61	gold quality
apex of heart	UBERON:0002098	88.45	gold quality
primordial germ cell in gonad	CL:0000670 ∩ UBERON:0000991	88.21	gold quality
bone marrow cell	CL:0002092	87.88	gold quality
skeletal muscle tissue	UBERON:0001134	87.32	gold quality
lymph node	UBERON:0000029	87.26	gold quality
body of pancreas	UBERON:0001150	87.20	gold quality
right uterine tube	UBERON:0001302	86.96	gold quality
leukocyte	CL:0000738	86.44	gold quality
monocyte	CL:0000576	86.41	gold quality
small intestine Peyer’s patch	UBERON:0003454	86.28	gold quality
muscle layer of sigmoid colon	UBERON:0035805	86.25	gold quality
fundus of stomach	UBERON:0001160	86.19	gold quality
right hemisphere of cerebellum	UBERON:0014890	86.08	gold quality
lower esophagus muscularis layer	UBERON:0035833	85.87	gold quality
lower esophagus	UBERON:0013473	85.86	gold quality
muscle tissue	UBERON:0002385	85.78	gold quality
transverse colon	UBERON:0001157	85.77	gold quality
body of stomach	UBERON:0001161	85.73	gold quality
small intestine	UBERON:0002108	85.59	gold quality
cerebellar hemisphere	UBERON:0002245	85.52	gold quality

Single-cell (SCXA)

Detected in 4 experiment(s), a significant marker in 2.

Experiment	Marker?	Max mean expression
E-MTAB-9801	yes	7.71
E-ANND-3	yes	5.81
E-MTAB-3929	no	403.57
E-CURD-10	no	121.63

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

39 targeting NSUN5, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-574-5P	100.00	66.01	989
HSA-MIR-5692A	100.00	74.40	6850
HSA-MIR-4282	99.99	75.36	6408
HSA-MIR-19A-3P	99.98	75.33	2762
HSA-MIR-19B-3P	99.98	75.44	2754
HSA-MIR-6783-3P	99.89	67.92	2059
HSA-MIR-3065-3P	99.87	70.25	1407
HSA-MIR-6756-5P	99.82	67.97	2466
HSA-MIR-4319	99.76	69.83	2586
HSA-MIR-1976	99.74	65.48	1127
HSA-MIR-6766-5P	99.68	67.70	2325
HSA-MIR-3202	99.66	67.70	2737
HSA-MIR-6134	99.63	65.68	1537
HSA-MIR-1260A	99.61	66.67	1098
HSA-MIR-1260B	99.61	66.67	1098
HSA-MIR-885-5P	99.59	68.59	879
HSA-MIR-516A-3P	99.46	67.96	1378
HSA-MIR-516B-3P	99.46	67.96	1378
HSA-MIR-20A-3P	99.44	69.10	1575
HSA-MIR-6507-5P	99.36	70.46	2524
HSA-MIR-4999-5P	99.35	69.15	926
HSA-MIR-8066	99.05	68.66	1532
HSA-MIR-4764-5P	98.88	65.53	894
HSA-MIR-3190-5P	98.87	64.89	1345
HSA-MIR-4716-5P	98.82	68.57	1168
HSA-MIR-876-3P	98.76	68.23	945
HSA-MIR-6811-3P	98.62	66.54	944
HSA-MIR-3944-5P	98.50	67.55	997
HSA-MIR-6804-5P	98.39	65.77	1084
HSA-MIR-1914-5P	97.83	66.21	807

Literature-anchored findings (GeneRIF, showing 10)

• Characterization of two novel genes, WBSCR20 and WBSCR22, deleted in Williams-Beuren syndrome (PMID:11978965)
• Epigenetic loss of RNA-methyltransferase NSUN5 in glioma targets ribosomes to drive a stress adaptive translational program. (PMID:31428936)
• Phenotypic consequences of NSUN5 deficiency in mammalian cells include decreased proliferation and size, which can be attributed to a reduction in total protein synthesis by altered ribosomes. (PMID:31722427)
• NSUN5 Facilitates Viral RNA Recognition by RIG-I Receptor. (PMID:33177158)
• RNA cytosine methyltransferase NSUN5 promotes protein synthesis and tumorigenic phenotypes in glioblastoma. (PMID:37057706)
• NSUN5-FTH1 Axis Inhibits Ferroptosis to Promote the Growth of Gastric Cancer Cells. (PMID:37528314)
• CDK13 promotes lipid deposition and prostate cancer progression by stimulating NSUN5-mediated m5C modification of ACC1 mRNA. (PMID:37845385)
• RNA 5-methylcytosine writer NSUN5 promotes hepatocellular carcinoma cell proliferation via a ZBED3-dependent mechanism. (PMID:38182896)
• The downregulation of NSUN5 may contribute to preeclampsiadagger. (PMID:38924712)
• NSUN5 promotes tumorigenic phenotypes through the WNT signaling pathway and immunosuppression of CD8+ T cells in gastric cancer. (PMID:39428025)

Cross-species orthologs

5 orthologs

Organism	Symbol	Gene ID
danio_rerio	nsun5	ENSDARG00000043209
mus_musculus	Nsun5	ENSMUSG00000000916
rattus_norvegicus	Nsun5	ENSRNOG00000001450
drosophila_melanogaster	Nsun5	FBGN0259704
caenorhabditis_elegans		WBGENE00013151

Paralogs (2): NOP2 (ENSG00000111641), NSUN6 (ENSG00000241058)

Protein

Protein identifiers

28S rRNA (cytosine-C(5))-methyltransferase — Q96P11 (reviewed: Q96P11)

Alternative names: NOL1-related protein, NOL1/NOP2/Sun domain family member 5, Williams-Beuren syndrome chromosomal region 20A protein

All UniProt accessions (2): Q96P11, H7C2G6

UniProt curated annotations — full annotation on UniProt →

Function. S-adenosyl-L-methionine-dependent methyltransferase that specifically methylates the C(5) position of cytosine 3782 (m5C3782) in 28S rRNA. m5C3782 promotes protein translation without affecting ribosome biogenesis and fidelity. Required for corpus callosum and cerebral cortex development.

Subcellular location. Nucleus. Nucleolus.

Tissue specificity. Ubiquitous. Detected in placenta, heart and skeletal muscle.

Disease relevance. NSUN5 is located in the Williams-Beuren syndrome (WBS) critical region. WBS results from a hemizygous deletion of several genes on chromosome 7q11.23, thought to arise as a consequence of unequal crossing over between highly homologous low-copy repeat sequences flanking the deleted region. Its deletion in WBS results in decreased methylation of the C(5) position of cytosine 3782 (m5C3782) in 28S rRNA.

Induction. Down-regulated in some glioma; epigenetic inactivation is a hallmark of glioma patients with long-term survival.

Similarity. Belongs to the class I-like SAM-binding methyltransferase superfamily. RsmB/NOP family.

Isoforms (5)

UniProt ID	Names	Canonical?
Q96P11-1	1	yes
Q96P11-2	2
Q96P11-3	3
Q96P11-4	4
Q96P11-5	5

RefSeq proteins (4): NP_001161819, NP_001161820, NP_060514, NP_683759* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR001678	MeTrfase_RsmB-F_NOP2_dom	Domain
IPR023267	RCMT	Family
IPR029063	SAM-dependent_MTases_sf	Homologous_superfamily
IPR048889	NSUN5_RCM1_N	Domain
IPR049560	MeTrfase_RsmB-F_NOP2_cat	Domain
IPR049561	NSUN5_7_fdxn-like	Domain

Pfam: PF01189, PF21148, PF21153

Catalyzed reactions (Rhea), 1 shown:

• cytidine(3782) in 28S rRNA + S-adenosyl-L-methionine = 5-methylcytidine(3782) in 28S rRNA + S-adenosyl-L-homocysteine + H(+) (RHEA:47784)

UniProt features (53 total): strand 15, helix 14, splice variant 7, binding site 4, sequence conflict 3, mutagenesis site 2, turn 2, modified residue 2, initiator methionine 1, chain 1, sequence variant 1, active site 1

Structure

Experimental structures (PDB)

1 structures.

PDB	Method	Resolution (Å)
2B9E	X-RAY DIFFRACTION	1.65

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q96P11-F1	91.77	0.76

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Catalytic / active sites (1): 359 (nucleophile)

Ligand- & substrate-binding residues (4): 234–240; 258; 263; 305

Post-translational modifications (2): 2, 167

Mutagenesis-validated functional residues (2):

Position	Phenotype
308	abolished methyltransferase activity without affecting nucleolar localization; when associated with s-359.
359	abolished methyltransferase activity without affecting nucleolar localization; when associated with s-308.

Function

Pathways and Gene Ontology

Reactome pathways

0 pathways

MSigDB gene sets: 0 (showing top):

GO Biological Process (10): oligodendrocyte development (GO:0014003), cerebral cortex development (GO:0021987), corpus callosum development (GO:0022038), regulation of myelination (GO:0031641), positive regulation of translation (GO:0045727), cognition (GO:0050890), rRNA base methylation (GO:0070475), RNA methylation (GO:0001510), rRNA processing (GO:0006364), methylation (GO:0032259)

GO Molecular Function (5): RNA binding (GO:0003723), rRNA (cytosine-C5-)-methyltransferase activity (GO:0009383), methyltransferase activity (GO:0008168), RNA methyltransferase activity (GO:0008173), transferase activity (GO:0016740)

GO Cellular Component (3): nucleoplasm (GO:0005654), nucleolus (GO:0005730), nucleus (GO:0005634)

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
anatomical structure development	2
nuclear lumen	2
glial cell development	1
oligodendrocyte differentiation	1
pallium development	1
telencephalon development	1
myelination	1
regulation of cellular process	1
regulation of nervous system development	1
translation	1
regulation of translation	1
positive regulation of gene expression	1
positive regulation of protein metabolic process	1
nervous system process	1
rRNA methylation	1
RNA modification	1
macromolecule methylation	1
RNA processing	1
rRNA metabolic process	1
ribosome biogenesis	1
metabolic process	1
nucleic acid binding	1
C-methyltransferase activity	1
rRNA (cytosine) methyltransferase activity	1
transferase activity, transferring one-carbon groups	1
methyltransferase activity	1
catalytic activity, acting on RNA	1
catalytic activity	1
cellular anatomical structure	1
intracellular membraneless organelle	1
intracellular membrane-bounded organelle	1

Protein interactions and networks

STRING

2136 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
NSUN5	NSUN3	Q9H649	920
NSUN5	NSUN4	Q96CB9	909
NSUN5	TRDMT1	O14717	807
NSUN5	TRIM50	Q86XT4	762
NSUN5	GTF2IRD1	Q9UHL9	729
NSUN5	TBL2	Q9Y4P3	722
NSUN5	FKBP6	O75344	708
NSUN5	BUD23	O43709	708
NSUN5	FKBP10	Q96AY3	694
NSUN5	ALYREF	Q86V81	681
NSUN5	EIF4H	Q15056	675
NSUN5	NSUN2	Q08J23	669
NSUN5	BCL7B	Q9BQE9	662
NSUN5	NSUN6	Q8TEA1	646
NSUN5	FBL	P22087	633

IntAct

53 interactions, top by confidence:

A	B	Type	Score
N	RBM47	psi-mi:“MI:0914”(association)	0.530
PSME1	POLR3A	psi-mi:“MI:0914”(association)	0.530
MAGEB2	GTPBP10	psi-mi:“MI:0914”(association)	0.530
ZNRD2	CCDC85C	psi-mi:“MI:0914”(association)	0.530
NSUN5	PTPN11	psi-mi:“MI:0915”(physical association)	0.370
JUN	TPM3	psi-mi:“MI:0914”(association)	0.350
RRP1B	ZNF785	psi-mi:“MI:0914”(association)	0.350
ESR1	ESYT2	psi-mi:“MI:0914”(association)	0.350
rep	TMEM120B	psi-mi:“MI:0914”(association)	0.350
N	RBM47	psi-mi:“MI:0914”(association)	0.350
CASP8	CCN1	psi-mi:“MI:0914”(association)	0.350
FKBP5	IFT56	psi-mi:“MI:0914”(association)	0.350
NCAPH	EIF3CL	psi-mi:“MI:0914”(association)	0.350
ATP2A1	TMEM120B	psi-mi:“MI:0914”(association)	0.350
PIPSL	C1orf226	psi-mi:“MI:0914”(association)	0.350
ZNRD2	KRBA1	psi-mi:“MI:0914”(association)	0.350
PSME3	ZNF891	psi-mi:“MI:0914”(association)	0.350
NSUN5P1	FAM171A2	psi-mi:“MI:0914”(association)	0.350
TSPAN8	TP53I11	psi-mi:“MI:0914”(association)	0.350
HNRNPLL	TBX3	psi-mi:“MI:0914”(association)	0.350
LMNB2	SPOP	psi-mi:“MI:0914”(association)	0.350
ZNF653	URB1	psi-mi:“MI:0914”(association)	0.350
TSPAN8	POTEF	psi-mi:“MI:0914”(association)	0.350
NSUN5P1		psi-mi:“MI:0914”(association)	0.350

BioGRID (77): NSUN5 (Affinity Capture-MS), NSUN5 (Affinity Capture-MS), NSUN5 (Co-fractionation), NSUN5 (Co-fractionation), NSUN5 (Co-fractionation), NSUN5 (Co-fractionation), NSUN5 (Co-fractionation), POLR1C (Co-fractionation), NSUN5 (Affinity Capture-MS), NSUN5 (Affinity Capture-MS), NSUN5 (Affinity Capture-MS), NSUN5 (Affinity Capture-MS), NSUN5 (Affinity Capture-MS), NSUN5 (Affinity Capture-MS), NSUN5 (Affinity Capture-MS)

ESM2 similar proteins: A0A7N9VSG0, A0JNU3, D3ZBP4, D3ZX08, F1MH07, O43542, O55137, O55171, O88202, O88267, P15575, P16444, P22412, P31429, P41226, P43477, Q08DH8, Q0P5I5, Q14CH7, Q2KHY1, Q2V057, Q32Q92, Q3SZM7, Q3UQ84, Q5E9L5, Q5JTZ9, Q5M876, Q5RCH4, Q66KF6, Q68FW7, Q6P3H4, Q6PAY6, Q86U10, Q8K4F6, Q8K4V2, Q8R123, Q8TDZ2, Q8VCZ9, Q8VDG5, Q8VDP3

Diamond homologs: A8GDM6, O14039, P53972, Q3KNT7, Q60343, Q63ZY6, Q8GYE8, Q8K4F6, Q96P11, Q9NAA7, A1AGI0, A1S788, A1SWV0, A4WBJ4, A4WF97, A6TB06, A6TEU2, A7N0K6, A7ZMV8, A7ZSH7, A8A133, A8A593, A8AFL6, A8AQI3, A8GKG7, A9MN78, A9MNH4, B1IQ11, B1J0Q3, B1KQN1, B1LD37, B1LGP5, B1X6E1, B1XHA3, B2U2Q6, B2U477, B2VK95, B4F1L5, B5F3P3, B5XNC2

SIGNOR signaling

0 interactions.

Disease & clinical

Clinical variants and AI predictions

ClinVar

96 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	75
Likely benign	14
Benign	1

Top pathogenic / likely-pathogenic (0)

SpliceAI

1325 predictions. Top by Δscore:

Variant	Effect	Δscore
7:73303736:CTAGC:C	acceptor_gain	1.0000
7:73303737:TAGC:T	acceptor_gain	1.0000
7:73303738:AGC:A	acceptor_gain	1.0000
7:73303739:GC:G	acceptor_gain	1.0000
7:73303740:CC:C	acceptor_gain	1.0000
7:73303741:C:CA	acceptor_loss	1.0000
7:73303741:C:CC	acceptor_gain	1.0000
7:73303821:TGTA:T	donor_loss	1.0000
7:73303822:GTAC:G	donor_loss	1.0000
7:73303825:C:CT	donor_loss	1.0000
7:73304405:CTTC:C	acceptor_gain	1.0000
7:73304742:CTCA:C	donor_loss	1.0000
7:73304743:TCACC:T	donor_loss	1.0000
7:73304744:CA:C	donor_loss	1.0000
7:73304745:A:AC	donor_gain	1.0000
7:73304745:A:AG	donor_loss	1.0000
7:73304745:AC:A	donor_gain	1.0000
7:73304746:C:A	donor_loss	1.0000
7:73304746:C:CC	donor_gain	1.0000
7:73304746:CC:C	donor_gain	1.0000
7:73304858:CTGGC:C	acceptor_gain	1.0000
7:73304863:C:CC	acceptor_gain	1.0000
7:73304954:CCTA:C	donor_loss	1.0000
7:73304955:CTAC:C	donor_loss	1.0000
7:73304957:AC:A	donor_gain	1.0000
7:73304957:ACCCT:A	donor_loss	1.0000
7:73304958:CC:C	donor_gain	1.0000
7:73304963:T:TA	donor_gain	1.0000
7:73305093:CGAGG:C	acceptor_gain	1.0000
7:73305096:GG:G	acceptor_gain	1.0000

AlphaMissense

2965 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
7:73307471:G:C	N141K	0.998
7:73307471:G:T	N141K	0.998
7:73304776:A:C	S242R	0.997
7:73304776:A:T	S242R	0.997
7:73304778:T:G	S242R	0.997
7:73303873:A:C	N366K	0.996
7:73303873:A:T	N366K	0.996
7:73303874:T:A	N366I	0.996
7:73304782:C:A	K240N	0.996
7:73304782:C:G	K240N	0.996
7:73303632:G:C	F418L	0.994
7:73303632:G:T	F418L	0.994
7:73303634:A:G	F418L	0.994
7:73303905:A:C	Y356D	0.994
7:73304798:G:T	A235D	0.994
7:73304857:G:C	S215R	0.994
7:73304857:G:T	S215R	0.994
7:73304859:T:G	S215R	0.994
7:73304397:G:T	A256D	0.993
7:73307479:G:T	R139S	0.993
7:73303635:G:C	F417L	0.992
7:73303635:G:T	F417L	0.992
7:73303637:A:G	F417L	0.992
7:73303877:T:A	E365V	0.992
7:73304250:T:C	D305G	0.992
7:73304783:T:A	K240M	0.992
7:73304789:C:A	G238V	0.992
7:73304975:A:G	L208P	0.992
7:73303627:G:T	A420D	0.991
7:73303937:G:T	A345E	0.991

dbSNP variants (sampled 300 via entrez): RS1044901 (7:73303650 T>C), RS1044904 (7:73303658 C>T), RS1044907 (7:73303659 A>G,T), RS1044909 (7:73303665 G>A), RS111321782 (7:73305957 C>G,T), RS111341677 (7:73303435 A>C), RS111502702 (7:73308742 G>A), RS112136204 (7:73303447 C>T), RS112696722 (7:73303852 C>T), RS113289566 (7:73309726 G>A), RS113536660 (7:73310547 C>G,T), RS113605106 (7:73304346 C>T), RS11544043 (7:73303936 T>C), RS11544045 (7:73303912 C>A,G), RS1156450737 (7:73305088 GTCATCGAGGCTGCCAGGGAAGAACCAT>G)

Disease associations

OMIM: gene MIM:615732 | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

1 associations (top):

Study	Trait	p-value
GCST90013406_288	Liver enzyme levels (alkaline phosphatase)	1.000000e-10

EFO canonical traits (1, from GWAS)

EFO ID	Trait name
EFO:0004533	alkaline phosphatase measurement

Drugs & pharmacology

Drug and pharmacology data

Is drug target: yes

ChEMBL targets (1): CHEMBL4802014 (SINGLE PROTEIN)

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

40 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Acetaminophen	decreases expression, increases expression	2
Cyclosporine	increases expression	2
Particulate Matter	increases abundance, increases expression, affects cotreatment	2
aristolochic acid I	increases expression	1
bisphenol F	affects cotreatment, decreases expression	1
TAK-243	increases sumoylation	1
methylmercuric chloride	increases expression	1
bisphenol A	affects cotreatment, decreases expression	1
deoxynivalenol	increases expression	1
beta-lapachone	increases expression	1
sodium arsenite	increases abundance, increases expression, affects cotreatment	1
nivalenol	increases expression	1
beta-methylcholine	affects expression	1
di-n-butylphosphoric acid	affects expression	1
abrine	increases expression	1
bisphenol S	affects cotreatment, decreases expression	1
Air Pollutants	increases abundance, increases expression	1
Ethanol	affects cotreatment, increases abundance, increases expression	1
Arsenic	affects cotreatment, increases abundance, increases expression	1
Benzo(a)pyrene	increases methylation	1
Dexamethasone	affects cotreatment, decreases expression	1
Diazinon	increases methylation	1
Doxorubicin	decreases expression	1
Enzyme Inhibitors	decreases activity, increases O-linked glycosylation	1
Estradiol	increases expression	1
Gasoline	affects cotreatment, increases abundance, increases expression	1
Indomethacin	affects cotreatment, decreases expression	1
Ivermectin	decreases expression	1
Lead	affects methylation	1
Methyl Methanesulfonate	increases expression	1

ChEMBL screening assays

7 unique, capped per target: 7 binding

Representative assays (with source publication via chembl_document):

Assay ID	Type	Description	Source paper
CHEMBL4775914	Binding	Binding affinity to NSUN5 in PMA-differentiated human THP-1 cells incubated for 2 hrs by SDS-PAGE and LC-MS/MS analysis	Berberine Directly Targets the NEK7 Protein to Block the NEK7-NLRP3 Interaction and Exert Anti-inflammatory Activity. — J Med Chem

Cellosaurus cell lines

4 cell lines: 4 cancer cell line

First 10 cell lines (id-ordered, not curated):

Cellosaurus	Name	Category	Sex
CVCL_TB19	HAP1 NSUN5 (-) 1	Cancer cell line	Male
CVCL_XR17	HAP1 NSUN5 (-) 2	Cancer cell line	Male
CVCL_XR18	HAP1 NSUN5 (-) 3	Cancer cell line	Male
CVCL_XR19	HAP1 NSUN5 (-) 4	Cancer cell line	Male

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.