NT5DC2
gene geneOn this page
Also known as FLJ12442
Summary
NT5DC2 (5’-nucleotidase domain containing 2, HGNC:25717) is a protein-coding gene on chromosome 3p21.1, encoding 5’-nucleotidase domain-containing protein 2 (Q9H857). Promotes dephosphorylation of tyrosine 3-monooxygenase TH which decreases TH catalytic activity and leads to reduced synthesis of catecholamines including dopamine, noradrenaline and adrenaline.
Predicted to enable 5’-nucleotidase activity. Predicted to be involved in negative regulation of dopamine biosynthetic process; negative regulation of oxidoreductase activity; and negative regulation of peptidyl-serine phosphorylation. Located in mitochondrion.
Source: NCBI Gene 64943 — RefSeq curated summary.
At a glance
- GWAS associations: 35
- Clinical variants (ClinVar): 124 total
- Druggable target: yes
- MANE Select transcript:
NM_001134231
Identifiers
Gene identifiers
| Field | Value |
|---|---|
| HGNC ID | HGNC:25717 |
| Approved symbol | NT5DC2 |
| Name | 5’-nucleotidase domain containing 2 |
| Location | 3p21.1 |
| Locus type | gene with protein product |
| Status | Approved |
| Aliases | FLJ12442 |
| Ensembl gene | ENSG00000168268 |
| Ensembl biotype | protein_coding |
| OMIM | 621077 |
| Entrez | 64943 |
Gene structure
Transcript identifiers
Ensembl transcripts: 25 — 16 protein_coding, 6 retained_intron, 2 protein_coding_CDS_not_defined, 1 nonsense_mediated_decay
ENST00000307076, ENST00000422318, ENST00000459839, ENST00000462261, ENST00000463947, ENST00000466112, ENST00000469616, ENST00000471522, ENST00000478091, ENST00000479024, ENST00000486792, ENST00000487779, ENST00000489316, ENST00000490681, ENST00000492555, ENST00000900516, ENST00000900517, ENST00000919385, ENST00000919386, ENST00000919387, ENST00000919388, ENST00000919389, ENST00000919390, ENST00000919391, ENST00000965313
RefSeq mRNA: 2 — MANE Select: NM_001134231
NM_001134231, NM_022908
CCDS: CCDS2858, CCDS46843
Canonical transcript exons
ENST00000422318 — 14 exons
| Exon | Start | End |
|---|---|---|
| ENSE00001859694 | 52524387 | 52524731 |
| ENSE00003464065 | 52528013 | 52528073 |
| ENSE00003530512 | 52528861 | 52528935 |
| ENSE00003537053 | 52524817 | 52524881 |
| ENSE00003555716 | 52527617 | 52527718 |
| ENSE00003622651 | 52528446 | 52528539 |
| ENSE00003626674 | 52525209 | 52525295 |
| ENSE00003632784 | 52527829 | 52527931 |
| ENSE00003643555 | 52528183 | 52528311 |
| ENSE00003659906 | 52524963 | 52525103 |
| ENSE00003666620 | 52529150 | 52529334 |
| ENSE00003686021 | 52528637 | 52528692 |
| ENSE00003785643 | 52527294 | 52527375 |
| ENSE00003847118 | 52533506 | 52533857 |
Expression profiles
Bgee: expression breadth ubiquitous, 228 present calls, max score 99.00.
FANTOM5 (CAGE): breadth ubiquitous, TPM avg 24.1413 / max 133.2881, expressed in 1690 samples.
FANTOM5 promoters (11 alternative TSS)
| Promoter ID | TPM avg | Samples expressed |
|---|---|---|
| 42447 | 13.3333 | 1650 |
| 42445 | 3.9631 | 1210 |
| 42449 | 2.5863 | 882 |
| 42442 | 1.4336 | 795 |
| 42446 | 1.0443 | 587 |
| 42444 | 0.7395 | 396 |
| 42441 | 0.3468 | 182 |
| 42439 | 0.2490 | 105 |
| 42438 | 0.2150 | 96 |
| 42448 | 0.1502 | 58 |
Top tissues by expression
284 total, by Bgee expression score (0-100, higher = more expressed):
| Tissue | Anatomy ID | Expression score | Quality |
|---|---|---|---|
| ganglionic eminence | UBERON:0004023 | 99.00 | gold quality |
| ventricular zone | UBERON:0003053 | 98.99 | gold quality |
| stromal cell of endometrium | CL:0002255 | 98.76 | gold quality |
| embryo | UBERON:0000922 | 97.92 | gold quality |
| apex of heart | UBERON:0002098 | 97.74 | gold quality |
| right coronary artery | UBERON:0001625 | 97.57 | gold quality |
| cortical plate | UBERON:0005343 | 97.57 | gold quality |
| right atrium auricular region | UBERON:0006631 | 97.46 | gold quality |
| left coronary artery | UBERON:0001626 | 97.23 | gold quality |
| lower esophagus mucosa | UBERON:0035834 | 97.20 | gold quality |
| right hemisphere of cerebellum | UBERON:0014890 | 96.37 | gold quality |
| endocervix | UBERON:0000458 | 96.33 | gold quality |
| adenohypophysis | UBERON:0002196 | 96.29 | gold quality |
| coronary artery | UBERON:0001621 | 96.26 | gold quality |
| right testis | UBERON:0004534 | 96.14 | gold quality |
| cerebellar hemisphere | UBERON:0002245 | 96.08 | gold quality |
| tibial nerve | UBERON:0001323 | 96.05 | gold quality |
| cerebellar cortex | UBERON:0002129 | 95.95 | gold quality |
| left testis | UBERON:0004533 | 95.93 | gold quality |
| right adrenal gland | UBERON:0001233 | 95.80 | gold quality |
| cardiac atrium | UBERON:0002081 | 95.80 | gold quality |
| left adrenal gland | UBERON:0001234 | 95.62 | gold quality |
| left adrenal gland cortex | UBERON:0035825 | 95.61 | gold quality |
| left ovary | UBERON:0002119 | 95.59 | gold quality |
| ectocervix | UBERON:0012249 | 95.51 | gold quality |
| esophagus mucosa | UBERON:0002469 | 95.28 | gold quality |
| right ovary | UBERON:0002118 | 95.16 | gold quality |
| skin of leg | UBERON:0001511 | 95.01 | gold quality |
| right adrenal gland cortex | UBERON:0035827 | 95.00 | gold quality |
| pituitary gland | UBERON:0000007 | 94.91 | gold quality |
Single-cell (SCXA)
Detected in 3 experiment(s), a significant marker in 2.
| Experiment | Marker? | Max mean expression |
|---|---|---|
| E-HCAD-13 | yes | 25.03 |
| E-MTAB-9689 | no | 423.89 |
| E-ANND-3 | no | 0.00 |
Regulation
Is transcription factor: no
miRNA regulators (miRDB)
5 targeting NT5DC2, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):
| miRNA | Max score | Avg score | miRNA target_count |
|---|---|---|---|
| HSA-MIR-6745 | 99.74 | 65.33 | 1321 |
| HSA-MIR-6776-5P | 98.54 | 67.43 | 1304 |
| HSA-MIR-1255B-2-3P | 97.80 | 67.04 | 880 |
| HSA-MIR-4288 | 97.11 | 67.23 | 1636 |
| HSA-MIR-1231 | 95.10 | 65.63 | 663 |
Literature-anchored findings (GeneRIF, showing 7)
- Disruption of NT5DC2 in GSCs markedly reduces the expression of Fyn, a Src family proto-oncogene that has been implicated in the regulation of GBM progression. The expression of NT5DC2 strongly correlated with increased aggression of human gliomas, but not that of other brain tumors. (PMID:30978441)
- NT5DC2 promotes tumor cell proliferation by stabilizing EGFR in hepatocellular carcinoma. (PMID:32382041)
- NT5DC2 suppression restrains progression towards metastasis of non-small-cell lung cancer through regulation p53 signaling. (PMID:32962856)
- NT5DC2 knockdown inhibits colorectal carcinoma progression by repressing metastasis, angiogenesis and tumor-associated macrophage recruitment: A mechanism involving VEGF signaling. (PMID:32991874)
- Decreased RNAbinding protein IGF2BP2 downregulates NT5DC2, which suppresses cell proliferation, and induces cell cycle arrest and apoptosis in diffuse large Bcell lymphoma cells by regulating the p53 signaling pathway. (PMID:35894142)
- Gastric cancer metastasis-related NT5DC2 indicates unfavorable prognosis of patients. (PMID:37800836)
- NT5DC2 knockdown suppresses progression, glycolysis, and neuropathic pain in triple-negative breast cancer by blocking the EGFR pathway. (PMID:38289126)
Cross-species orthologs
5 orthologs
| Organism | Symbol | Gene ID |
|---|---|---|
| mus_musculus | Nt5dc2 | ENSMUSG00000071547 |
| rattus_norvegicus | Nt5dc2 | ENSRNOG00000018358 |
| drosophila_melanogaster | Nt5c | FBGN0033426 |
| drosophila_melanogaster | Nt5b | FBGN0052549 |
| caenorhabditis_elegans | WBGENE00022201 |
Paralogs (4): NT5C2 (ENSG00000076685), NT5DC3 (ENSG00000111696), NT5DC4 (ENSG00000144130), NT5DC1 (ENSG00000178425)
Protein
Protein identifiers
5’-nucleotidase domain-containing protein 2 — Q9H857 (reviewed: Q9H857)
All UniProt accessions (5): C9J036, Q9H857, F8WEY1, H7C4G8, H7C519
UniProt curated annotations — full annotation on UniProt →
Function. Promotes dephosphorylation of tyrosine 3-monooxygenase TH which decreases TH catalytic activity and leads to reduced synthesis of catecholamines including dopamine, noradrenaline and adrenaline. The exact mechanism of activity is unknown but may act as a phosphatase or promote the activity of phosphatases or may inhibit phosphorylation by acting as a barrier to interfere with protein kinase access.
Subunit / interactions. Interacts with tyrosine 3-monooxygenase TH; the interaction results in reduced phosphorylation and decreased catalytic activity of TH.
Subcellular location. Cytoplasm.
Similarity. Belongs to the 5’(3’)-deoxyribonucleotidase family.
Isoforms (4)
| UniProt ID | Names | Canonical? |
|---|---|---|
| Q9H857-1 | 1 | yes |
| Q9H857-2 | 2 | |
| Q9H857-3 | 3 | |
| Q9H857-4 | 4 |
RefSeq proteins (2): NP_001127703, NP_075059 (=MANE)
Domains & families (InterPro)
| ID | Name | Type |
|---|---|---|
| IPR008380 | HAD-SF_hydro_IG_5-nucl | Family |
| IPR016695 | Pur_nucleotidase | Family |
| IPR023214 | HAD_sf | Homologous_superfamily |
| IPR036412 | HAD-like_sf | Homologous_superfamily |
Pfam: PF05761
UniProt features (13 total): sequence conflict 3, binding site 3, splice variant 3, active site 2, chain 1, sequence variant 1
Structure
Experimental structures (PDB)
0 structures.
Predicted structure (AlphaFold)
| Model | pLDDT | Fraction very-high |
|---|---|---|
| AF-Q9H857-F1 | 86.69 | 0.75 |
Functional residue map
Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.
Catalytic / active sites (2): 73 (nucleophile); 75 (proton donor)
Ligand- & substrate-binding residues (3): 73; 75; 358
Function
Pathways and Gene Ontology
Reactome pathways
0 pathways
MSigDB gene sets: 161 (showing top):
RNGTGGGC_UNKNOWN, GOBP_PHENOL_CONTAINING_COMPOUND_METABOLIC_PROCESS, GOBP_PHENOL_CONTAINING_COMPOUND_BIOSYNTHETIC_PROCESS, GOBP_REGULATION_OF_PHOSPHORYLATION, GOBP_PEPTIDYL_SERINE_MODIFICATION, GRAESSMANN_APOPTOSIS_BY_DOXORUBICIN_UP, GOBP_REGULATION_OF_OXIDOREDUCTASE_ACTIVITY, GOBP_REGULATION_OF_AMINE_METABOLIC_PROCESS, GOBP_REGULATION_OF_PEPTIDYL_SERINE_PHOSPHORYLATION, GOBP_DOPAMINE_METABOLIC_PROCESS, LE_EGR2_TARGETS_UP, GOBP_NEGATIVE_REGULATION_OF_OXIDOREDUCTASE_ACTIVITY, HEN1_01, GOBP_NEGATIVE_REGULATION_OF_PHOSPHORUS_METABOLIC_PROCESS, GOBP_NEGATIVE_REGULATION_OF_MOLECULAR_FUNCTION
GO Biological Process (4): negative regulation of peptidyl-serine phosphorylation (GO:0033137), obsolete negative regulation of catecholamine metabolic process (GO:0045914), negative regulation of oxidoreductase activity (GO:0051354), negative regulation of dopamine biosynthetic process (GO:1903180)
GO Molecular Function (3): 5’-nucleotidase activity (GO:0008253), metal ion binding (GO:0046872), hydrolase activity (GO:0016787)
GO Cellular Component (2): cytoplasm (GO:0005737), mitochondrion (GO:0005739)
GO top-level categories
Rollup of top GO terms by namespace:
| Category | Terms |
|---|---|
| negative regulation of protein phosphorylation | 1 |
| peptidyl-serine phosphorylation | 1 |
| regulation of peptidyl-serine phosphorylation | 1 |
| oxidoreductase activity | 1 |
| negative regulation of catalytic activity | 1 |
| regulation of oxidoreductase activity | 1 |
| negative regulation of biosynthetic process | 1 |
| dopamine biosynthetic process | 1 |
| negative regulation of dopamine metabolic process | 1 |
| regulation of dopamine biosynthetic process | 1 |
| nucleotidase activity | 1 |
| cation binding | 1 |
| catalytic activity | 1 |
| intracellular anatomical structure | 1 |
| cellular anatomical structure | 1 |
| cytoplasm | 1 |
| intracellular membrane-bounded organelle | 1 |
Protein interactions and networks
STRING
776 interactions, top by confidence (×1000):
| Protein A | Protein B | Partner UniProt | Score |
|---|---|---|---|
| NT5DC2 | UQCC5 | Q8WVI0 | 511 |
| NT5DC2 | STIMATE | Q86TL2 | 510 |
| NT5DC2 | CENPW | Q5EE01 | 470 |
| NT5DC2 | PPM1M | Q96MI6 | 463 |
| NT5DC2 | LRATD1 | Q96KN4 | 462 |
| NT5DC2 | ZNF664 | Q8N3J9 | 448 |
| NT5DC2 | TH | P07101 | 443 |
| NT5DC2 | UBE2T | Q9NPD8 | 443 |
| NT5DC2 | C2orf69 | Q8N8R5 | 436 |
| NT5DC2 | PLPP6 | Q8IY26 | 430 |
| NT5DC2 | CCDC92 | Q53HC0 | 428 |
| NT5DC2 | PUDP | Q08623 | 424 |
| NT5DC2 | CST9L | Q9H4G1 | 423 |
| NT5DC2 | MTMR9 | Q96QG7 | 394 |
| NT5DC2 | BCO2 | Q9BYV7 | 387 |
IntAct
65 interactions, top by confidence:
| A | B | Type | Score |
|---|---|---|---|
| CFTR | ESYT2 | psi-mi:“MI:2364”(proximity) | 0.710 |
| ETFRF1 | NDUFAB1 | psi-mi:“MI:0914”(association) | 0.640 |
| EMILIN1 | METTL15 | psi-mi:“MI:0914”(association) | 0.530 |
| KCTD17 | CBX4 | psi-mi:“MI:0914”(association) | 0.530 |
| TOLLIP | IRAK2 | psi-mi:“MI:0914”(association) | 0.500 |
| NT5DC3 | NT5DC2 | psi-mi:“MI:0915”(physical association) | 0.400 |
| HSPB2 | NT5DC2 | psi-mi:“MI:0915”(physical association) | 0.370 |
| NT5DC2 | TSG101 | psi-mi:“MI:0915”(physical association) | 0.370 |
| SIRT4 | VWA8 | psi-mi:“MI:0914”(association) | 0.350 |
| TSNAX | psi-mi:“MI:0914”(association) | 0.350 | |
| HIF1AN | CNOT1 | psi-mi:“MI:0914”(association) | 0.350 |
| HSCB | RBP5 | psi-mi:“MI:0914”(association) | 0.350 |
| CUL3 | PXDNL | psi-mi:“MI:0914”(association) | 0.350 |
| LRRK2 | psi-mi:“MI:0914”(association) | 0.350 | |
| FMC1 | NDUFAB1 | psi-mi:“MI:0914”(association) | 0.350 |
| CISD3 | POLRMT | psi-mi:“MI:0914”(association) | 0.350 |
| XPNPEP3 | COQ9 | psi-mi:“MI:0914”(association) | 0.350 |
| FMC1 | DNM1L | psi-mi:“MI:0914”(association) | 0.350 |
| COQ9 | ACOT7 | psi-mi:“MI:0914”(association) | 0.350 |
| XPNPEP3 | ALDH1L1 | psi-mi:“MI:0914”(association) | 0.350 |
| FMC1 | POLRMT | psi-mi:“MI:0914”(association) | 0.350 |
BioGRID (134): NT5DC2 (Affinity Capture-MS), NT5DC2 (Affinity Capture-MS), NT5DC2 (Two-hybrid), NT5DC2 (Affinity Capture-MS), NT5DC2 (Affinity Capture-MS), NT5DC2 (Affinity Capture-MS), NT5DC2 (Affinity Capture-MS), NT5DC2 (Affinity Capture-MS), NT5DC2 (Affinity Capture-MS), NT5DC2 (Affinity Capture-MS), NT5DC2 (Affinity Capture-MS), NT5DC2 (Affinity Capture-MS), NT5DC2 (Affinity Capture-MS), NT5DC2 (Affinity Capture-MS), NT5DC2 (Affinity Capture-MS)
ESM2 similar proteins: A0A3L7I2I8, A6H7H7, D4ABP9, O60733, O95476, P37287, P97570, P97819, Q12980, Q1RMV9, Q20432, Q28EX9, Q28HW9, Q29I63, Q2KIX2, Q2KJD7, Q2TBU5, Q3B7T6, Q3TP92, Q3U1V6, Q3UHB1, Q4R678, Q5F480, Q5FWT7, Q5R4C4, Q5TFE4, Q5U395, Q5U3T3, Q5ZJJ8, Q61C05, Q66H63, Q6NWD4, Q6NYU2, Q80YV4, Q86UY8, Q8AYC9, Q8BGR9, Q8BM85, Q8JIL9, Q8VIJ8
Diamond homologs: A4IHT9, Q3UHB1, Q54XC1, Q5TFE4, Q6GN91, Q6Q0N3, Q75K12, Q86UY8, Q86YG4, Q9H857, Q2TBU5, Q5EBF1, Q5ZIZ4, Q6DKB0, Q8C5P5, D3ZMY7, O46411, P49902, Q3V1L4, Q5RA22
SIGNOR signaling
0 interactions.
Disease & clinical
Clinical variants and AI predictions
ClinVar
124 variants total. Per-class counts are floors (≥ shown; pagination cap):
| Classification | Count (floor) |
|---|---|
| Pathogenic | 0 |
| Likely pathogenic | 0 |
| Uncertain significance | 91 |
| Likely benign | 2 |
| Benign | 0 |
Top pathogenic / likely-pathogenic (0)
SpliceAI
2150 predictions. Top by Δscore:
| Variant | Effect | Δscore |
|---|---|---|
| 3:52524812:CTCA:C | donor_loss | 1.0000 |
| 3:52524813:TCA:T | donor_loss | 1.0000 |
| 3:52524816:C:CT | donor_loss | 1.0000 |
| 3:52524877:TAGGT:T | acceptor_gain | 1.0000 |
| 3:52524878:AGGT:A | acceptor_gain | 1.0000 |
| 3:52524879:GGT:G | acceptor_gain | 1.0000 |
| 3:52524880:GT:G | acceptor_gain | 1.0000 |
| 3:52524882:C:A | acceptor_loss | 1.0000 |
| 3:52524882:C:CC | acceptor_gain | 1.0000 |
| 3:52524959:ACAC:A | donor_loss | 1.0000 |
| 3:52524960:CACC:C | donor_loss | 1.0000 |
| 3:52524961:AC:A | donor_loss | 1.0000 |
| 3:52524965:G:A | donor_gain | 1.0000 |
| 3:52525019:A:AC | donor_gain | 1.0000 |
| 3:52525020:C:CC | donor_gain | 1.0000 |
| 3:52525102:TC:T | acceptor_gain | 1.0000 |
| 3:52525102:TCC:T | acceptor_loss | 1.0000 |
| 3:52525103:CC:C | acceptor_gain | 1.0000 |
| 3:52525104:C:CC | acceptor_gain | 1.0000 |
| 3:52525104:CT:C | acceptor_loss | 1.0000 |
| 3:52525105:T:A | acceptor_loss | 1.0000 |
| 3:52525202:C:A | donor_gain | 1.0000 |
| 3:52525292:TTCCC:T | acceptor_loss | 1.0000 |
| 3:52525293:TCCCT:T | acceptor_loss | 1.0000 |
| 3:52525294:CC:C | acceptor_gain | 1.0000 |
| 3:52525295:CC:C | acceptor_gain | 1.0000 |
| 3:52525297:T:A | acceptor_loss | 1.0000 |
| 3:52527288:CCTTA:C | donor_loss | 1.0000 |
| 3:52527289:CTTA:C | donor_loss | 1.0000 |
| 3:52527290:TTA:T | donor_loss | 1.0000 |
AlphaMissense
3672 scored. Top likely-pathogenic:
| Variant | Protein change | am_pathogenicity |
|---|---|---|
| 3:52524684:C:G | R450P | 1.000 |
| 3:52524696:C:A | G446V | 1.000 |
| 3:52525069:G:T | A377D | 1.000 |
| 3:52525072:C:T | G376D | 1.000 |
| 3:52525082:A:G | W373R | 1.000 |
| 3:52525082:A:T | W373R | 1.000 |
| 3:52525213:A:G | L364P | 1.000 |
| 3:52525215:A:C | D363E | 1.000 |
| 3:52525215:A:T | D363E | 1.000 |
| 3:52525216:T:A | D363V | 1.000 |
| 3:52525216:T:C | D363G | 1.000 |
| 3:52525216:T:G | D363A | 1.000 |
| 3:52525217:C:G | D363H | 1.000 |
| 3:52525231:T:A | D358V | 1.000 |
| 3:52525231:T:C | D358G | 1.000 |
| 3:52525231:T:G | D358A | 1.000 |
| 3:52525234:C:A | G357V | 1.000 |
| 3:52525234:C:T | G357E | 1.000 |
| 3:52525235:C:A | G357W | 1.000 |
| 3:52525235:C:G | G357R | 1.000 |
| 3:52525235:C:T | G357R | 1.000 |
| 3:52525294:C:T | G337E | 1.000 |
| 3:52527631:G:C | F304L | 1.000 |
| 3:52527631:G:T | F304L | 1.000 |
| 3:52527633:A:G | F304L | 1.000 |
| 3:52527634:G:C | F303L | 1.000 |
| 3:52527634:G:T | F303L | 1.000 |
| 3:52527636:A:G | F303L | 1.000 |
| 3:52527643:C:A | K300N | 1.000 |
| 3:52527643:C:G | K300N | 1.000 |
dbSNP variants (sampled 300 via entrez): RS1000039280 (3:52536808 A>G), RS1000449787 (3:52531698 G>A), RS1000810387 (3:52525412 G>A), RS1000859453 (3:52527112 C>T), RS1001051732 (3:52533104 C>A,T), RS1001092868 (3:52526388 C>T), RS1001197086 (3:52531100 C>T), RS1001219838 (3:52533304 CGCCCCCGGGCGTCGGGGCGCCCCAGAG>C), RS1001258857 (3:52525935 A>G), RS1001379772 (3:52533284 C>G,T), RS1001384085 (3:52532211 C>CTTAGAA), RS1001385100 (3:52531761 C>A,G), RS1002038278 (3:52526738 C>T), RS1002219413 (3:52532739 G>A), RS1002908351 (3:52527082 T>C)
Disease associations
OMIM: gene MIM:621077 | disease phenotypes:
GenCC curated gene-disease
Mondo (0):
Orphanet (0):
HPO phenotypes
0 total (0 of 0 shown, HPO-id order):
GWAS associations
35 associations (top):
| Study | Trait | p-value |
|---|---|---|
| GCST001241_15 | Bipolar disorder | 2.000000e-06 |
| GCST002149_14 | Schizophrenia | 1.000000e-08 |
| GCST002539_48 | Schizophrenia | 4.000000e-11 |
| GCST002774_8 | Cognitive function | 5.000000e-06 |
| GCST002782_110 | Waist-to-hip ratio adjusted for body mass index | 3.000000e-10 |
| GCST002782_111 | Waist-to-hip ratio adjusted for body mass index | 7.000000e-11 |
| GCST002782_262 | Waist-to-hip ratio adjusted for body mass index | 1.000000e-09 |
| GCST002782_263 | Waist-to-hip ratio adjusted for body mass index | 3.000000e-10 |
| GCST004063_106 | Waist circumference adjusted for body mass index | 6.000000e-10 |
| GCST004063_169 | Waist circumference adjusted for body mass index | 1.000000e-08 |
| GCST004500_50 | Waist circumference adjusted for BMI (adjusted for smoking behaviour) | 7.000000e-07 |
| GCST004500_95 | Waist circumference adjusted for BMI (adjusted for smoking behaviour) | 4.000000e-07 |
| GCST004501_119 | Waist circumference adjusted for BMI (joint analysis main effects and smoking interaction) | 3.000000e-07 |
| GCST004501_120 | Waist circumference adjusted for BMI (joint analysis main effects and smoking interaction) | 1.000000e-06 |
| GCST004505_89 | Waist-to-hip ratio adjusted for BMI (adjusted for smoking behaviour) | 2.000000e-06 |
| GCST004521_123 | Autism spectrum disorder or schizophrenia | 3.000000e-12 |
| GCST004521_201 | Autism spectrum disorder or schizophrenia | 4.000000e-08 |
| GCST004521_259 | Autism spectrum disorder or schizophrenia | 6.000000e-09 |
| GCST004615_10 | Hemoglobin concentration | 6.000000e-09 |
| GCST004622_161 | Reticulocyte count | 2.000000e-15 |
| GCST005316_131 | Intelligence (MTAG) | 8.000000e-11 |
| GCST006269_1074 | General cognitive ability | 2.000000e-11 |
| GCST006269_512 | General cognitive ability | 3.000000e-15 |
| GCST006803_55 | Schizophrenia | 1.000000e-11 |
| GCST008103_3 | Bipolar disorder | 7.000000e-11 |
| GCST010083_130 | Hemoglobin levels | 2.000000e-14 |
| GCST010698_14 | Subcortical volume (min-P) | 8.000000e-09 |
| GCST010699_73 | Brain morphology (min-P) | 1.000000e-18 |
| GCST010701_137 | Cortical surface area (MOSTest) | 8.000000e-10 |
| GCST010702_70 | Subcortical volume (MOSTest) | 2.000000e-11 |
EFO canonical traits (8, from GWAS)
| EFO ID | Trait name |
|---|---|
| EFO:0004337 | intelligence |
| EFO:0007788 | BMI-adjusted waist-hip ratio |
| EFO:0007789 | BMI-adjusted waist circumference |
| EFO:0004318 | smoking behavior |
| EFO:0004509 | hemoglobin measurement |
| EFO:0007986 | reticulocyte count |
| EFO:0004346 | neuroimaging measurement |
| EFO:0004348 | hematocrit |
Drugs & pharmacology
Drug and pharmacology data
Is drug target: yes
ChEMBL targets (1): CHEMBL4295945 (SINGLE PROTEIN)
PharmGKB: 1 entry (VIP=true, CPIC=false)
ChEMBL bioactivities
2 potent at pChembl≥5 of 2 total, top 2 by pChembl (potency: 10 = 0.1 nM, 6 = 1 µM).
| pChembl | Type | Value | Unit | Molecule |
|---|---|---|---|---|
| 5.76 | Kd | 1724 | nM | CHEMBL5653589 |
| 5.76 | ED50 | 1724 | nM | CHEMBL5653589 |
PubChem BioAssay actives
1 with measured affinity, of 3 total; 1 most potent distinct compounds. Largely complementary to BindingDB; screening values are coarse (µM, 4 dp), so sub-nM hits tie at the floor.
| Compound | Assay | Type | Value | Unit |
|---|---|---|---|---|
| 4-methyl-3-[(2-methyl-6-pyridin-3-ylpyrazolo[3,4-d]pyrimidin-4-yl)amino]-N-[3-(trifluoromethyl)phenyl]benzamide | 2148892: Binding affinity to human NT5DC2 incubated for 45 mins by Kinobead based pull down assay | kd | 1.7236 | uM |
CTD chemical–gene interactions
62 total (human), top 30 by PubMed support.
| Chemical | Actions (top 5) | PubMed papers |
|---|---|---|
| sodium arsenite | increases abundance, increases expression, affects methylation, decreases expression | 5 |
| methylmercuric chloride | increases expression, affects cotreatment | 2 |
| Air Pollutants | decreases expression, increases abundance, increases expression | 2 |
| Estradiol | affects cotreatment, increases expression | 2 |
| Phenylmercuric Acetate | affects cotreatment, decreases expression | 2 |
| Smoke | decreases expression, increases abundance, increases expression | 2 |
| Valproic Acid | increases expression, increases methylation | 2 |
| Particulate Matter | decreases expression, increases abundance, increases expression | 2 |
| bisphenol F | increases expression | 1 |
| bisphenol A | affects expression | 1 |
| methylparaben | increases expression | 1 |
| sodium bichromate | decreases expression | 1 |
| mono-(2-ethylhexyl)phthalate | decreases methylation, increases abundance | 1 |
| tris(1,3-dichloro-2-propyl)phosphate | decreases expression | 1 |
| cobaltous chloride | decreases expression | 1 |
| potassium chromate(VI) | decreases expression | 1 |
| ferrous chloride | decreases expression | 1 |
| perfluorooctane sulfonic acid | increases expression | 1 |
| pentabromodiphenyl ether | decreases expression | 1 |
| CGP 52608 | affects binding, increases reaction | 1 |
| K 7174 | decreases expression | 1 |
| 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide | affects cotreatment, increases expression, decreases expression | 1 |
| erucylphospho-N,N,N-trimethylpropylammonium | decreases expression | 1 |
| ICG 001 | increases expression | 1 |
| abrine | decreases expression | 1 |
| 2,2’,4,4’-tetrabromodiphenyl ether | decreases expression | 1 |
| dorsomorphin | affects cotreatment, increases expression, decreases expression | 1 |
| 2-(1H-indazol-4-yl)-6-(4-methanesulfonylpiperazin-1-ylmethyl)-4-morpholin-4-ylthieno(3,2-d)pyrimidine | decreases expression, increases response to substance | 1 |
| NSC 689534 | decreases expression, affects binding | 1 |
| 4-(4-((5-(4,5-dimethyl-2-nitrophenyl)-2-furanyl)methylene)-4,5-dihydro-3-methyl-5-oxo-1H-pyrazol-1-yl)benzoic acid | decreases expression | 1 |
ChEMBL screening assays
2 unique, capped per target: 2 binding
Representative assays (with source publication via chembl_document):
| Assay ID | Type | Description | Source paper |
|---|---|---|---|
| CHEMBL4232645 | Binding | Binding affinity to NT5DC2 cysteine residue in human 786-O cell soluble proteomic lysate at 5 uM incubated for 1 hr followed by cell lysis by IA-alkyne probe based isoTOP-ABPP analysis | Covalent inhibitors of nicotinamide N-methyltransferase (NNMT) provide evidence for target engagement challenges in situ. — Bioorg Med Chem Lett |
Cellosaurus cell lines
4 cell lines: 4 cancer cell line
First 10 cell lines (id-ordered, not curated):
| Cellosaurus | Name | Category | Sex |
|---|---|---|---|
| CVCL_TB24 | HAP1 NT5DC2 (-) 1 | Cancer cell line | Male |
| CVCL_XR20 | HAP1 NT5DC2 (-) 2 | Cancer cell line | Male |
| CVCL_XR21 | HAP1 NT5DC2 (-) 3 | Cancer cell line | Male |
| CVCL_XR22 | HAP1 NT5DC2 (-) 4 | Cancer cell line | Male |
Clinical trials (associated diseases)
0 trials via MONDO — disease-level, not drug-specific.
Related Atlas pages
No linked Atlas pages yet — the cross-entity mesh grows as the corpus expands.