NUTF2

Summary

NUTF2 (nuclear transport factor 2, HGNC:13722) is a protein-coding gene on chromosome 16q22.1, encoding Nuclear transport factor 2 (P61970). Mediates the import of GDP-bound RAN from the cytoplasm into the nucleus which is essential for the function of RAN in cargo receptor-mediated nucleocytoplasmic transport. It is a common-essential gene (DepMap: required in 99.3% of cancer cell lines).

This gene encodes a cytosolic factor that facilitates protein transport into the nucleus. The encoded protein is required for nuclear import of the small Ras-like GTPase, Ran which is involved in numerous cellular processes. This protein also interacts with the nuclear pore complex glycoprotein p62.

Source: NCBI Gene 10204 — RefSeq curated summary.

At a glance

• GWAS associations: 3
• Clinical variants (ClinVar): 11 total
• Expression (HPA): Low tissue specificity — highest in tongue, skeletal muscle, supraoptic nucleus
• GTEx eGene: eQTL in 9 tissues, sQTL in 2 (q < 0.05)
• Cancer dependency (DepMap): dependent in 99.3% of screened cell lines (common-essential)
• Constraint (gnomAD): pLI 0.99 (loss-of-function intolerant), LOEUF 0.40 (moderately constrained)
• MANE Select transcript: NM_005796

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:13722
Approved symbol	NUTF2
Name	nuclear transport factor 2
Location	16q22.1
Locus type	gene with protein product
Status	Approved
Aliases	NTF2, PP15
Ensembl gene	ENSG00000102898
Ensembl biotype	protein_coding
OMIM	605813
Entrez	10204

Gene structure

Transcript identifiers

Ensembl transcripts: 38 — 37 protein_coding, 1 retained_intron

MANE Select: ENST00000219169

Transcript support level (Ensembl TSL; 1 = fully mRNA-supported): TSL 1: 1, TSL 2: 3, TSL 3: 3

ENST00000219169, ENST00000567105, ENST00000568233, ENST00000568390, ENST00000568396, ENST00000569436, ENST00000570026, ENST00000587481, ENST00000700610, ENST00000700611, ENST00000700612, ENST00000700613, ENST00000700614, ENST00000700615, ENST00000899783, ENST00000899784, ENST00000899785, ENST00000899786, ENST00000899787, ENST00000939627, ENST00000939628, ENST00000939629, ENST00000939630, ENST00000939631, ENST00000939632, ENST00000969121, ENST00001024898, ENST00001091867, ENST00001091868, ENST00001091869, ENST00001091870, ENST00001091871, ENST00001091872, ENST00001091873, ENST00001091874, ENST00001091875, ENST00001091876, ENST00001137350

RefSeq mRNA: 5 — MANE Select: NM_005796 NM_001322038, NM_001322039, NM_001322040, NM_001322041, NM_005796

CCDS: CCDS10848

Canonical transcript exons

ENST00000219169 — 5 exons

Exon	Start	End
ENSE00001047772	67846933	67846985
ENSE00003601795	67868340	67868411
ENSE00003651473	67865102	67865229
ENSE00003980331	67870800	67872567
ENSE00003980332	67868501	67868599

Expression profiles

Bgee: expression breadth ubiquitous, 233 present calls, max score 97.25.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 190.4099 / max 809.1524, expressed in 1828 samples.

Highest expression (Bgee): ascending aorta, hindlimb stylopod muscle, thoracic aorta, popliteal artery, tibial artery.

Genetic regulation across tissues (GTEx eQTL / sQTL)

NUTF2 is an eGene in GTEx v10 — its expression is genetically regulated (eQTL) in 9 tissues and its splicing (sQTL) in 2 (q < 0.05). Strongest associations first; slope = normalized effect of the lead variant’s alternative allele.

11 significant tissue × QTL associations:

Tissue	QTL	q-value	Slope	Lead variant
Nerve Tibial	eqtl	3.7e-03	-0.27	16:67103074:TC:T
Esophagus Gastroesophageal Junction	eqtl	1.0e-02	+0.52	16:68374424:TGGAGCAGCA:T
Adipose Subcutaneous	eqtl	1.4e-02	+0.26	16:67072628:G:A
Cells EBV-transformed lymphocytes	eqtl	1.8e-02	-0.11	16:68201828:CATGCCTGTAGTCCCAGCTACTTGGGAGGCTGGCATAGGAGAA:C
Colon Transverse	eqtl	2.0e-02	-0.50	16:67408313:G:A
Whole Blood	eqtl	2.1e-02	-0.20	16:68828262:C:T
Brain Nucleus accumbens basal ganglia	eqtl	2.7e-02	-0.31	16:67937477:C:T
Esophagus Mucosa	sqtl	2.8e-02	-0.23	16:67657765:A:G
Nerve Tibial	sqtl	3.2e-02	-0.47	16:67530156:C:T
Muscle Skeletal	eqtl	3.7e-02	+0.17	16:67334057:G:A
Skin Sun Exposed Lower leg	eqtl	4.1e-02	-0.34	16:67279902:G:A

FANTOM5 promoters

5 alternative TSS:

Promoter ID	TPM avg	Samples expressed
154683	166.1076	1825
154684	12.8740	1780
154682	9.4450	1792
154685	1.4328	915
154681	0.5505	323

Top tissues by expression

showing 100 of 250 tissues by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
ascending aorta	UBERON:0001496	97.25	gold quality
hindlimb stylopod muscle	UBERON:0004252	97.25	gold quality
thoracic aorta	UBERON:0001515	97.24	gold quality
popliteal artery	UBERON:0002250	97.18	gold quality
tibial artery	UBERON:0007610	97.18	gold quality
aorta	UBERON:0000947	97.12	gold quality
left coronary artery	UBERON:0001626	97.01	gold quality
C1 segment of cervical spinal cord	UBERON:0006469	96.99	gold quality
descending thoracic aorta	UBERON:0002345	96.96	gold quality
artery	UBERON:0001637	96.95	gold quality
right coronary artery	UBERON:0001625	96.93	gold quality
anterior cingulate cortex	UBERON:0009835	96.78	gold quality
stromal cell of endometrium	CL:0002255	96.76	gold quality
embryo	UBERON:0000922	96.70	gold quality
ganglionic eminence	UBERON:0004023	96.70	gold quality
lower esophagus muscularis layer	UBERON:0035833	96.57	gold quality
lower esophagus	UBERON:0013473	96.56	gold quality
hypothalamus	UBERON:0001898	96.49	gold quality
amygdala	UBERON:0001876	96.48	gold quality
coronary artery	UBERON:0001621	96.44	gold quality
esophagogastric junction muscularis propria	UBERON:0035841	96.44	gold quality
ventricular zone	UBERON:0003053	96.39	gold quality
monocyte	CL:0000576	96.26	gold quality
smooth muscle tissue	UBERON:0001135	96.26	gold quality
leukocyte	CL:0000738	96.21	gold quality
gastrocnemius	UBERON:0001388	96.21	gold quality
right adrenal gland cortex	UBERON:0035827	96.20	gold quality
skin of abdomen	UBERON:0001416	96.19	gold quality
right atrium auricular region	UBERON:0006631	96.19	gold quality
body of uterus	UBERON:0009853	96.19	gold quality
right adrenal gland	UBERON:0001233	96.18	gold quality
left uterine tube	UBERON:0001303	96.13	gold quality
Brodmann (1909) area 9	UBERON:0013540	96.09	gold quality
muscle layer of sigmoid colon	UBERON:0035805	96.06	gold quality
right testis	UBERON:0004534	96.05	gold quality
prefrontal cortex	UBERON:0000451	96.03	gold quality
right frontal lobe	UBERON:0002810	96.02	gold quality
ectocervix	UBERON:0012249	95.97	gold quality
nucleus accumbens	UBERON:0001882	95.94	gold quality
endocervix	UBERON:0000458	95.89	gold quality
muscle of leg	UBERON:0001383	95.89	gold quality
spinal cord	UBERON:0002240	95.87	gold quality
body of pancreas	UBERON:0001150	95.86	gold quality
mucosa of transverse colon	UBERON:0004991	95.86	gold quality
putamen	UBERON:0001874	95.81	gold quality
apex of heart	UBERON:0002098	95.81	gold quality
left testis	UBERON:0004533	95.78	gold quality
left adrenal gland	UBERON:0001234	95.74	gold quality
skin of leg	UBERON:0001511	95.69	gold quality
upper lobe of left lung	UBERON:0008952	95.67	gold quality
omental fat pad	UBERON:0010414	95.66	gold quality
peritoneum	UBERON:0002358	95.63	gold quality
metanephros cortex	UBERON:0010533	95.63	gold quality
mucosa of stomach	UBERON:0001199	95.60	gold quality
left adrenal gland cortex	UBERON:0035825	95.58	gold quality
cortical plate	UBERON:0005343	95.57	gold quality
esophagus	UBERON:0001043	95.44	gold quality
caudate nucleus	UBERON:0001873	95.42	gold quality
right ovary	UBERON:0002118	95.41	gold quality
islet of Langerhans	UBERON:0000006	95.36	gold quality
vermiform appendix	UBERON:0001154	95.34	gold quality
transverse colon	UBERON:0001157	95.32	gold quality
tibial nerve	UBERON:0001323	95.19	gold quality
body of stomach	UBERON:0001161	95.15	gold quality
cardiac atrium	UBERON:0002081	95.14	gold quality
right lobe of thyroid gland	UBERON:0001119	95.09	gold quality
adenohypophysis	UBERON:0002196	95.03	gold quality
right uterine tube	UBERON:0001302	95.00	gold quality
left ovary	UBERON:0002119	94.97	gold quality
heart left ventricle	UBERON:0002084	94.96	gold quality
rectum	UBERON:0001052	94.95	gold quality
adrenal cortex	UBERON:0001235	94.94	gold quality
adrenal tissue	UBERON:0018303	94.93	gold quality
minor salivary gland	UBERON:0001830	94.84	gold quality
left lobe of thyroid gland	UBERON:0001120	94.80	gold quality
esophagus mucosa	UBERON:0002469	94.70	gold quality
granulocyte	CL:0000094	94.69	gold quality
right lung	UBERON:0002167	94.69	gold quality
cardiac ventricle	UBERON:0002082	94.58	gold quality
pancreas	UBERON:0001264	94.57	gold quality
adrenal gland	UBERON:0002369	94.57	gold quality
small intestine Peyer’s patch	UBERON:0003454	94.55	gold quality
adipose tissue of abdominal region	UBERON:0007808	94.49	gold quality
heart	UBERON:0000948	94.48	gold quality
substantia nigra	UBERON:0002038	94.46	gold quality
dorsolateral prefrontal cortex	UBERON:0009834	94.25	gold quality
neocortex	UBERON:0001950	94.24	gold quality
upper lobe of lung	UBERON:0008948	94.15	gold quality
lower esophagus mucosa	UBERON:0035834	94.15	gold quality
testis	UBERON:0000473	93.99	gold quality
stomach	UBERON:0000945	93.96	gold quality
lymph node	UBERON:0000029	93.85	gold quality
frontal cortex	UBERON:0001870	93.85	gold quality
olfactory segment of nasal mucosa	UBERON:0005386	93.84	gold quality
muscle organ	UBERON:0001630	93.77	gold quality
skeletal muscle organ	UBERON:0014892	93.77	gold quality
cortex of kidney	UBERON:0001225	93.68	gold quality
thyroid gland	UBERON:0002046	93.63	gold quality
pituitary gland	UBERON:0000007	93.62	gold quality
midbrain	UBERON:0001891	93.62	gold quality

Single-cell (SCXA)

Detected in 3 experiment(s), a significant marker in 1.

Experiment	Marker?	Max mean expression
E-MTAB-7303	no	826.32
E-MTAB-8060	no	143.55
E-ANND-3	no	0.00

HPA expression

RNA tissue specificity: Low tissue specificity

showing 60 of 80 HPA tissues / cells by nTPM:

Tissue / cell	Axis	nTPM	Protein (IHC)
Tongue	tissue	161.0
Skeletal muscle	tissue	142.5	not detected
Locus coeruleus	tissue	138.6
Heart muscle	tissue	122.6	not detected
Thymus	tissue	114.0
Spinal cord	tissue	109.3
Urinary bladder	tissue	107.3	medium
Placenta	tissue	105.0	low
Hippocampus	tissue	102.5	low
Smooth muscle	tissue	99.6	low
Nucleus accumbens	tissue	96.0
Lymph node	tissue	95.3	low
Tonsil	tissue	94.1	medium
Postcentral gyrus	tissue	90.0
Thalamus	tissue	89.8
Ovary	tissue	88.6	medium
Pons	tissue	87.9
Medulla oblongata	tissue	87.8
Bone marrow	tissue	87.0	medium
Midbrain	tissue	86.4
Colon	tissue	85.6	medium
Superior colliculi	tissue	84.9
Parathyroid gland	tissue	83.7	medium
Putamen	tissue	81.3
Fallopian tube	tissue	79.1	high
Substantia nigra	tissue	78.0
Appendix	tissue	77.5	medium
Corpus callosum	tissue	76.7
Choroid plexus	tissue	76.5
Adipose tissue	tissue	74.4	not detected
Hippocampal formation	tissue	73.9
Rectum	tissue	73.3	medium
Seminal vesicle	tissue	72.8	low
Cerebral cortex	tissue	71.3	low
Occipital cortex	tissue	71.3
Esophagus	tissue	71.1	low
Pancreas	tissue	70.3	medium
Somatosensory cortex	tissue	69.9
Epididymis	tissue	69.3	high
Cervix	tissue	68.7	medium
Breast	tissue	68.2	medium
Testis	tissue	68.2	high
Prefrontal cortex	tissue	68.1
Motor cortex	tissue	67.3
Hypothalamus	tissue	65.9
Basal ganglia	tissue	65.1	not detected
Liver	tissue	64.5	low
Endometrium 1	tissue	63.9	low
Ventral forebrain	tissue	63.5
Adrenal gland	tissue	61.7	medium
Periaqueductal gray	tissue	61.7
Septum	tissue	61.5
Temporal cortex	tissue	61.5
Entorhinal cortex	tissue	60.4
Lung	tissue	59.5	high
Retrosplenial and cingulate cortex	tissue	59.4
Spleen	tissue	59.3	not detected
Prostate	tissue	59.1	not detected
Salivary gland	tissue	57.4	low
Skin 1	tissue	57.2	low

Brain sub-regions (HPA Brain Atlas): detected in 192; highest nTPM — Supraoptic nucleus (139.9), Lateral hypothalamic area (137.2), Lateral funiculus (white matter) (126.9), Anterior funiculus (white matter) (126.2), Median raphe nucleus (126.1).

Regulation

Is transcription factor: no

Upstream regulators (CollecTRI, top): MYC

miRNA regulators (miRDB)

Targeting NUTF2 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific).

showing 30 of 56 miRNAs:

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-4481	100.00	66.42	1669
HSA-MIR-9-5P	100.00	72.28	2361
HSA-MIR-4673	100.00	66.64	1490
HSA-MIR-4747-5P	100.00	67.90	2681
HSA-MIR-5196-5P	100.00	67.98	2761
HSA-MIR-4645-5P	99.98	65.81	1284
HSA-MIR-4745-5P	99.98	65.95	1028
HSA-MIR-3658	99.96	73.87	4379
HSA-MIR-4648	99.91	67.00	710
HSA-MIR-765	99.84	68.24	2442
HSA-MIR-4659A-3P	99.80	72.62	4248
HSA-MIR-4659B-3P	99.80	72.62	4248
HSA-MIR-3156-3P	99.76	66.72	939
HSA-MIR-11181-3P	99.75	66.38	2205
HSA-MIR-3680-3P	99.75	72.51	3095
HSA-MIR-1976	99.74	65.48	1127
HSA-MIR-4802-3P	99.72	70.13	1273
HSA-MIR-494-3P	99.70	71.45	2795
HSA-MIR-6715B-5P	99.64	69.63	1420
HSA-MIR-1827	99.63	68.57	3265
HSA-MIR-1287-3P	99.63	66.93	492
HSA-MIR-298	99.63	67.56	1916
HSA-MIR-891B	99.59	69.81	1083
HSA-MIR-2113	99.58	71.22	1521
HSA-MIR-18A-3P	99.56	65.68	1092
HSA-MIR-4269	99.55	69.89	1373
HSA-MIR-510-3P	99.54	70.06	2965
HSA-MIR-486-3P	99.51	66.82	1901
HSA-MIR-548G-3P	99.48	68.67	2159
HSA-MIR-12131	99.48	68.72	1673

Functional genomics

gnomAD constraint: pLI 0.99, LOEUF 0.403, missense Z 3.34 — population loss-of-function intolerance (pLI ≥ 0.9 = LoF-intolerant; lower LOEUF = more constrained). gnomAD

Regional missense constraint (gnomAD RMC): no regional variation along ENST00000219169 — one region, missense o/e 0.27. DepMap (CRISPR cell-line fitness): dependent in 99.3% of screened cell lines, common-essential.

Most-dependent cell lines (DepMap gene-effect, lower = stronger; ≤ −0.5 shown): NCI-H226 (-2.866), LOU-NH91 (-2.676), Panc 03.27 (-2.507), NIH:OVCAR-3 (-2.354), DK-MG (-2.347), COLO-678 (-2.347), RERF-GC-1B (-2.336), OV-90 (-2.314), AsPC-1 (-2.27), NCI-H2052 (-2.162), MFE-280 (-2.134), NCI-H3122 (-2.134), RD-ES (-2.113), KP-4 (-2.087), SNU-626 (-2.069).

Literature-anchored findings (GeneRIF, showing 9)

• A nuclear pore binding site was studied on a mutated NTF2 protein. (PMID:15522285)
• Results report that NTF2 and Ran control nuclear import of the filamentous actin capping protein CapG. (PMID:18266911)
• NTF2 is a potential mediator of retinal vasculature integrity. (PMID:19404486)
• Data suggest actin accumulation in senescent cells is due to the failure of RanGTP restoration with ATP deficiency and NTF2 accumulation, resulting in decreased actin export via Exp6 inactivation. (PMID:21195711)
• Nucleocytoplasmic translocation of NTF2 is regulated in mammalian cells. (PMID:22880006)
• Binding of Ran to NTF2 is required for NTF2 to inhibit nuclear expansion and import of large cargo molecules. (PMID:26823604)
• These results showed that BLM enters the nucleus via the importin beta1, RanGDP and NTF2 dependent pathway, demonstrating for the first time the nuclear trafficking mechanism of a DNA helicase. (PMID:29017749)
• DNA-Origami NanoTrap for Studying the Selective Barriers Formed by Phenylalanine-Glycine-Rich Nucleoporins. (PMID:34324340)
• Nuclear Transport Factor 2 (NTF2) suppresses WM983B metastatic melanoma by modifying cell migration, metastasis, and gene expression. (PMID:34880267)

Cross-species orthologs

8 orthologs

Organism	Symbol	Gene ID
danio_rerio	nutf2	ENSDARG00000056531
mus_musculus	Nutf2	ENSMUSG00000008450
mus_musculus	Nutf2-ps1	ENSMUSG00000071497
rattus_norvegicus	Nutf2	ENSRNOG00000018945
rattus_norvegicus	AABR07018058.1	ENSRNOG00000057750
drosophila_melanogaster	Ntf-2	FBGN0031145
drosophila_melanogaster	Ntf-2r	FBGN0032680
caenorhabditis_elegans	ran-4	WBGENE00004305

Paralogs (2): NXT2 (ENSG00000101888), NXT1 (ENSG00000132661)

Mouse-model phenotypes

Observed phenotypes of the mouse ortholog (MGI:1915301) from MGI (Alliance of Genome Resources) — knockout/mutant phenotypes, ranked by annotation count. 4 distinct phenotype terms.

Mouse phenotype (MP)	Records
abnormal lens morphology	1
cataract	1
decreased heart rate	1
preweaning lethality, complete penetrance	1

Additional cross-species homologs

Sequence homologs in species beyond Ensembl Compara’s model organisms, by Diamond local protein alignment (% sequence identity; best hit per species). Lower-identity rows are more distant homologs. The matched accessions’ gene symbols aren’t in biobtree yet, so each row shows the UniProt accession.

Organism	UniProt	Identity	Method
Bos taurus	Q32KP9	100.0%	Diamond
Pongo abelii	Q5R8G4	100.0%	Diamond
Nakaseomyces glabratus CBS 138	Q6FRC6	93.6%	Diamond
Eremothecium gossypii ATCC 10895	Q75AA5	93.6%	Diamond
Saccharomyces cerevisiae S288C	P33331	92.8%	Diamond
Kluyveromyces lactis NRRL Y-1140	Q6CQX4	91.2%	Diamond
Debaryomyces hansenii CBS767	Q6BWC0	88.7%	Diamond
Candida albicans	Q9P926	88.7%	Diamond
Xenopus laevis	O42242	86.6%	Diamond
Arabidopsis thaliana	Q9C7F5	84.6%	Diamond
Schizosaccharomyces pombe 972h-	Q10100	71.7%	Diamond
Oryza sativa Japonica Group	Q9XJ54	70.2%	Diamond
Yarrowia lipolytica CLIB122	Q6CC82	68.3%	Diamond
Cladosporium herbarum	Q8NJ52	65.6%	Diamond
Aspergillus nidulans FGSC A4	Q96VN3	65.6%	Diamond
Neurospora crassa OR74A	P87102	57.5%	Diamond
Dictyostelium discoideum	Q86HW7	44.3%	Diamond

Genomic neighbors (locus context)

Genes flanking this one on the chromosome (NCBI/Entrez gene neighborhood). Positional context only — some neighbors share regulatory elements (bidirectional promoters, antisense/overlapping transcripts), but chromosomal adjacency is not itself a functional relationship (see Interactions for that).

Symbol	Type	Entrez
CTRL	protein-coding	1506
EDC4	protein-coding	23644
PSKH1	protein-coding	5681
PSMB10	protein-coding	5699
CENPT	protein-coding	80152
C16orf86	protein-coding	388284
TSNAXIP1	protein-coding	55815
THAP11	protein-coding	57215
RANBP10	protein-coding	57610
GFOD2	protein-coding	81577
NRN1L	protein-coding	123904

Protein

Protein identifiers

Nuclear transport factor 2 — P61970 (reviewed: P61970)

Alternative names: Placental protein 15

All UniProt accessions (7): A0A8V8TPY3, A0A8V8TR25, A0A8V8TR28, A0A8V8TRD3, B4DEQ2, P61970, H3BRV9

UniProt curated annotations — full annotation on UniProt →

Function. Mediates the import of GDP-bound RAN from the cytoplasm into the nucleus which is essential for the function of RAN in cargo receptor-mediated nucleocytoplasmic transport. Thereby, plays indirectly a more general role in cargo receptor-mediated nucleocytoplasmic transport. Interacts with GDP-bound RAN in the cytosol, recruits it to the nuclear pore complex via its interaction with nucleoporins and promotes its nuclear import.

Subunit / interactions. Homodimer. Interacts with RAN (GDP-bound form); the interaction is direct and regulates RAN nuclear import. Interacts with the nucleoporins NUP54, NUP58 and NUP62 (via FG repeats); recruits NUTF2 to the nuclear pore complex a step required for NUTF2-mediated GDP-bound RAN nuclear import. Interacts with CAPG; mediates its nuclear import.

Subcellular location. Cytoplasm. Cytosol. Nucleus outer membrane. Nucleus. Nuclear pore complex. Nucleus inner membrane. Nucleoplasm.

RefSeq proteins (5): NP_001308967, NP_001308968, NP_001308969, NP_001308970, NP_005787* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR002075	NTF2_dom	Domain
IPR018222	Nuclear_transport_factor_2_euk	Domain
IPR032710	NTF2-like_dom_sf	Homologous_superfamily
IPR045875	NTF2	Family

Pfam: PF02136

UniProt features (14 total): strand 6, helix 3, mutagenesis site 2, chain 1, domain 1, modified residue 1

Structure

Experimental structures (PDB)

1 structure by resolution:

PDB	Title	Method	Resolution (Å)
1GY5	D92N,D94N double point mutant of human Nuclear Transport Factor 2 (NTF2)	X-RAY DIFFRACTION	2.3

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-P61970-F1	95.29	0.93

Human Protein Atlas

Protein class: Predicted intracellular proteins, Plasma proteins, Essential proteins

Protein evidence: Evidence at protein level

Antibody reliability (HPA): IH supported

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Post-translational modifications (1)

Type	Positions
N6-acetyllysine	4

Mutagenesis-validated functional residues (2)

Position	Phenotype
42	no effect on localization to the nucleoplasm.
124	no effect on localization to the nucleoplasm.

Function

Pathways and Gene Ontology

Reactome pathways

0 curated (TAS) of 0; 0 disease pathways. Curated-first; evidence = TAS (manually curated) vs IEA (electronic inference).

MSigDB gene sets: 209 (showing top): MYAATNNNNNNNGGC_UNKNOWN, E2F_Q4_01, chr16q22, GOBP_INTRACELLULAR_PROTEIN_TRANSPORT, KAAB_FAILED_HEART_ATRIUM_DN, GRAESSMANN_APOPTOSIS_BY_DOXORUBICIN_DN, GRAESSMANN_RESPONSE_TO_MC_AND_DOXORUBICIN_DN, RACCACAR_AML_Q6, GOBP_ESTABLISHMENT_OF_PROTEIN_LOCALIZATION_TO_ORGANELLE, GOMF_GTPASE_BINDING, GGAMTNNNNNTCCY_UNKNOWN, CAGCTG_AP4_Q5, PUJANA_CHEK2_PCC_NETWORK, GOBP_NUCLEAR_TRANSPORT, AAACCAC_MIR140

GO Biological Process (6): protein import into nucleus (GO:0006606), protein export from nucleus (GO:0006611), mRNA transport (GO:0051028), protein localization to nuclear pore (GO:0090204), nucleocytoplasmic transport (GO:0006913), protein transport (GO:0015031)

GO Molecular Function (5): structural constituent of nuclear pore (GO:0017056), small GTPase binding (GO:0031267), identical protein binding (GO:0042802), nuclear import signal receptor activity (GO:0061608), protein binding (GO:0005515)

GO Cellular Component (10): nuclear inner membrane (GO:0005637), nuclear outer membrane (GO:0005640), nucleoplasm (GO:0005654), cytosol (GO:0005829), nuclear membrane (GO:0031965), nuclear pore central transport channel (GO:0044613), extracellular exosome (GO:0070062), nucleus (GO:0005634), nuclear pore (GO:0005643), cytoplasm (GO:0005737)

GO top-level categories

32 GO namespaces:

Category	Terms
cellular anatomical structure	3
intracellular protein transport	2
import into nucleus	2
nuclear pore	2
nuclear membrane	2
nuclear envelope	2
nuclear protein-containing complex	2
protein localization to nucleus	1
establishment of protein localization to organelle	1
nuclear export	1
RNA transport	1
protein localization to nuclear envelope	1
nuclear transport	1
transport	1
intracellular protein localization	1
establishment of protein localization	1
structural molecule activity	1
nucleocytoplasmic transport	1
GTPase binding	1
protein binding	1
nucleocytoplasmic carrier activity	1
binding	1
organelle inner membrane	1
organelle outer membrane	1
nuclear outer membrane-endoplasmic reticulum membrane network	1
nuclear lumen	1
cytoplasm	1
nucleus	1
organelle membrane	1
extracellular vesicle	1
intracellular membrane-bounded organelle	1
intracellular anatomical structure	1

Experimentally-supported GO annotations

GO terms backed by direct experimental evidence (ECO experimental codes) — 8 of 21 annotations. The rest are phylogenetic / computational / electronic (IEA).

8 experimentally-supported GO terms:

GO term	NS	Evidence
protein export from nucleus	BP	direct assay
protein import into nucleus	BP	direct assay
cytosol	CC	direct assay
extracellular exosome	CC	high-throughput assay
nucleoplasm	CC	direct assay
identical protein binding	MF	physical interaction
small GTPase binding	MF	direct assay
structural constituent of nuclear pore	MF	direct assay

Protein interactions and networks

IntAct

Human interaction partners of NUTF2 in IntAct, one row per partner (best MIscore; records = supporting IntAct interaction records).

showing 30 of 46 partners by confidence:

Partner	Interaction type	MIscore	Records
RAN	physical association	0.890	4
NUP62	physical association	0.780	7
BEND7	physical association	0.560	3
BRWD1	physical association	0.560	3
CAMK2G	physical association	0.560	3
CCDC106	physical association	0.560	3
CCDC150	physical association	0.560	3
CHCHD3	physical association	0.560	3
CHMP4A	physical association	0.560	3
CKMT1A	physical association	0.560	3
CLPP	physical association	0.560	3
FAM50B	physical association	0.560	3
HMG20A	physical association	0.560	3
HMG20B	physical association	0.560	3
KHDC4	physical association	0.560	3
KRT86	physical association	0.560	3
KRTAP9-8	physical association	0.560	3
LASP1	physical association	0.560	3
LCE1C	physical association	0.560	3
LCE5A	physical association	0.560	3
LENG1	physical association	0.560	3
MRNIP	physical association	0.560	3
MYOZ3	physical association	0.560	3
NME1	physical association	0.560	3
NME4	physical association	0.560	3
NRIP3	physical association	0.560	3
NUP54	physical association	0.560	3
PAX4	physical association	0.560	3
PBX4	physical association	0.560	3
PCNA	physical association	0.560	3

BioGRID (154 interactions; top human partners by supporting records): RAN (Two-hybrid; 11 records), NUP62 (Two-hybrid; 5 records), NUP153 (Reconstituted Complex; 3 records), KPNB1 (Reconstituted Complex; 2 records), NUP54 (Two-hybrid; 2 records), NUP93 (Affinity Capture-MS; 2 records), NXF1 (Affinity Capture-RNA; 2 records), AES (Two-hybrid), AGR2 (Proximity Label-MS), AP2A1 (Co-fractionation), AP2A2 (Co-fractionation), APOA1BP (Co-fractionation), BAG1 (Affinity Capture-MS), BAP1 (Affinity Capture-MS), BEND7 (Two-hybrid)

SIGNOR signaling

1 signaling interactions:

A	Effect	B	Mechanism
NUTF2	“up-regulates activity”	NUP62	binding

Disease & clinical

Genetic variants

Variant evidence for NUTF2: 11 ClinVar records (0 pathogenic / likely pathogenic); 3 GWAS associations.

ClinVar

11 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	1
Likely benign	0
Benign	0

SpliceAI

Top 10 splice-impact sites by Δscore (adjacent positions with the same effect merged into one range; 37 predictions of 325):

Position(s)	Effect	Δscore	Sites
16:67868338–67868339	acceptor_loss	1.0000	5
16:67868600–67868601	donor_loss	1.0000	5
16:67870798–67870799	acceptor_loss	1.0000	6
16:67846986–67846987	donor_loss	0.9900	5
16:67865191	donor_gain	0.9900
16:67868339	acceptor_loss	0.9900
16:67868412–67868413	donor_loss	0.9900	6
16:67868421	donor_gain	0.9900
16:67868499–67868500	acceptor_loss	0.9900	6
16:67870797	acceptor_gain	0.9900

HPA cancer prognostics

RNA cancer specificity: Low cancer specificity

Human Protein Atlas survival analysis — favorable = higher expression predicts better survival.

5 prognostic cancer types:

Cancer	Prognostic	p-value
Kidney Renal Clear Cell Carcinoma (TCGA)	unfavorable	1.4e-06
Head and Neck Squamous Cell Carcinoma (TCGA)	unfavorable	8.54e-05
Liver Hepatocellular Carcinoma (TCGA)	unfavorable	0.000121
Kidney Renal Clear Cell Carcinoma (validation)	unfavorable	0.00034
Liver Hepatocellular Carcinoma (validation)	unfavorable	0.000497

Disease associations

OMIM: gene MIM:605813 | disease phenotypes:

GWAS associations

3 associations:

Study	Trait	p-value
GCST010002_165	Refractive error	2e-14
GCST002539_44	Schizophrenia	2e-8
GCST006803_78	Schizophrenia	4e-8

Drugs & pharmacology

Drug and pharmacology data

Is drug target: yes

ChEMBL targets (1): CHEMBL6067085 (SINGLE PROTEIN)

PharmGKB: 1 entry (CPIC guideline: no)

Binding affinities (BindingDB)

1 measured of 1 human assays (2 total across all organisms); most potent 1 below. Values come from heterogeneous assays and are not directly comparable.

Ligand	Measure	Value
CHEMBL5653589	KD	1440 nM

ChEMBL bioactivities

4 potent at pChembl≥5 of 4 total, top 4 by pChembl (potency: 10 = 0.1 nM, 6 = 1 µM).

pChembl	Type	Value	Unit	Molecule
8.66	Kd	2.171	nM	CHEMBL3752910
8.66	ED50	2.171	nM	CHEMBL3752910
6.38	Kd	419.2	nM	CHEMBL5653589
6.38	ED50	419.2	nM	CHEMBL5653589

PubChem BioAssay actives

2 with measured affinity, of 4 total; 2 most potent distinct compounds. Largely complementary to BindingDB; screening values are coarse (µM, 4 dp), so sub-nM hits tie at the floor.

Compound	Assay	Type	Value	Unit
4-methyl-3-[(1-methyl-6-pyridin-3-ylpyrazolo[3,4-d]pyrimidin-4-yl)amino]-N-[3-(trifluoromethyl)phenyl]benzamide	2148908: Binding affinity to human NUTF2 incubated for 45 mins by Kinobead based pull down assay	kd	0.0022	uM
4-methyl-3-[(2-methyl-6-pyridin-3-ylpyrazolo[3,4-d]pyrimidin-4-yl)amino]-N-[3-(trifluoromethyl)phenyl]benzamide	2148908: Binding affinity to human NUTF2 incubated for 45 mins by Kinobead based pull down assay	kd	0.4192	uM

CTD chemical–gene interactions

35 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
bisphenol A	decreases expression, increases expression	3
Valproic Acid	decreases expression, increases expression, affects cotreatment	3
4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	affects cotreatment, increases expression, decreases expression	2
Tretinoin	decreases expression	2
aristolochic acid I	increases expression	1
bisphenol F	increases expression	1
nobiletin	decreases expression, decreases reaction	1
sodium arsenate	decreases expression, decreases reaction	1
sodium arsenite	decreases expression	1
cobaltous chloride	decreases expression	1
ochratoxin A	increases expression	1
tamibarotene	affects expression	1
microcystin RR	decreases expression	1
di-n-butylphosphoric acid	affects expression	1
CGP 52608	increases reaction, affects binding	1
K 7174	decreases expression	1
dorsomorphin	affects cotreatment, decreases expression	1
LDN 193189	affects cotreatment, increases expression	1
bisphenol AF	increases expression	1
Arsenic	affects methylation	1
Cisplatin	increases expression	1
Diazinon	increases methylation	1
Doxorubicin	decreases expression	1
Hydrogen Peroxide	affects expression	1
Ivermectin	decreases expression	1
Selenium	increases expression	1
Smoke	decreases expression	1
Theophylline	increases expression	1
Tobacco Smoke Pollution	affects expression	1
Vitamin E	increases expression	1

ChEMBL screening assays

1 unique, capped per target: 1 binding

Representative assays (with source publication via chembl_document):

Assay ID	Type	Description	Source paper
CHEMBL5651950	Binding	Binding affinity to human NUTF2 incubated for 45 mins by Kinobead based pull down assay	NVP-BHG712: Effects of Regioisomers on the Affinity and Selectivity toward the EPHrin Family. — *ChemMedChem*

Clinical trials (associated diseases)

Via MONDO — disease-level, not drug-specific.

Predicted chemistry — Sugi Predict

The predicted patent-compound landscape for NUTF2 across ~30M SureChEMBL compounds — explore on Sugi Predict.