OR10H1

Summary

OR10H1 (olfactory receptor family 10 subfamily H member 1, HGNC:8172) is a protein-coding gene on chromosome 19p13.12, encoding Olfactory receptor 10H1 (Q9Y4A9). Odorant receptor.

Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome.

Source: NCBI Gene 26539 — RefSeq curated summary.

At a glance

• GWAS associations: 1
• Clinical variants (ClinVar): 78 total
• MANE Select transcript: NM_013940

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:8172
Approved symbol	OR10H1
Name	olfactory receptor family 10 subfamily H member 1
Location	19p13.12
Locus type	gene with protein product
Status	Approved
Ensembl gene	ENSG00000186723
Ensembl biotype	protein_coding
Entrez	26539

Gene structure

Transcript identifiers

Ensembl transcripts: 2 — 2 protein_coding

ENST00000334920, ENST00000641419

RefSeq mRNA: 1 — MANE Select: NM_013940 NM_013940

CCDS: CCDS12335

Canonical transcript exons

ENST00000641419 — 4 exons

Exon	Start	End
ENSE00003812071	15815555	15815664
ENSE00003812406	15812230	15812878
ENSE00003812767	15808725	15808841
ENSE00003813094	15804549	15808048

Expression profiles

Bgee: expression breadth broad, 14 present calls, max score 82.84.

Top tissues by expression

247 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
buccal mucosa cell	CL:0002336	82.84	silver quality
cervix squamous epithelium	UBERON:0006922	77.36	gold quality
male germ line stem cell (sensu Vertebrata) in testis	CL:0000089 ∩ UBERON:0000473	77.24	silver quality
skeletal muscle tissue of rectus abdominis	UBERON:0004511	74.35	gold quality
sperm	CL:0000019	72.58	silver quality
male germ cell	CL:0000015	70.79	silver quality
superficial temporal artery	UBERON:0001614	69.73	gold quality
mucosa of urinary bladder	UBERON:0001259	69.48	gold quality
gingival epithelium	UBERON:0001949	69.38	gold quality
gingiva	UBERON:0001828	68.78	gold quality
triceps brachii	UBERON:0001509	68.57	gold quality
oocyte	CL:0000023	67.12	gold quality
parotid gland	UBERON:0001831	66.88	gold quality
pharyngeal mucosa	UBERON:0000355	66.84	gold quality
gluteal muscle	UBERON:0002000	66.76	gold quality
squamous epithelium	UBERON:0006914	66.73	gold quality
pericardium	UBERON:0002407	66.40	gold quality
mucosa of sigmoid colon	UBERON:0004993	66.30	gold quality
body of tongue	UBERON:0011876	65.94	gold quality
cardia of stomach	UBERON:0001162	65.63	gold quality
ventral tegmental area	UBERON:0002691	65.57	silver quality
mucosa of paranasal sinus	UBERON:0005030	65.53	gold quality
pons	UBERON:0000988	65.48	silver quality
saphenous vein	UBERON:0007318	65.42	gold quality
synovial joint	UBERON:0002217	65.29	silver quality
orbitofrontal cortex	UBERON:0004167	65.20	gold quality
subthalamic nucleus	UBERON:0001906	65.09	gold quality
inferior vagus X ganglion	UBERON:0005363	65.01	gold quality
superior surface of tongue	UBERON:0007371	64.97	gold quality
cerebellar vermis	UBERON:0004720	64.95	gold quality

Single-cell (SCXA)

Detected in 3 experiment(s), a significant marker in 2.

Experiment	Marker?	Max mean expression
E-GEOD-137537	yes	1281.07
E-ANND-3	yes	4.57
E-MTAB-9801	no	2.68

Regulation

Is transcription factor: no

Cross-species orthologs

8 orthologs

Organism	Symbol	Gene ID
mus_musculus	Or10h1	ENSMUSG00000093884
mus_musculus	Or10h1b	ENSMUSG00000094891
mus_musculus	Or10h5	ENSMUSG00000096169
rattus_norvegicus	Olr1092	ENSRNOG00000073810
rattus_norvegicus	Or10h1	ENSRNOG00000074063
rattus_norvegicus	Olr1090	ENSRNOG00000082788
rattus_norvegicus	Olr1093	ENSRNOG00000090741
rattus_norvegicus	Or10h1d	ENSRNOG00000091234

Paralogs (92): OR2B6 (ENSG00000124657), OR13C9 (ENSG00000136839), OR13C4 (ENSG00000148136), OR2M5 (ENSG00000162727), OR10A5 (ENSG00000166363), OR2D2 (ENSG00000166368), OR2B2 (ENSG00000168131), OR2C1 (ENSG00000168158), OR13J1 (ENSG00000168828), OR10G3 (ENSG00000169208), OR10A3 (ENSG00000170683), OR10A4 (ENSG00000170782), OR10A2 (ENSG00000170790), OR13H1 (ENSG00000171054), OR2K2 (ENSG00000171133), OR2M4 (ENSG00000171180), OR10H2 (ENSG00000171942), OR10H5 (ENSG00000172519), OR10AD1 (ENSG00000172640), OR2Y1 (ENSG00000174339), OR10AG1 (ENSG00000174970), OR2T1 (ENSG00000175143), OR10P1 (ENSG00000175398), OR2T35 (ENSG00000177151), OR2M7 (ENSG00000177186), OR2T12 (ENSG00000177201), OR2T33 (ENSG00000177212), OR2AJ1 (ENSG00000177275), OR2T8 (ENSG00000177462), OR2G3 (ENSG00000177476), OR2G2 (ENSG00000177489), OR2B11 (ENSG00000177535), OR2D3 (ENSG00000178358), OR13D1 (ENSG00000179055), OR10A7 (ENSG00000179919), OR2Z1 (ENSG00000181733), OR2V2 (ENSG00000182613), OR10G7 (ENSG00000182634), OR2T29 (ENSG00000182783), OR2T34 (ENSG00000183310)

Protein

Protein identifiers

Olfactory receptor 10H1 — Q9Y4A9 (reviewed: Q9Y4A9)

Alternative names: Olfactory receptor OR19-27

All UniProt accessions (2): A0A126GVU5, Q9Y4A9

UniProt curated annotations — full annotation on UniProt →

Function. Odorant receptor.

Subcellular location. Cell membrane.

Similarity. Belongs to the G-protein coupled receptor 1 family.

RefSeq proteins (1): NP_039228* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR000276	GPCR_Rhodpsn	Family
IPR000725	Olfact_rcpt	Family
IPR017452	GPCR_Rhodpsn_7TM	Domain

Pfam: PF13853

UniProt features (21 total): topological domain 8, transmembrane region 7, sequence variant 3, chain 1, glycosylation site 1, disulfide bond 1

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q9Y4A9-F1	87.56	0.63

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Disulfide bonds (1): 97–189

Glycosylation sites (1): 5

Function

Pathways and Gene Ontology

Reactome pathways

1 pathways

ID	Pathway
R-HSA-9752946	Expression and translocation of olfactory receptors

MSigDB gene sets: 35 (showing top): XU_GH1_AUTOCRINE_TARGETS_UP, GOBP_SENSORY_PERCEPTION_OF_CHEMICAL_STIMULUS, KEGG_OLFACTORY_TRANSDUCTION, GOBP_DETECTION_OF_STIMULUS, GOBP_SENSORY_PERCEPTION, ACEVEDO_METHYLATED_IN_LIVER_CANCER_DN, XU_GH1_EXOGENOUS_TARGETS_UP, chr19p13, GOMF_OLFACTORY_RECEPTOR_ACTIVITY, GOMF_TRANSMEMBRANE_SIGNALING_RECEPTOR_ACTIVITY, GOMF_G_PROTEIN_COUPLED_RECEPTOR_ACTIVITY, GOBP_SENSORY_PERCEPTION_OF_SMELL, GOBP_G_PROTEIN_COUPLED_RECEPTOR_SIGNALING_PATHWAY, GOBP_DETECTION_OF_STIMULUS_INVOLVED_IN_SENSORY_PERCEPTION, RELA_DN.V1_DN

GO Biological Process (4): detection of chemical stimulus involved in sensory perception of smell (GO:0050911), signal transduction (GO:0007165), G protein-coupled receptor signaling pathway (GO:0007186), sensory perception of smell (GO:0007608)

GO Molecular Function (2): G protein-coupled receptor activity (GO:0004930), olfactory receptor activity (GO:0004984)

GO Cellular Component (2): plasma membrane (GO:0005886), membrane (GO:0016020)

Reactome top-level categories

Rollup of top-1 pathways:

Category	Pathways
Olfactory Signaling Pathway	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
transmembrane signaling receptor activity	2
sensory perception of smell	1
detection of chemical stimulus involved in sensory perception	1
cell communication	1
cellular process	1
signaling	1
regulation of cellular process	1
cellular response to stimulus	1
G protein-coupled receptor activity	1
signal transduction	1
sensory perception of chemical stimulus	1
G protein-coupled receptor signaling pathway	1
detection of chemical stimulus involved in sensory perception of smell	1
membrane	1
cell periphery	1
cellular anatomical structure	1

Protein interactions and networks

STRING

192 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
OR10H1	NPIPB8	E9PQR5	506
OR10H1	CATSPERB	Q9H7T0	464
OR10H1	NPIPB9	F8W1W9	447
OR10H1	TUFM	P49411	443
OR10H1	EFCAB13	Q8IY85	432
OR10H1	APOBR	Q0VD83	421
OR10H1	APOL4	Q9BPW4	415
OR10H1	RABEP2	Q9H5N1	409
OR10H1	NUPR1	O60356	401
OR10H1	RGPD1	P0C839	392
OR10H1	KIF26B	Q2KJY2	385
OR10H1	TAS2R60	P59551	363
OR10H1	ZNF200	P98182	359
OR10H1	SPATA3	Q8NHX4	348
OR10H1	SPAG8	Q99932	311

IntAct

3 interactions, top by confidence:

A	B	Type	Score
OR10H1	AHNAK	psi-mi:“MI:0915”(physical association)	0.400
OR10H1	NRP1	psi-mi:“MI:0914”(association)	0.350
OR10H1	NPC1	psi-mi:“MI:0914”(association)	0.350

BioGRID (48): OR10H1 (Proximity Label-MS), ADCY3 (Affinity Capture-MS), PIGA (Affinity Capture-MS), NRP1 (Affinity Capture-MS), SARAF (Affinity Capture-MS), AKAP9 (Affinity Capture-MS), ABCC4 (Affinity Capture-MS), NDFIP1 (Affinity Capture-MS), LRIG3 (Affinity Capture-MS), RLBP1 (Affinity Capture-MS), ABCA2 (Affinity Capture-MS), SETD2 (Affinity Capture-MS), ABHD6 (Affinity Capture-MS), ABCC10 (Affinity Capture-MS), DNAJC18 (Affinity Capture-MS)

ESM2 similar proteins: A4D2G3, O60403, O76001, O76002, O76100, O95006, O95047, P23269, P23272, P23274, P30953, P30955, P34984, P58173, P59922, P70526, Q13607, Q15619, Q15622, Q5TZ20, Q60890, Q6IF42, Q7Z3T1, Q8N628, Q8NGA6, Q8NGQ2, Q8NGT7, Q8NGT9, Q8NGX0, Q8NGY5, Q8NGZ4, Q8NGZ5, Q8NGZ6, Q8NHA6, Q8VGD6, Q8VGI1, Q95156, Q96R30, Q96R45, Q96R47

Diamond homologs: A0A2R8YED5, O14581, O43749, O76099, O95221, P0C626, P0C7N1, P0C7N5, P0DN81, P23266, P23275, P30955, P47890, P58173, P58181, P59922, Q15617, Q15619, Q15622, Q60878, Q60881, Q60895, Q6IEU7, Q6UXT6, Q7TQQ0, Q7Z3T1, Q8N0Y5, Q8N146, Q8N162, Q8N628, Q8NG98, Q8NGA1, Q8NGC2, Q8NGE5, Q8NGF4, Q8NGF8, Q8NGG0, Q8NGG3, Q8NGG4, Q8NGG8

SIGNOR signaling

0 interactions.

Disease & clinical

Clinical variants and AI predictions

ClinVar

78 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	55
Likely benign	11
Benign	11

Top pathogenic / likely-pathogenic (0)

SpliceAI

184 predictions. Top by Δscore:

Variant	Effect	Δscore
19:15807229:T:TA	donor_gain	0.5900
19:15807162:GCT:G	acceptor_gain	0.5700
19:15807371:CGA:C	acceptor_gain	0.5700
19:15807290:C:CT	donor_gain	0.5600
19:15807369:CACGA:C	acceptor_gain	0.5600
19:15807381:A:C	acceptor_gain	0.5600
19:15807159:GAGGC:G	acceptor_gain	0.5500
19:15807369:C:T	acceptor_gain	0.5500
19:15807163:C:A	acceptor_gain	0.5400
19:15807288:G:GT	donor_gain	0.5400
19:15807372:G:T	acceptor_gain	0.5400
19:15807293:C:CT	donor_gain	0.5200
19:15807672:G:C	donor_gain	0.5200
19:15807134:TGGCG:T	donor_gain	0.5100
19:15807294:CACAG:C	acceptor_gain	0.5000
19:15807380:CA:C	acceptor_gain	0.5000
19:15807225:T:TA	donor_gain	0.4900
19:15807288:GAC:G	donor_gain	0.4800
19:15807366:G:T	acceptor_gain	0.4700
19:15807138:G:GT	donor_gain	0.4500
19:15807161:GGCT:G	acceptor_gain	0.4500
19:15807164:T:A	acceptor_gain	0.4500
19:15807373:A:AC	acceptor_gain	0.4500
19:15807373:A:C	acceptor_gain	0.4500
19:15807176:GGCT:G	acceptor_gain	0.4400
19:15807177:GCTG:G	acceptor_gain	0.4400
19:15807254:T:TA	donor_gain	0.4400
19:15807155:T:TA	donor_gain	0.4300
19:15807175:GGGCT:G	acceptor_gain	0.4300
19:15807287:CGA:C	donor_gain	0.4300

AlphaMissense

2087 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
19:15807165:G:C	F291L	0.979
19:15807165:G:T	F291L	0.979
19:15807167:A:G	F291L	0.979
19:15807177:G:C	S287R	0.971
19:15807177:G:T	S287R	0.971
19:15807179:T:G	S287R	0.971
19:15807162:G:C	S292R	0.970
19:15807162:G:T	S292R	0.970
19:15807164:T:G	S292R	0.970
19:15807507:A:C	F177L	0.954
19:15807507:A:T	F177L	0.954
19:15807509:A:G	F177L	0.954
19:15807987:G:C	F17L	0.954
19:15807987:G:T	F17L	0.954
19:15807989:A:G	F17L	0.954
19:15808002:G:C	F12L	0.946
19:15808002:G:T	F12L	0.946
19:15808004:A:G	F12L	0.946
19:15807673:C:G	R122P	0.944
19:15807683:C:G	G119R	0.942
19:15807684:C:A	M118I	0.942
19:15807684:C:G	M118I	0.942
19:15807684:C:T	M118I	0.942
19:15807534:G:C	F168L	0.941
19:15807534:G:T	F168L	0.941
19:15807536:A:G	F168L	0.941
19:15807166:A:G	F291S	0.940
19:15807593:A:G	W149R	0.940
19:15807593:A:T	W149R	0.940
19:15807720:G:C	S106R	0.939

dbSNP variants (sampled 300 via entrez): RS1001005208 (19:15808835 C>A,G,T), RS1001187554 (19:15811414 G>T), RS1001401373 (19:15816310 G>C), RS1001656274 (19:15806034 C>T), RS1001727166 (19:15806339 C>T), RS1001863758 (19:15813719 GGTGGGGAGAGAGAA>G,GGTGGGGAGAGAGAAGTGGGGAGAGAGAA), RS1002305089 (19:15804221 T>C), RS1002582503 (19:15816487 A>T), RS1002665930 (19:15816224 G>A), RS1003138280 (19:15804988 T>C), RS1003675973 (19:15815243 A>T), RS1003697920 (19:15815428 C>G,T), RS1003758222 (19:15809924 T>C), RS1004868317 (19:15815195 G>A), RS1004928394 (19:15809601 G>A,C)

Disease associations

OMIM: gene `` | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

1 associations (top):

Study	Trait	p-value
GCST90011899_162	Aspartate aminotransferase levels	3.000000e-08

EFO canonical traits (1, from GWAS)

EFO ID	Trait name
EFO:0004736	aspartate aminotransferase measurement

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

5 total (human), top 5 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
aristolochic acid I	increases expression	1
4-nonylphenol	affects cotreatment, increases expression	1
CGP 52608	affects binding, increases reaction	1
4-tert-octylphenol	affects cotreatment, increases expression	1
Benzo(a)pyrene	increases methylation	1

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.