OR3A3

Summary

OR3A3 (olfactory receptor family 3 subfamily A member 3, HGNC:8284) is a protein-coding gene on chromosome 17p13.2, encoding Olfactory receptor 3A3 (P47888). Odorant receptor.

Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome.

Source: NCBI Gene 8392 — RefSeq curated summary.

At a glance

• Clinical variants (ClinVar): 37 total
• MANE Select transcript: NM_012373

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:8284
Approved symbol	OR3A3
Name	olfactory receptor family 3 subfamily A member 3
Location	17p13.2
Locus type	gene with protein product
Status	Approved
Aliases	OR17-201, OR17-137, OR17-16
Ensembl gene	ENSG00000159961
Ensembl biotype	protein_coding
Entrez	8392

Gene structure

Transcript identifiers

Ensembl transcripts: 2 — 2 protein_coding

ENST00000574571, ENST00000641141

RefSeq mRNA: 2 — MANE Select: NM_012373 NM_001386098, NM_012373

CCDS: CCDS11025

Canonical transcript exons

ENST00000641141 — 3 exons

Exon	Start	End
ENSE00003812028	3420580	3424070
ENSE00003812227	3411978	3412171
ENSE00003813594	3411370	3411484

Expression profiles

Bgee: expression breadth broad, 38 present calls, max score 79.44.

Top tissues by expression

230 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
pancreatic ductal cell	CL:0002079	79.44	silver quality
cervix squamous epithelium	UBERON:0006922	73.45	gold quality
tibialis anterior	UBERON:0001385	68.59	silver quality
epithelial cell of pancreas	CL:0000083	68.28	gold quality
male germ line stem cell (sensu Vertebrata) in testis	CL:0000089 ∩ UBERON:0000473	67.96	silver quality
tongue squamous epithelium	UBERON:0006919	65.50	gold quality
orbitofrontal cortex	UBERON:0004167	65.09	gold quality
triceps brachii	UBERON:0001509	64.34	gold quality
gluteal muscle	UBERON:0002000	64.19	gold quality
cervix epithelium	UBERON:0004801	62.72	gold quality
parotid gland	UBERON:0001831	62.70	gold quality
olfactory bulb	UBERON:0002264	60.81	gold quality
type B pancreatic cell	CL:0000169	60.56	gold quality
nasal cavity epithelium	UBERON:0005384	59.78	gold quality
myocardium	UBERON:0002349	59.41	gold quality
skeletal muscle tissue of biceps brachii	UBERON:0004502	59.26	gold quality
Brodmann (1909) area 46	UBERON:0006483	58.91	gold quality
mucosa of urinary bladder	UBERON:0001259	58.62	gold quality
cartilage tissue	UBERON:0002418	58.24	gold quality
thymus	UBERON:0002370	58.19	gold quality
layer of synovial tissue	UBERON:0007616	57.59	gold quality
decidua	UBERON:0002450	56.79	gold quality
endothelial cell	CL:0000115	56.73	gold quality
mucosa of sigmoid colon	UBERON:0004993	56.22	gold quality
heart right ventricle	UBERON:0002080	55.94	gold quality
oviduct epithelium	UBERON:0004804	55.89	gold quality
oocyte	CL:0000023	55.82	gold quality
nipple	UBERON:0002030	55.67	gold quality
biceps brachii	UBERON:0001507	55.58	gold quality
cranial nerve II	UBERON:0000941	54.89	silver quality

Single-cell (SCXA)

Detected in 1 experiment(s), a significant marker in 1.

Experiment	Marker?	Max mean expression
E-ANND-3	yes	3.76

Regulation

Is transcription factor: no

Cross-species orthologs

0 orthologs

Paralogs (130): OR1I1 (ENSG00000094661), OR12D3 (ENSG00000112462), OR7A10 (ENSG00000127515), OR7C2 (ENSG00000127529), OR7C1 (ENSG00000127530), OR1E2 (ENSG00000127780), OR1J1 (ENSG00000136834), OR1L4 (ENSG00000136939), OR4D1 (ENSG00000141194), OR4K1 (ENSG00000155249), OR7G1 (ENSG00000161807), OR1Q1 (ENSG00000165202), OR1K1 (ENSG00000165204), OR4K2 (ENSG00000165762), OR4D6 (ENSG00000166884), OR1F1 (ENSG00000168124), OR4K14 (ENSG00000169484), OR4K15 (ENSG00000169488), OR7G3 (ENSG00000170920), OR7G2 (ENSG00000170923), OR1M1 (ENSG00000170929), OR4D5 (ENSG00000171014), OR1L6 (ENSG00000171459), OR1L3 (ENSG00000171481), OR1L8 (ENSG00000171496), OR1N2 (ENSG00000171501), OR1N1 (ENSG00000171505), OR2AT4 (ENSG00000171561), OR1A1 (ENSG00000172146), OR1A2 (ENSG00000172150), OR4C11 (ENSG00000172188), OR4X2 (ENSG00000172208), OR4D9 (ENSG00000172742), OR10K1 (ENSG00000173285), OR1L1 (ENSG00000173679), OR7D4 (ENSG00000174667), OR4S2 (ENSG00000174982), OR4B1 (ENSG00000175619), OR4D11 (ENSG00000176200), OR4K17 (ENSG00000176230)

Protein

Protein identifiers

Olfactory receptor 3A3 — P47888 (reviewed: P47888)

Alternative names: Olfactory receptor 17-201, Olfactory receptor 3A6, Olfactory receptor 3A7, Olfactory receptor 3A8, Olfactory receptor OR17-22

All UniProt accessions (1): A0A126GWB3

UniProt curated annotations — full annotation on UniProt →

Function. Odorant receptor.

Subcellular location. Cell membrane.

Similarity. Belongs to the G-protein coupled receptor 1 family.

RefSeq proteins (2): NP_001373027, NP_036505* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR000276	GPCR_Rhodpsn	Family
IPR000725	Olfact_rcpt	Family
IPR017452	GPCR_Rhodpsn_7TM	Domain

Pfam: PF13853

UniProt features (26 total): topological domain 8, transmembrane region 7, sequence variant 4, sequence conflict 4, chain 1, glycosylation site 1, disulfide bond 1

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-P47888-F1	86.24	0.60

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Disulfide bonds (1): 106–198

Glycosylation sites (1): 14

Function

Pathways and Gene Ontology

Reactome pathways

1 pathways

ID	Pathway
R-HSA-9752946	Expression and translocation of olfactory receptors

MSigDB gene sets: 29 (showing top): GOBP_SENSORY_PERCEPTION_OF_CHEMICAL_STIMULUS, KEGG_OLFACTORY_TRANSDUCTION, GOBP_DETECTION_OF_STIMULUS, GOBP_SENSORY_PERCEPTION, SHEN_SMARCA2_TARGETS_DN, GOMF_OLFACTORY_RECEPTOR_ACTIVITY, GOMF_TRANSMEMBRANE_SIGNALING_RECEPTOR_ACTIVITY, LIU_NASOPHARYNGEAL_CARCINOMA, GOMF_G_PROTEIN_COUPLED_RECEPTOR_ACTIVITY, GOBP_SENSORY_PERCEPTION_OF_SMELL, GOBP_G_PROTEIN_COUPLED_RECEPTOR_SIGNALING_PATHWAY, GOBP_DETECTION_OF_STIMULUS_INVOLVED_IN_SENSORY_PERCEPTION, KRAS.LUNG_UP.V1_DN, GSE14000_TRANSLATED_RNA_VS_MRNA_DC_DN, WP_GPCRS_CLASS_A_RHODOPSINLIKE

GO Biological Process (4): signal transduction (GO:0007165), G protein-coupled receptor signaling pathway (GO:0007186), sensory perception of smell (GO:0007608), detection of chemical stimulus involved in sensory perception of smell (GO:0050911)

GO Molecular Function (2): G protein-coupled receptor activity (GO:0004930), olfactory receptor activity (GO:0004984)

GO Cellular Component (2): plasma membrane (GO:0005886), membrane (GO:0016020)

Reactome top-level categories

Rollup of top-1 pathways:

Category	Pathways
Olfactory Signaling Pathway	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
transmembrane signaling receptor activity	2
cell communication	1
cellular process	1
signaling	1
regulation of cellular process	1
cellular response to stimulus	1
G protein-coupled receptor activity	1
signal transduction	1
sensory perception of chemical stimulus	1
sensory perception of smell	1
detection of chemical stimulus involved in sensory perception	1
G protein-coupled receptor signaling pathway	1
detection of chemical stimulus involved in sensory perception of smell	1
membrane	1
cell periphery	1
cellular anatomical structure	1

Protein interactions and networks

STRING

76 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
OR3A3	MYO3B	Q8WXR4	511
OR3A3	TAS2R39	P59534	507
OR3A3	MYO18B	Q8IUG5	500
OR3A3	ACAD10	Q6JQN1	416
OR3A3	MYOM1	P52179	352
OR3A3	MYH10	P35580	337
OR3A3	MAPKAPK5	Q8IW41	336
OR3A3	MYH3	P11055	310
OR3A3	PIP	P12273	278
OR3A3	LDLR	P01130	256
OR3A3	KIF26B	Q2KJY2	252
OR3A3	ALDH2	P05091	220
OR3A3	MYO18A	Q92614	207
OR3A3	MID1	O15344	202
OR3A3	CNGA2	Q16280	201

IntAct

0 interactions, top by confidence:

ESM2 similar proteins: A6NH00, O60403, O95371, O95918, P23266, P23267, P23275, P34984, P47881, P47888, P47893, Q15619, Q5JQS5, Q5TZ20, Q60885, Q60891, Q60894, Q6IEZ7, Q7Z3T1, Q8N628, Q8NG76, Q8NG77, Q8NG97, Q8NGA6, Q8NGC4, Q8NGE3, Q8NGE9, Q8NGQ2, Q8NGQ4, Q8NGR4, Q8NGS0, Q8NGT9, Q8NGX9, Q8NGY1, Q8NGZ6, Q8NH02, Q8NH03, Q8NH04, Q8NHB1, Q8VGD6

Diamond homologs: O14581, O43749, O60412, O60431, O76001, O76099, O76100, P0DN82, P23265, P23266, P23268, P23269, P23271, P23272, P23273, P23274, P30953, P30955, P34982, P34987, P35896, P35898, P35899, P47881, P47884, P47887, P47888, P47890, P58170, P58173, P59922, P70526, Q0VAX9, Q15619, Q15620, Q15622, Q60879, Q60882, Q60884, Q60890

SIGNOR signaling

0 interactions.

Disease & clinical

Clinical variants and AI predictions

ClinVar

37 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	34
Likely benign	3
Benign	0

Top pathogenic / likely-pathogenic (0)

SpliceAI

234 predictions. Top by Δscore:

Variant	Effect	Δscore
17:3420809:G:GT	donor_gain	0.9300
17:3421022:T:G	donor_gain	0.6600
17:3420770:T:G	donor_gain	0.6200
17:3420802:G:GT	donor_gain	0.6100
17:3421111:G:GT	donor_gain	0.6000
17:3421377:GC:G	donor_gain	0.6000
17:3420794:C:A	donor_gain	0.5900
17:3421019:GGAT:G	donor_gain	0.5800
17:3421020:GATG:G	donor_gain	0.5800
17:3421405:GA:G	donor_gain	0.5700
17:3421030:GC:G	donor_gain	0.5600
17:3421025:T:A	donor_gain	0.5500
17:3421336:G:GG	donor_gain	0.5500
17:3420811:T:G	donor_gain	0.5400
17:3421027:GTGGC:G	donor_gain	0.5400
17:3421028:TGGCT:T	donor_gain	0.5400
17:3421029:GGCTG:G	donor_gain	0.5400
17:3421406:A:G	donor_gain	0.5400
17:3420843:T:TA	donor_gain	0.5300
17:3421368:C:G	donor_gain	0.5300
17:3421030:GCTGC:G	donor_gain	0.5200
17:3421333:GTG:G	donor_gain	0.5200
17:3420747:G:GA	donor_gain	0.5100
17:3420775:T:G	donor_gain	0.5100
17:3421000:A:G	donor_gain	0.5100
17:3421257:G:GC	donor_gain	0.5100
17:3420623:C:G	donor_gain	0.5000
17:3420806:TCGG:T	donor_gain	0.5000
17:3421006:C:A	donor_gain	0.5000
17:3421260:A:AG	donor_gain	0.5000

AlphaMissense

0 scored. Top likely-pathogenic:

dbSNP variants (sampled 300 via entrez): RS1000099916 (17:3411575 AGGAGAATGGTGTGAACCTG>A,AGGAGAATGGTGTGAACCTGGGAGAATGGTGTGAACCTG), RS1000128601 (17:3420944 C>A,T), RS1000366073 (17:3415809 TTATTATTATTA>T), RS1000442391 (17:3422146 G>A), RS1000452194 (17:3421880 T>C), RS1000891007 (17:3409627 G>A,T), RS1000974660 (17:3417570 G>T), RS1001029774 (17:3411279 C>T), RS1001300920 (17:3417249 T>G), RS1001583081 (17:3424099 A>G), RS1001637432 (17:3414275 G>A), RS1001963557 (17:3414134 C>T), RS1002122730 (17:3420308 T>A,G), RS1002641538 (17:3422981 A>G), RS1002810480 (17:3418037 C>T)

Disease associations

OMIM: gene `` | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

0 associations (top):

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

7 total (human), top 7 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
propionaldehyde	decreases expression	1
Grape Seed Proanthocyanidins	affects cotreatment, increases expression	1
theaflavin-3,3’-digallate	affects expression	1
Cadmium	decreases expression, increases abundance	1
Catechin	affects cotreatment, increases expression	1
Folic Acid	decreases expression	1
Cadmium Chloride	increases abundance, decreases expression	1

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.