OR8B8

Summary

OR8B8 (olfactory receptor family 8 subfamily B member 8, HGNC:8477) is a protein-coding gene on chromosome 11q24.2, encoding Olfactory receptor 8B8 (Q15620). Odorant receptor (Potential).

Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome.

Source: NCBI Gene 26493 — RefSeq curated summary.

At a glance

• GWAS associations: 1
• Clinical variants (ClinVar): 42 total
• MANE Select transcript: NM_012378

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:8477
Approved symbol	OR8B8
Name	olfactory receptor family 8 subfamily B member 8
Location	11q24.2
Locus type	gene with protein product
Status	Approved
Aliases	TPCR85
Ensembl gene	ENSG00000197125
Ensembl biotype	protein_coding
Entrez	26493

Gene structure

Transcript identifiers

Ensembl transcripts: 2 — 2 protein_coding

ENST00000328064, ENST00000642064

RefSeq mRNA: 1 — MANE Select: NM_012378 NM_012378

CCDS: CCDS8446

Canonical transcript exons

ENST00000642064 — 3 exons

Exon	Start	End
ENSE00003812041	124445576	124445696
ENSE00003814027	124437445	124441101
ENSE00003814212	124441488	124441623

Expression profiles

Bgee: expression breadth tissue_specific, 2 present calls, max score 52.89.

Top tissues by expression

240 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
buccal mucosa cell	CL:0002336	52.89	gold quality
skin of hip	UBERON:0001554	49.87	silver quality
vastus lateralis	UBERON:0001379	46.72	gold quality
quadriceps femoris	UBERON:0001377	46.56	gold quality
sural nerve	UBERON:0015488	46.19	gold quality
upper leg skin	UBERON:0004262	43.71	silver quality
skeletal muscle tissue of rectus abdominis	UBERON:0004511	43.37	gold quality
secondary oocyte	CL:0000655	42.57	gold quality
superficial temporal artery	UBERON:0001614	41.33	gold quality
palpebral conjunctiva	UBERON:0001812	41.10	gold quality
dorsal plus ventral thalamus	UBERON:0001897	41.06	gold quality
mucosa of paranasal sinus	UBERON:0005030	40.98	gold quality
subthalamic nucleus	UBERON:0001906	40.74	gold quality
amniotic fluid	UBERON:0000173	40.69	gold quality
jejunal mucosa	UBERON:0000399	40.59	gold quality
biceps brachii	UBERON:0001507	40.57	gold quality
epithelium of nasopharynx	UBERON:0001951	40.45	gold quality
myocardium	UBERON:0002349	40.45	gold quality
gingival epithelium	UBERON:0001949	40.43	gold quality
germinal epithelium of ovary	UBERON:0001304	40.33	gold quality
esophagus squamous epithelium	UBERON:0006920	40.29	gold quality
skeletal muscle tissue of biceps brachii	UBERON:0004502	40.27	gold quality
jejunum	UBERON:0002115	40.18	gold quality
cartilage tissue	UBERON:0002418	40.06	gold quality
oviduct epithelium	UBERON:0004804	40.03	gold quality
mammary duct	UBERON:0001765	39.98	gold quality
mucosa of sigmoid colon	UBERON:0004993	39.95	gold quality
deltoid	UBERON:0001476	39.83	gold quality
saphenous vein	UBERON:0007318	39.83	gold quality
parotid gland	UBERON:0001831	39.81	gold quality

Single-cell (SCXA)

Detected in 1 experiment(s), a significant marker in 1.

Experiment	Marker?	Max mean expression
E-ANND-3	yes	3.44

Regulation

Is transcription factor: no

Cross-species orthologs

2 orthologs

Organism	Symbol	Gene ID
mus_musculus	Or8b8	ENSMUSG00000066748
rattus_norvegicus	Or8b8	ENSRNOG00000083397

Paralogs (96): OR5C1 (ENSG00000148215), OR5F1 (ENSG00000149133), OR8K1 (ENSG00000150261), OR5M9 (ENSG00000150269), OR14K1 (ENSG00000153230), OR8J3 (ENSG00000167822), OR5I1 (ENSG00000167825), OR5AU1 (ENSG00000169327), OR9K2 (ENSG00000170605), OR8B12 (ENSG00000170953), OR10H3 (ENSG00000171936), OR8I2 (ENSG00000172154), OR8U1 (ENSG00000172199), OR10V1 (ENSG00000172289), OR5A1 (ENSG00000172320), OR5A2 (ENSG00000172324), OR5B12 (ENSG00000172362), OR5B2 (ENSG00000172365), OR9I1 (ENSG00000172377), OR9G4 (ENSG00000172457), OR5AR1 (ENSG00000172459), OR5AP2 (ENSG00000172464), OR8J1 (ENSG00000172487), OR5B3 (ENSG00000172769), OR10W1 (ENSG00000172772), OR5M3 (ENSG00000174937), OR5J2 (ENSG00000174957), OR10H4 (ENSG00000176231), OR5AN1 (ENSG00000176495), OR14C36 (ENSG00000177174), OR6B3 (ENSG00000178586), OR10Q1 (ENSG00000180475), OR8G2P (ENSG00000181214), OR5AK2 (ENSG00000181273), OR5AK3P (ENSG00000181282), OR5M8 (ENSG00000181371), OR8D4 (ENSG00000181518), OR8H1 (ENSG00000181693), OR8K5 (ENSG00000181752), OR8H3 (ENSG00000181761)

Protein

Protein identifiers

Olfactory receptor 8B8 — Q15620 (reviewed: Q15620)

Alternative names: Olfactory receptor TPCR85, Olfactory-like receptor JCG8

All UniProt accessions (2): A0A126GW73, Q15620

UniProt curated annotations — full annotation on UniProt →

Function. Odorant receptor (Potential). May be involved in taste perception.

Subcellular location. Cell membrane.

Tissue specificity. Expressed in the tongue and testis.

Similarity. Belongs to the G-protein coupled receptor 1 family.

RefSeq proteins (1): NP_036510* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR000276	GPCR_Rhodpsn	Family
IPR000725	Olfact_rcpt	Family
IPR017452	GPCR_Rhodpsn_7TM	Domain

Pfam: PF13853

UniProt features (19 total): topological domain 8, transmembrane region 7, chain 1, glycosylation site 1, disulfide bond 1, sequence conflict 1

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q15620-F1	90.05	0.74

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Disulfide bonds (1): 97–189

Glycosylation sites (1): 5

Function

Pathways and Gene Ontology

Reactome pathways

1 pathways

ID	Pathway
R-HSA-9752946	Expression and translocation of olfactory receptors

MSigDB gene sets: 31 (showing top): GOBP_SENSORY_PERCEPTION_OF_CHEMICAL_STIMULUS, KEGG_OLFACTORY_TRANSDUCTION, GOBP_DETECTION_OF_STIMULUS, GOBP_SENSORY_PERCEPTION, GOMF_OLFACTORY_RECEPTOR_ACTIVITY, GOMF_TRANSMEMBRANE_SIGNALING_RECEPTOR_ACTIVITY, chr11q24, GOMF_ODORANT_BINDING, GOMF_G_PROTEIN_COUPLED_RECEPTOR_ACTIVITY, GOBP_SENSORY_PERCEPTION_OF_SMELL, GOBP_G_PROTEIN_COUPLED_RECEPTOR_SIGNALING_PATHWAY, GOBP_DETECTION_OF_STIMULUS_INVOLVED_IN_SENSORY_PERCEPTION, TGACAGNY_MEIS1_01, WP_GPCRS_CLASS_A_RHODOPSINLIKE, REACTOME_OLFACTORY_SIGNALING_PATHWAY

GO Biological Process (4): G protein-coupled receptor signaling pathway (GO:0007186), sensory perception of smell (GO:0007608), signal transduction (GO:0007165), detection of chemical stimulus involved in sensory perception of smell (GO:0050911)

GO Molecular Function (3): G protein-coupled receptor activity (GO:0004930), olfactory receptor activity (GO:0004984), odorant binding (GO:0005549)

GO Cellular Component (2): plasma membrane (GO:0005886), membrane (GO:0016020)

Reactome top-level categories

Rollup of top-1 pathways:

Category	Pathways
Olfactory Signaling Pathway	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
transmembrane signaling receptor activity	2
G protein-coupled receptor activity	1
signal transduction	1
sensory perception of chemical stimulus	1
cell communication	1
cellular process	1
signaling	1
regulation of cellular process	1
cellular response to stimulus	1
sensory perception of smell	1
detection of chemical stimulus involved in sensory perception	1
G protein-coupled receptor signaling pathway	1
detection of chemical stimulus involved in sensory perception of smell	1
binding	1
membrane	1
cell periphery	1
cellular anatomical structure	1

Protein interactions and networks

STRING

188 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
OR8B8	CCDC198	Q9NVL8	488
OR8B8	ZNF425	Q6IV72	448
OR8B8	HDDC2	Q7Z4H3	435
OR8B8	ZNF781	Q8N8C0	419
OR8B8	SLC35F4	A4IF30	419
OR8B8	CALHM3	Q86XJ0	374
OR8B8	PCED1B	Q96HM7	371
OR8B8	OR7G1	Q8NGA0	365
OR8B8	MTMR12	Q9C0I1	359
OR8B8	ZNF699	Q32M78	350
OR8B8	JADE2	Q9NQC1	345
OR8B8	OR4D6	Q8NGJ1	325
OR8B8	NPBWR2	P48146	316
OR8B8	RCAN3	Q9UKA8	307
OR8B8	HABP4	Q5JVS0	301

IntAct

2 interactions, top by confidence:

A	B	Type	Score
OR8B8	YLPM1	psi-mi:“MI:0914”(association)	0.350

BioGRID (3): PBRM1 (Affinity Capture-MS), YLPM1 (Affinity Capture-MS), BRD7 (Affinity Capture-MS)

ESM2 similar proteins: A6NCV1, A6NF89, A6NJZ3, A6NL08, A6NM76, O76000, O95007, O95221, P0C626, P0C629, P30955, P37070, P70526, Q15617, Q15620, Q60882, Q60893, Q60895, Q6IEU7, Q8N0Y5, Q8N162, Q8NGE1, Q8NGG4, Q8NGG8, Q8NGH3, Q8NGL1, Q8NGP8, Q8NGP9, Q8NGR5, Q8NGR8, Q8NGS4, Q8NGT1, Q8NGX3, Q8NH01, Q8VEW5, Q8VF66, Q8VF76, Q8VFD0, Q8VFD3, Q8VFK2

Diamond homologs: A6NDH6, A6NET4, A6NHG9, A6NKK0, A6NL26, A6NMS3, O95221, P0C626, P0C628, P0C7N1, P0C7N5, P0DMU2, P0DN80, P34985, P37068, P37070, P37071, P37072, Q13606, Q15617, Q15620, Q60880, Q60882, Q60884, Q60886, Q60893, Q60894, Q6UXT6, Q7TS48, Q8N127, Q8N146, Q8N162, Q8NG75, Q8NG78, Q8NGC0, Q8NGF4, Q8NGF7, Q8NGG0, Q8NGG1, Q8NGG2

SIGNOR signaling

0 interactions.

Disease & clinical

Clinical variants and AI predictions

ClinVar

42 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	39
Likely benign	3
Benign	0

Top pathogenic / likely-pathogenic (0)

SpliceAI

178 predictions. Top by Δscore:

Variant	Effect	Δscore
11:124440983:AGAAG:A	donor_gain	0.9800
11:124441021:C:CA	donor_gain	0.9800
11:124440941:T:C	donor_gain	0.9600
11:124441036:AAG:A	donor_gain	0.9000
11:124441022:C:A	donor_gain	0.8500
11:124440977:C:CT	donor_gain	0.7700
11:124440680:TGGTG:T	donor_gain	0.7400
11:124440798:C:CA	donor_gain	0.6900
11:124440415:C:CC	acceptor_gain	0.6500
11:124440795:ACAC:A	donor_gain	0.6400
11:124440796:CACC:C	donor_gain	0.6400
11:124440379:TTGG:T	donor_gain	0.6100
11:124440913:G:C	donor_gain	0.6000
11:124440968:C:CT	donor_gain	0.6000
11:124440413:TG:T	acceptor_gain	0.5800
11:124440940:A:AC	donor_gain	0.5800
11:124440963:C:A	donor_gain	0.5700
11:124440969:CACAG:C	donor_gain	0.5700
11:124440912:A:AC	donor_gain	0.5300
11:124440940:AT:A	donor_gain	0.5000
11:124440965:C:T	donor_gain	0.5000
11:124440970:A:T	donor_gain	0.4900
11:124440410:AGATG:A	acceptor_loss	0.4800
11:124440413:TGCT:T	acceptor_loss	0.4800
11:124440414:GCTGG:G	acceptor_loss	0.4800
11:124440415:C:G	acceptor_loss	0.4800
11:124440416:T:A	acceptor_loss	0.4800
11:124440664:CACA:C	donor_loss	0.4800
11:124440665:ACACC:A	donor_loss	0.4800
11:124440666:CA:C	donor_loss	0.4800

AlphaMissense

2072 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
11:124440213:G:C	S291R	0.903
11:124440213:G:T	S291R	0.903
11:124440215:T:G	S291R	0.903
11:124440721:C:G	R122P	0.903
11:124441050:A:C	F12L	0.902
11:124441050:A:T	F12L	0.902
11:124441052:A:G	F12L	0.902
11:124440861:A:C	S75R	0.887
11:124440861:A:T	S75R	0.887
11:124440863:T:G	S75R	0.887
11:124440732:C:A	M118I	0.882
11:124440732:C:G	M118I	0.882
11:124440732:C:T	M118I	0.882
11:124440582:G:C	F168L	0.881
11:124440582:G:T	F168L	0.881
11:124440584:A:G	F168L	0.881
11:124440330:A:C	F252L	0.855
11:124440330:A:T	F252L	0.855
11:124440332:A:G	F252L	0.855
11:124440730:G:T	A119E	0.855
11:124440378:T:A	K236N	0.845
11:124440378:T:G	K236N	0.845
11:124440360:G:C	S242R	0.841
11:124440360:G:T	S242R	0.841
11:124440362:T:G	S242R	0.841
11:124440960:G:C	N42K	0.825
11:124440960:G:T	N42K	0.825
11:124440228:G:C	N286K	0.822
11:124440228:G:T	N286K	0.822
11:124440723:G:C	D121E	0.822

dbSNP variants (sampled 300 via entrez): RS1000082699 (11:124446195 T>C), RS1000497890 (11:124439943 C>T), RS1000810891 (11:124439880 C>T), RS1000946071 (11:124440154 G>A,C,T), RS1001279964 (11:124438783 A>G), RS1002080262 (11:124443382 T>A,G), RS1002153561 (11:124444594 C>T), RS1002166829 (11:124438328 CT>C), RS1002278766 (11:124438991 G>A), RS1002441320 (11:124443199 G>A), RS1002556980 (11:124437407 C>G,T), RS1002856525 (11:124437400 T>C), RS1003018797 (11:124437647 TGTGTGTGTGTGTGTGTGTGTGC>T), RS1003020212 (11:124443298 A>C), RS1003403102 (11:124437645 T>C)

Disease associations

OMIM: gene `` | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

1 associations (top):

Study	Trait	p-value
GCST010796_2653	Electrocardiogram morphology (amplitude at temporal datapoints)	4.000000e-08

EFO canonical traits (1, from GWAS)

EFO ID	Trait name
EFO:0004327	electrocardiography

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

19 total (human), top 19 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
bisphenol A	affects cotreatment, decreases expression	1
benzo(e)pyrene	increases methylation	1
CGP 52608	affects binding, increases reaction	1
Resveratrol	affects cotreatment, decreases expression	1
Azacitidine	increases expression	1
Benzo(a)pyrene	affects methylation	1
Cadmium	increases abundance, increases expression	1
Dexamethasone	affects cotreatment, decreases expression	1
Bucladesine	affects cotreatment, increases expression	1
Estradiol	affects cotreatment, increases expression	1
Folic Acid	decreases expression	1
Indomethacin	affects cotreatment, decreases expression	1
Methapyrilene	increases methylation	1
Plant Extracts	affects cotreatment, decreases expression	1
Tretinoin	decreases expression	1
1-Methyl-3-isobutylxanthine	affects cotreatment, decreases expression	1
Medroxyprogesterone Acetate	affects cotreatment, increases expression	1
Asbestos, Crocidolite	affects expression	1
Cadmium Chloride	increases abundance, increases expression	1

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.