OR8D4
gene geneOn this page
Summary
OR8D4 (olfactory receptor family 8 subfamily D member 4, HGNC:14840) is a protein-coding gene on chromosome 11q24.1, encoding Olfactory receptor 8D4 (Q8NGM9). Odorant receptor.
Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome.
Source: NCBI Gene 338662 — RefSeq curated summary.
At a glance
- GWAS associations: 1
- Clinical variants (ClinVar): 36 total
- MANE Select transcript:
NM_001005197
Identifiers
Gene identifiers
| Field | Value |
|---|---|
| HGNC ID | HGNC:14840 |
| Approved symbol | OR8D4 |
| Name | olfactory receptor family 8 subfamily D member 4 |
| Location | 11q24.1 |
| Locus type | gene with protein product |
| Status | Approved |
| Ensembl gene | ENSG00000181518 |
| Ensembl biotype | protein_coding |
| Entrez | 338662 |
Gene structure
Transcript identifiers
Ensembl transcripts: 2 — 2 protein_coding
ENST00000321355, ENST00000641687
RefSeq mRNA: 1 — MANE Select: NM_001005197
NM_001005197
CCDS: CCDS31698
Canonical transcript exons
ENST00000641687 — 2 exons
| Exon | Start | End |
|---|---|---|
| ENSE00003811655 | 123902167 | 123902257 |
| ENSE00003811911 | 123906417 | 123909229 |
Expression profiles
Bgee: expression breadth tissue_specific, 4 present calls, max score 76.57.
Top tissues by expression
123 total, by Bgee expression score (0-100, higher = more expressed):
| Tissue | Anatomy ID | Expression score | Quality |
|---|---|---|---|
| male germ line stem cell (sensu Vertebrata) in testis | CL:0000089 ∩ UBERON:0000473 | 76.57 | gold quality |
| body of pancreas | UBERON:0001150 | 45.40 | silver quality |
| colonic epithelium | UBERON:0000397 | 41.45 | gold quality |
| pancreas | UBERON:0001264 | 39.96 | silver quality |
| cortical plate | UBERON:0005343 | 39.84 | gold quality |
| bone marrow cell | CL:0002092 | 38.28 | gold quality |
| ventricular zone | UBERON:0003053 | 36.48 | gold quality |
| sural nerve | UBERON:0015488 | 35.70 | gold quality |
| monocyte | CL:0000576 | 35.36 | gold quality |
| mucosa of transverse colon | UBERON:0004991 | 35.34 | gold quality |
| leukocyte | CL:0000738 | 34.66 | gold quality |
| prefrontal cortex | UBERON:0000451 | 34.39 | gold quality |
| skeletal muscle tissue | UBERON:0001134 | 33.38 | gold quality |
| bone marrow | UBERON:0002371 | 32.82 | gold quality |
| muscle tissue | UBERON:0002385 | 32.15 | gold quality |
| hindlimb stylopod muscle | UBERON:0004252 | 32.15 | gold quality |
| urinary bladder | UBERON:0001255 | 31.73 | gold quality |
| frontal cortex | UBERON:0001870 | 30.80 | gold quality |
| liver | UBERON:0002107 | 30.80 | gold quality |
| tonsil | UBERON:0002372 | 30.25 | gold quality |
| primary visual cortex | UBERON:0002436 | 30.09 | gold quality |
| stromal cell of endometrium | CL:0002255 | 29.87 | gold quality |
| superior frontal gyrus | UBERON:0002661 | 29.84 | gold quality |
| vermiform appendix | UBERON:0001154 | 29.26 | gold quality |
| placenta | UBERON:0001987 | 29.20 | gold quality |
| blood | UBERON:0000178 | 28.64 | gold quality |
| calcaneal tendon | UBERON:0003701 | 28.45 | gold quality |
| gall bladder | UBERON:0002110 | 28.44 | gold quality |
| duodenum | UBERON:0002114 | 28.14 | gold quality |
| lymph node | UBERON:0000029 | 27.57 | gold quality |
Single-cell (SCXA)
Detected in 1 experiment(s), a significant marker in 1.
| Experiment | Marker? | Max mean expression |
|---|---|---|
| E-ANND-3 | yes | 5.67 |
Regulation
Is transcription factor: no
Cross-species orthologs
2 orthologs
| Organism | Symbol | Gene ID |
|---|---|---|
| mus_musculus | Or8d4 | ENSMUSG00000049073 |
| rattus_norvegicus | Or8d4 | ENSRNOG00000053238 |
Paralogs (96): OR5C1 (ENSG00000148215), OR5F1 (ENSG00000149133), OR8K1 (ENSG00000150261), OR5M9 (ENSG00000150269), OR14K1 (ENSG00000153230), OR8J3 (ENSG00000167822), OR5I1 (ENSG00000167825), OR5AU1 (ENSG00000169327), OR9K2 (ENSG00000170605), OR8B12 (ENSG00000170953), OR10H3 (ENSG00000171936), OR8I2 (ENSG00000172154), OR8U1 (ENSG00000172199), OR10V1 (ENSG00000172289), OR5A1 (ENSG00000172320), OR5A2 (ENSG00000172324), OR5B12 (ENSG00000172362), OR5B2 (ENSG00000172365), OR9I1 (ENSG00000172377), OR9G4 (ENSG00000172457), OR5AR1 (ENSG00000172459), OR5AP2 (ENSG00000172464), OR8J1 (ENSG00000172487), OR5B3 (ENSG00000172769), OR10W1 (ENSG00000172772), OR5M3 (ENSG00000174937), OR5J2 (ENSG00000174957), OR10H4 (ENSG00000176231), OR5AN1 (ENSG00000176495), OR14C36 (ENSG00000177174), OR6B3 (ENSG00000178586), OR10Q1 (ENSG00000180475), OR8G2P (ENSG00000181214), OR5AK2 (ENSG00000181273), OR5AK3P (ENSG00000181282), OR5M8 (ENSG00000181371), OR8H1 (ENSG00000181693), OR8K5 (ENSG00000181752), OR8H3 (ENSG00000181761), OR8H2 (ENSG00000181767)
Protein
Protein identifiers
Olfactory receptor 8D4 — Q8NGM9 (reviewed: Q8NGM9)
Alternative names: Olfactory receptor OR11-275
All UniProt accessions (1): Q8NGM9
UniProt curated annotations — full annotation on UniProt →
Function. Odorant receptor.
Subcellular location. Cell membrane.
Similarity. Belongs to the G-protein coupled receptor 1 family.
RefSeq proteins (1): NP_001005197* (*=MANE)
Domains & families (InterPro)
| ID | Name | Type |
|---|---|---|
| IPR000276 | GPCR_Rhodpsn | Family |
| IPR000725 | Olfact_rcpt | Family |
| IPR017452 | GPCR_Rhodpsn_7TM | Domain |
Pfam: PF13853
UniProt features (26 total): topological domain 8, sequence variant 8, transmembrane region 7, chain 1, glycosylation site 1, disulfide bond 1
Structure
Experimental structures (PDB)
0 structures.
Predicted structure (AlphaFold)
| Model | pLDDT | Fraction very-high |
|---|---|---|
| AF-Q8NGM9-F1 | 90.56 | 0.74 |
Functional residue map
Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.
Disulfide bonds (1): 97–189
Glycosylation sites (1): 5
Function
Pathways and Gene Ontology
Reactome pathways
1 pathways
| ID | Pathway |
|---|---|
| R-HSA-9752946 | Expression and translocation of olfactory receptors |
MSigDB gene sets: 18 (showing top):
GOBP_SENSORY_PERCEPTION_OF_CHEMICAL_STIMULUS, KEGG_OLFACTORY_TRANSDUCTION, GOBP_DETECTION_OF_STIMULUS, GOBP_SENSORY_PERCEPTION, GOMF_OLFACTORY_RECEPTOR_ACTIVITY, GOMF_TRANSMEMBRANE_SIGNALING_RECEPTOR_ACTIVITY, chr11q24, GOMF_ODORANT_BINDING, GOMF_G_PROTEIN_COUPLED_RECEPTOR_ACTIVITY, GOBP_SENSORY_PERCEPTION_OF_SMELL, GOBP_G_PROTEIN_COUPLED_RECEPTOR_SIGNALING_PATHWAY, GOBP_DETECTION_OF_STIMULUS_INVOLVED_IN_SENSORY_PERCEPTION, REACTOME_OLFACTORY_SIGNALING_PATHWAY, REACTOME_SENSORY_PERCEPTION, GOBP_DETECTION_OF_CHEMICAL_STIMULUS
GO Biological Process (4): G protein-coupled receptor signaling pathway (GO:0007186), sensory perception of smell (GO:0007608), signal transduction (GO:0007165), detection of chemical stimulus involved in sensory perception of smell (GO:0050911)
GO Molecular Function (3): G protein-coupled receptor activity (GO:0004930), olfactory receptor activity (GO:0004984), odorant binding (GO:0005549)
GO Cellular Component (2): plasma membrane (GO:0005886), membrane (GO:0016020)
Reactome top-level categories
Rollup of top-1 pathways:
| Category | Pathways |
|---|---|
| Olfactory Signaling Pathway | 1 |
GO top-level categories
Rollup of top GO terms by namespace:
| Category | Terms |
|---|---|
| transmembrane signaling receptor activity | 2 |
| G protein-coupled receptor activity | 1 |
| signal transduction | 1 |
| sensory perception of chemical stimulus | 1 |
| cell communication | 1 |
| cellular process | 1 |
| signaling | 1 |
| regulation of cellular process | 1 |
| cellular response to stimulus | 1 |
| sensory perception of smell | 1 |
| detection of chemical stimulus involved in sensory perception | 1 |
| G protein-coupled receptor signaling pathway | 1 |
| detection of chemical stimulus involved in sensory perception of smell | 1 |
| binding | 1 |
| membrane | 1 |
| cell periphery | 1 |
| cellular anatomical structure | 1 |
Protein interactions and networks
STRING
112 interactions, top by confidence (×1000):
| Protein A | Protein B | Partner UniProt | Score |
|---|---|---|---|
| OR8D4 | TAFA2 | Q8N3H0 | 393 |
| OR8D4 | MT1M | Q8N339 | 391 |
| OR8D4 | TAS2R16 | Q9NYV7 | 375 |
| OR8D4 | TMEM39A | Q9NV64 | 367 |
| OR8D4 | DHRS9 | Q9BPW9 | 367 |
| OR8D4 | TCN1 | P20061 | 366 |
| OR8D4 | DPYSL3 | Q14195 | 349 |
| OR8D4 | TAS2R1 | Q9NYW7 | 342 |
| OR8D4 | BEST3 | Q8N1M1 | 338 |
| OR8D4 | STXBP6 | Q8NFX7 | 321 |
| OR8D4 | TAAR5 | O14804 | 320 |
| OR8D4 | MT1G | P13640 | 311 |
| OR8D4 | ADAMTSL1 | Q8N6G6 | 303 |
| OR8D4 | WDFY4 | Q6ZS81 | 299 |
| OR8D4 | SLU7 | O95391 | 296 |
IntAct
0 interactions, top by confidence:
BioGRID (1): OR8D4 (Affinity Capture-Luminescence)
ESM2 similar proteins: A0A096LPK9, A0A0X1KG70, A6NCV1, O95221, P0C7N1, P0C7N5, Q60881, Q60888, Q6IEU7, Q8NGA8, Q8NGB6, Q8NGC6, Q8NGD0, Q8NGD1, Q8NGD2, Q8NGD4, Q8NGD5, Q8NGE8, Q8NGF8, Q8NGI4, Q8NGI6, Q8NGJ1, Q8NGM9, Q8NGP8, Q8NGP9, Q8NGS9, Q8NGT0, Q8NH01, Q8NH10, Q8NH18, Q8NH21, Q8NH41, Q8NH42, Q8NH43, Q8NH49, Q8NH69, Q8NH85, Q8VEW5, Q8VF65, Q8VFD3
Diamond homologs: A6NDH6, A6NET4, A6NHG9, A6NKK0, A6NL26, A6NMS3, O95221, P0C626, P0C628, P0C7N1, P0C7N5, P0DMU2, P0DN80, P34985, P37068, P37070, P37071, P37072, Q13606, Q15617, Q15620, Q60880, Q60882, Q60884, Q60886, Q60893, Q60894, Q6UXT6, Q7TS48, Q8N127, Q8N146, Q8N162, Q8NG75, Q8NG78, Q8NGC0, Q8NGF4, Q8NGF7, Q8NGG0, Q8NGG1, Q8NGG2
SIGNOR signaling
0 interactions.
Disease & clinical
Clinical variants and AI predictions
ClinVar
36 variants total. Per-class counts are floors (≥ shown; pagination cap):
| Classification | Count (floor) |
|---|---|
| Pathogenic | 0 |
| Likely pathogenic | 0 |
| Uncertain significance | 35 |
| Likely benign | 1 |
| Benign | 0 |
Top pathogenic / likely-pathogenic (0)
SpliceAI
140 predictions. Top by Δscore:
| Variant | Effect | Δscore |
|---|---|---|
| 11:123906411:CCACA:C | acceptor_loss | 0.9500 |
| 11:123906412:CACA:C | acceptor_loss | 0.9500 |
| 11:123906413:ACAGA:A | acceptor_loss | 0.9500 |
| 11:123906414:CAGAT:C | acceptor_loss | 0.9500 |
| 11:123906415:A:AT | acceptor_loss | 0.9500 |
| 11:123906416:G:A | acceptor_loss | 0.9500 |
| 11:123906259:AGGTA:A | donor_loss | 0.9200 |
| 11:123906261:G:T | donor_loss | 0.9200 |
| 11:123906415:A:AG | acceptor_gain | 0.9100 |
| 11:123906416:G:GG | acceptor_gain | 0.9100 |
| 11:123906408:T:G | acceptor_gain | 0.8900 |
| 11:123906761:T:A | acceptor_gain | 0.8900 |
| 11:123906264:G:GT | donor_loss | 0.8500 |
| 11:123906416:GATTT:G | acceptor_gain | 0.8200 |
| 11:123906416:GAT:G | acceptor_gain | 0.8100 |
| 11:123906261:G:GG | donor_gain | 0.7900 |
| 11:123906407:A:AG | acceptor_gain | 0.7600 |
| 11:123906413:A:AG | acceptor_gain | 0.7600 |
| 11:123906416:GA:G | acceptor_gain | 0.7300 |
| 11:123906414:C:G | acceptor_gain | 0.7000 |
| 11:123906416:GATT:G | acceptor_gain | 0.6800 |
| 11:123906259:AGGT:A | donor_gain | 0.6700 |
| 11:123906269:A:G | donor_gain | 0.6300 |
| 11:123906266:T:TA | donor_gain | 0.5900 |
| 11:123906267:A:AA | donor_gain | 0.5900 |
| 11:123906611:C:CG | donor_gain | 0.5100 |
| 11:123906260:GGT:G | donor_gain | 0.4800 |
| 11:123906236:T:A | donor_gain | 0.4600 |
| 11:123906233:G:GG | donor_gain | 0.4500 |
| 11:123906463:A:T | acceptor_gain | 0.4500 |
AlphaMissense
2051 scored. Top likely-pathogenic:
| Variant | Protein change | am_pathogenicity |
|---|---|---|
| 11:123906465:T:C | F12L | 0.906 |
| 11:123906467:T:A | F12L | 0.906 |
| 11:123906467:T:G | F12L | 0.906 |
| 11:123906933:T:C | F168L | 0.819 |
| 11:123906935:C:A | F168L | 0.819 |
| 11:123906935:C:G | F168L | 0.819 |
| 11:123906522:T:C | F31L | 0.743 |
| 11:123906524:C:A | F31L | 0.743 |
| 11:123906524:C:G | F31L | 0.743 |
| 11:123906513:T:C | F28L | 0.712 |
| 11:123906515:C:A | F28L | 0.712 |
| 11:123906515:C:G | F28L | 0.712 |
| 11:123906466:T:C | F12S | 0.710 |
| 11:123906963:T:C | F178L | 0.706 |
| 11:123906965:C:A | F178L | 0.706 |
| 11:123906965:C:G | F178L | 0.706 |
| 11:123907062:A:C | S211R | 0.703 |
| 11:123907064:C:A | S211R | 0.703 |
| 11:123907064:C:G | S211R | 0.703 |
| 11:123907182:T:C | F251L | 0.702 |
| 11:123907184:T:A | F251L | 0.702 |
| 11:123907184:T:G | F251L | 0.702 |
| 11:123907143:T:C | F238L | 0.680 |
| 11:123907145:T:A | F238L | 0.680 |
| 11:123907145:T:G | F238L | 0.680 |
| 11:123906684:T:C | F85L | 0.669 |
| 11:123906686:T:A | F85L | 0.669 |
| 11:123906686:T:G | F85L | 0.669 |
| 11:123906466:T:G | F12C | 0.652 |
| 11:123907260:T:C | F277L | 0.629 |
dbSNP variants (sampled 300 via entrez): RS1000512935 (11:123900575 C>T), RS1000584878 (11:123900244 A>T), RS1000885852 (11:123900645 A>G), RS1001105458 (11:123906244 G>A,T), RS1001415968 (11:123904903 C>T), RS1001920126 (11:123909728 A>G), RS1002120009 (11:123903505 T>C), RS1002305656 (11:123903272 A>C), RS1003115846 (11:123903205 T>C), RS1003185205 (11:123908805 C>T), RS1003417122 (11:123902122 A>G), RS1003494372 (11:123903427 A>G,T), RS1003573455 (11:123901975 T>C), RS1003648593 (11:123908511 T>C,G), RS1003817351 (11:123907943 GAATCCAAGCCCAAAAGGAAATCATC>G)
Disease associations
OMIM: gene `` | disease phenotypes:
GenCC curated gene-disease
Mondo (0):
Orphanet (0):
HPO phenotypes
0 total (0 of 0 shown, HPO-id order):
GWAS associations
1 associations (top):
| Study | Trait | p-value |
|---|---|---|
| GCST004751_11 | Serum uric acid levels in response to allopurinol in gout | 3.000000e-06 |
EFO canonical traits (1, from GWAS)
| EFO ID | Trait name |
|---|---|
| EFO:0004761 | uric acid measurement |
Drugs & pharmacology
Drug and pharmacology data
Is drug target: no
PharmGKB: 1 entry (VIP=true, CPIC=false)
CTD chemical–gene interactions
2 total (human), top 2 by PubMed support.
| Chemical | Actions (top 5) | PubMed papers |
|---|---|---|
| Benzo(a)pyrene | affects methylation | 1 |
| Phthalic Acids | increases methylation | 1 |
Clinical trials (associated diseases)
0 trials via MONDO — disease-level, not drug-specific.
Related Atlas pages
No linked Atlas pages yet — the cross-entity mesh grows as the corpus expands.