OR8D4

Summary

OR8D4 (olfactory receptor family 8 subfamily D member 4, HGNC:14840) is a protein-coding gene on chromosome 11q24.1, encoding Olfactory receptor 8D4 (Q8NGM9). Odorant receptor.

Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome.

Source: NCBI Gene 338662 — RefSeq curated summary.

At a glance

• GWAS associations: 1
• Clinical variants (ClinVar): 36 total
• MANE Select transcript: NM_001005197

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:14840
Approved symbol	OR8D4
Name	olfactory receptor family 8 subfamily D member 4
Location	11q24.1
Locus type	gene with protein product
Status	Approved
Ensembl gene	ENSG00000181518
Ensembl biotype	protein_coding
Entrez	338662

Gene structure

Transcript identifiers

Ensembl transcripts: 2 — 2 protein_coding

ENST00000321355, ENST00000641687

RefSeq mRNA: 1 — MANE Select: NM_001005197 NM_001005197

CCDS: CCDS31698

Canonical transcript exons

ENST00000641687 — 2 exons

Exon	Start	End
ENSE00003811655	123902167	123902257
ENSE00003811911	123906417	123909229

Expression profiles

Bgee: expression breadth tissue_specific, 4 present calls, max score 76.57.

Top tissues by expression

123 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
male germ line stem cell (sensu Vertebrata) in testis	CL:0000089 ∩ UBERON:0000473	76.57	gold quality
body of pancreas	UBERON:0001150	45.40	silver quality
colonic epithelium	UBERON:0000397	41.45	gold quality
pancreas	UBERON:0001264	39.96	silver quality
cortical plate	UBERON:0005343	39.84	gold quality
bone marrow cell	CL:0002092	38.28	gold quality
ventricular zone	UBERON:0003053	36.48	gold quality
sural nerve	UBERON:0015488	35.70	gold quality
monocyte	CL:0000576	35.36	gold quality
mucosa of transverse colon	UBERON:0004991	35.34	gold quality
leukocyte	CL:0000738	34.66	gold quality
prefrontal cortex	UBERON:0000451	34.39	gold quality
skeletal muscle tissue	UBERON:0001134	33.38	gold quality
bone marrow	UBERON:0002371	32.82	gold quality
muscle tissue	UBERON:0002385	32.15	gold quality
hindlimb stylopod muscle	UBERON:0004252	32.15	gold quality
urinary bladder	UBERON:0001255	31.73	gold quality
frontal cortex	UBERON:0001870	30.80	gold quality
liver	UBERON:0002107	30.80	gold quality
tonsil	UBERON:0002372	30.25	gold quality
primary visual cortex	UBERON:0002436	30.09	gold quality
stromal cell of endometrium	CL:0002255	29.87	gold quality
superior frontal gyrus	UBERON:0002661	29.84	gold quality
vermiform appendix	UBERON:0001154	29.26	gold quality
placenta	UBERON:0001987	29.20	gold quality
blood	UBERON:0000178	28.64	gold quality
calcaneal tendon	UBERON:0003701	28.45	gold quality
gall bladder	UBERON:0002110	28.44	gold quality
duodenum	UBERON:0002114	28.14	gold quality
lymph node	UBERON:0000029	27.57	gold quality

Single-cell (SCXA)

Detected in 1 experiment(s), a significant marker in 1.

Experiment	Marker?	Max mean expression
E-ANND-3	yes	5.67

Regulation

Is transcription factor: no

Cross-species orthologs

2 orthologs

Organism	Symbol	Gene ID
mus_musculus	Or8d4	ENSMUSG00000049073
rattus_norvegicus	Or8d4	ENSRNOG00000053238

Paralogs (96): OR5C1 (ENSG00000148215), OR5F1 (ENSG00000149133), OR8K1 (ENSG00000150261), OR5M9 (ENSG00000150269), OR14K1 (ENSG00000153230), OR8J3 (ENSG00000167822), OR5I1 (ENSG00000167825), OR5AU1 (ENSG00000169327), OR9K2 (ENSG00000170605), OR8B12 (ENSG00000170953), OR10H3 (ENSG00000171936), OR8I2 (ENSG00000172154), OR8U1 (ENSG00000172199), OR10V1 (ENSG00000172289), OR5A1 (ENSG00000172320), OR5A2 (ENSG00000172324), OR5B12 (ENSG00000172362), OR5B2 (ENSG00000172365), OR9I1 (ENSG00000172377), OR9G4 (ENSG00000172457), OR5AR1 (ENSG00000172459), OR5AP2 (ENSG00000172464), OR8J1 (ENSG00000172487), OR5B3 (ENSG00000172769), OR10W1 (ENSG00000172772), OR5M3 (ENSG00000174937), OR5J2 (ENSG00000174957), OR10H4 (ENSG00000176231), OR5AN1 (ENSG00000176495), OR14C36 (ENSG00000177174), OR6B3 (ENSG00000178586), OR10Q1 (ENSG00000180475), OR8G2P (ENSG00000181214), OR5AK2 (ENSG00000181273), OR5AK3P (ENSG00000181282), OR5M8 (ENSG00000181371), OR8H1 (ENSG00000181693), OR8K5 (ENSG00000181752), OR8H3 (ENSG00000181761), OR8H2 (ENSG00000181767)

Protein

Protein identifiers

Olfactory receptor 8D4 — Q8NGM9 (reviewed: Q8NGM9)

Alternative names: Olfactory receptor OR11-275

All UniProt accessions (1): Q8NGM9

UniProt curated annotations — full annotation on UniProt →

Function. Odorant receptor.

Subcellular location. Cell membrane.

Similarity. Belongs to the G-protein coupled receptor 1 family.

RefSeq proteins (1): NP_001005197* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR000276	GPCR_Rhodpsn	Family
IPR000725	Olfact_rcpt	Family
IPR017452	GPCR_Rhodpsn_7TM	Domain

Pfam: PF13853

UniProt features (26 total): topological domain 8, sequence variant 8, transmembrane region 7, chain 1, glycosylation site 1, disulfide bond 1

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q8NGM9-F1	90.56	0.74

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Disulfide bonds (1): 97–189

Glycosylation sites (1): 5

Function

Pathways and Gene Ontology

Reactome pathways

1 pathways

ID	Pathway
R-HSA-9752946	Expression and translocation of olfactory receptors

MSigDB gene sets: 18 (showing top): GOBP_SENSORY_PERCEPTION_OF_CHEMICAL_STIMULUS, KEGG_OLFACTORY_TRANSDUCTION, GOBP_DETECTION_OF_STIMULUS, GOBP_SENSORY_PERCEPTION, GOMF_OLFACTORY_RECEPTOR_ACTIVITY, GOMF_TRANSMEMBRANE_SIGNALING_RECEPTOR_ACTIVITY, chr11q24, GOMF_ODORANT_BINDING, GOMF_G_PROTEIN_COUPLED_RECEPTOR_ACTIVITY, GOBP_SENSORY_PERCEPTION_OF_SMELL, GOBP_G_PROTEIN_COUPLED_RECEPTOR_SIGNALING_PATHWAY, GOBP_DETECTION_OF_STIMULUS_INVOLVED_IN_SENSORY_PERCEPTION, REACTOME_OLFACTORY_SIGNALING_PATHWAY, REACTOME_SENSORY_PERCEPTION, GOBP_DETECTION_OF_CHEMICAL_STIMULUS

GO Biological Process (4): G protein-coupled receptor signaling pathway (GO:0007186), sensory perception of smell (GO:0007608), signal transduction (GO:0007165), detection of chemical stimulus involved in sensory perception of smell (GO:0050911)

GO Molecular Function (3): G protein-coupled receptor activity (GO:0004930), olfactory receptor activity (GO:0004984), odorant binding (GO:0005549)

GO Cellular Component (2): plasma membrane (GO:0005886), membrane (GO:0016020)

Reactome top-level categories

Rollup of top-1 pathways:

Category	Pathways
Olfactory Signaling Pathway	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
transmembrane signaling receptor activity	2
G protein-coupled receptor activity	1
signal transduction	1
sensory perception of chemical stimulus	1
cell communication	1
cellular process	1
signaling	1
regulation of cellular process	1
cellular response to stimulus	1
sensory perception of smell	1
detection of chemical stimulus involved in sensory perception	1
G protein-coupled receptor signaling pathway	1
detection of chemical stimulus involved in sensory perception of smell	1
binding	1
membrane	1
cell periphery	1
cellular anatomical structure	1

Protein interactions and networks

STRING

112 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
OR8D4	TAFA2	Q8N3H0	393
OR8D4	MT1M	Q8N339	391
OR8D4	TAS2R16	Q9NYV7	375
OR8D4	TMEM39A	Q9NV64	367
OR8D4	DHRS9	Q9BPW9	367
OR8D4	TCN1	P20061	366
OR8D4	DPYSL3	Q14195	349
OR8D4	TAS2R1	Q9NYW7	342
OR8D4	BEST3	Q8N1M1	338
OR8D4	STXBP6	Q8NFX7	321
OR8D4	TAAR5	O14804	320
OR8D4	MT1G	P13640	311
OR8D4	ADAMTSL1	Q8N6G6	303
OR8D4	WDFY4	Q6ZS81	299
OR8D4	SLU7	O95391	296

IntAct

0 interactions, top by confidence:

BioGRID (1): OR8D4 (Affinity Capture-Luminescence)

ESM2 similar proteins: A0A096LPK9, A0A0X1KG70, A6NCV1, O95221, P0C7N1, P0C7N5, Q60881, Q60888, Q6IEU7, Q8NGA8, Q8NGB6, Q8NGC6, Q8NGD0, Q8NGD1, Q8NGD2, Q8NGD4, Q8NGD5, Q8NGE8, Q8NGF8, Q8NGI4, Q8NGI6, Q8NGJ1, Q8NGM9, Q8NGP8, Q8NGP9, Q8NGS9, Q8NGT0, Q8NH01, Q8NH10, Q8NH18, Q8NH21, Q8NH41, Q8NH42, Q8NH43, Q8NH49, Q8NH69, Q8NH85, Q8VEW5, Q8VF65, Q8VFD3

Diamond homologs: A6NDH6, A6NET4, A6NHG9, A6NKK0, A6NL26, A6NMS3, O95221, P0C626, P0C628, P0C7N1, P0C7N5, P0DMU2, P0DN80, P34985, P37068, P37070, P37071, P37072, Q13606, Q15617, Q15620, Q60880, Q60882, Q60884, Q60886, Q60893, Q60894, Q6UXT6, Q7TS48, Q8N127, Q8N146, Q8N162, Q8NG75, Q8NG78, Q8NGC0, Q8NGF4, Q8NGF7, Q8NGG0, Q8NGG1, Q8NGG2

SIGNOR signaling

0 interactions.

Disease & clinical

Clinical variants and AI predictions

ClinVar

36 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	35
Likely benign	1
Benign	0

Top pathogenic / likely-pathogenic (0)

SpliceAI

140 predictions. Top by Δscore:

Variant	Effect	Δscore
11:123906411:CCACA:C	acceptor_loss	0.9500
11:123906412:CACA:C	acceptor_loss	0.9500
11:123906413:ACAGA:A	acceptor_loss	0.9500
11:123906414:CAGAT:C	acceptor_loss	0.9500
11:123906415:A:AT	acceptor_loss	0.9500
11:123906416:G:A	acceptor_loss	0.9500
11:123906259:AGGTA:A	donor_loss	0.9200
11:123906261:G:T	donor_loss	0.9200
11:123906415:A:AG	acceptor_gain	0.9100
11:123906416:G:GG	acceptor_gain	0.9100
11:123906408:T:G	acceptor_gain	0.8900
11:123906761:T:A	acceptor_gain	0.8900
11:123906264:G:GT	donor_loss	0.8500
11:123906416:GATTT:G	acceptor_gain	0.8200
11:123906416:GAT:G	acceptor_gain	0.8100
11:123906261:G:GG	donor_gain	0.7900
11:123906407:A:AG	acceptor_gain	0.7600
11:123906413:A:AG	acceptor_gain	0.7600
11:123906416:GA:G	acceptor_gain	0.7300
11:123906414:C:G	acceptor_gain	0.7000
11:123906416:GATT:G	acceptor_gain	0.6800
11:123906259:AGGT:A	donor_gain	0.6700
11:123906269:A:G	donor_gain	0.6300
11:123906266:T:TA	donor_gain	0.5900
11:123906267:A:AA	donor_gain	0.5900
11:123906611:C:CG	donor_gain	0.5100
11:123906260:GGT:G	donor_gain	0.4800
11:123906236:T:A	donor_gain	0.4600
11:123906233:G:GG	donor_gain	0.4500
11:123906463:A:T	acceptor_gain	0.4500

AlphaMissense

2051 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
11:123906465:T:C	F12L	0.906
11:123906467:T:A	F12L	0.906
11:123906467:T:G	F12L	0.906
11:123906933:T:C	F168L	0.819
11:123906935:C:A	F168L	0.819
11:123906935:C:G	F168L	0.819
11:123906522:T:C	F31L	0.743
11:123906524:C:A	F31L	0.743
11:123906524:C:G	F31L	0.743
11:123906513:T:C	F28L	0.712
11:123906515:C:A	F28L	0.712
11:123906515:C:G	F28L	0.712
11:123906466:T:C	F12S	0.710
11:123906963:T:C	F178L	0.706
11:123906965:C:A	F178L	0.706
11:123906965:C:G	F178L	0.706
11:123907062:A:C	S211R	0.703
11:123907064:C:A	S211R	0.703
11:123907064:C:G	S211R	0.703
11:123907182:T:C	F251L	0.702
11:123907184:T:A	F251L	0.702
11:123907184:T:G	F251L	0.702
11:123907143:T:C	F238L	0.680
11:123907145:T:A	F238L	0.680
11:123907145:T:G	F238L	0.680
11:123906684:T:C	F85L	0.669
11:123906686:T:A	F85L	0.669
11:123906686:T:G	F85L	0.669
11:123906466:T:G	F12C	0.652
11:123907260:T:C	F277L	0.629

dbSNP variants (sampled 300 via entrez): RS1000512935 (11:123900575 C>T), RS1000584878 (11:123900244 A>T), RS1000885852 (11:123900645 A>G), RS1001105458 (11:123906244 G>A,T), RS1001415968 (11:123904903 C>T), RS1001920126 (11:123909728 A>G), RS1002120009 (11:123903505 T>C), RS1002305656 (11:123903272 A>C), RS1003115846 (11:123903205 T>C), RS1003185205 (11:123908805 C>T), RS1003417122 (11:123902122 A>G), RS1003494372 (11:123903427 A>G,T), RS1003573455 (11:123901975 T>C), RS1003648593 (11:123908511 T>C,G), RS1003817351 (11:123907943 GAATCCAAGCCCAAAAGGAAATCATC>G)

Disease associations

OMIM: gene `` | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

1 associations (top):

Study	Trait	p-value
GCST004751_11	Serum uric acid levels in response to allopurinol in gout	3.000000e-06

EFO canonical traits (1, from GWAS)

EFO ID	Trait name
EFO:0004761	uric acid measurement

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

2 total (human), top 2 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Benzo(a)pyrene	affects methylation	1
Phthalic Acids	increases methylation	1

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.