P4HB

Summary

P4HB (prolyl 4-hydroxylase subunit beta, HGNC:8548) is a protein-coding gene on chromosome 17q25.3, encoding Protein disulfide-isomerase (P07237). This multifunctional protein catalyzes the formation, breakage and rearrangement of disulfide bonds.

This gene encodes the beta subunit of prolyl 4-hydroxylase, a highly abundant multifunctional enzyme that belongs to the protein disulfide isomerase family. When present as a tetramer consisting of two alpha and two beta subunits, this enzyme is involved in hydroxylation of prolyl residues in preprocollagen. This enzyme is also a disulfide isomerase containing two thioredoxin domains that catalyze the formation, breakage and rearrangement of disulfide bonds. Other known functions include its ability to act as a chaperone that inhibits aggregation of misfolded proteins in a concentration-dependent manner, its ability to bind thyroid hormone, its role in both the influx and efflux of S-nitrosothiol-bound nitric oxide, and its function as a subunit of the microsomal triglyceride transfer protein complex.

Source: NCBI Gene 5034 — RefSeq curated summary.

At a glance

• Gene–disease (curated): Cole-Carpenter syndrome 1 (Strong, GenCC) — +2 more curated relationships
• Clinical variants (ClinVar): 423 total — 1 pathogenic, 2 likely-pathogenic
• Phenotypes (HPO): 39
• Druggable target: yes — 1 molecules with ChEMBL bioactivity
• MANE Select transcript: NM_000918

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:8548
Approved symbol	P4HB
Name	prolyl 4-hydroxylase subunit beta
Location	17q25.3
Locus type	gene with protein product
Status	Approved
Aliases	PDIA1, PROHB, DSI, GIT, PDI, PO4HB, P4Hbeta
Ensembl gene	ENSG00000185624
Ensembl biotype	protein_coding
OMIM	176790
Entrez	5034

Gene structure

Transcript identifiers

Ensembl transcripts: 84 — 29 protein_coding, 28 retained_intron, 24 nonsense_mediated_decay, 3 protein_coding_CDS_not_defined

ENST00000331483, ENST00000415593, ENST00000439918, ENST00000466567, ENST00000467086, ENST00000471535, ENST00000472244, ENST00000473021, ENST00000474712, ENST00000476482, ENST00000477607, ENST00000478034, ENST00000484286, ENST00000570907, ENST00000571507, ENST00000571617, ENST00000573778, ENST00000574007, ENST00000574914, ENST00000575069, ENST00000576052, ENST00000576380, ENST00000576390, ENST00000576541, ENST00000679366, ENST00000679396, ENST00000679439, ENST00000679455, ENST00000679470, ENST00000679628, ENST00000679688, ENST00000679889, ENST00000680076, ENST00000680083, ENST00000680105, ENST00000680191, ENST00000680208, ENST00000680226, ENST00000680259, ENST00000680368, ENST00000680400, ENST00000680416, ENST00000680547, ENST00000680559, ENST00000680593, ENST00000680719, ENST00000680732, ENST00000680799, ENST00000680838, ENST00000680846, ENST00000680847, ENST00000680884, ENST00000680909, ENST00000680914, ENST00000681020, ENST00000681030, ENST00000681031, ENST00000681068, ENST00000681161, ENST00000681259, ENST00000681420, ENST00000681485, ENST00000681515, ENST00000681566, ENST00000681571, ENST00000681614, ENST00000681693, ENST00000681760, ENST00000681835, ENST00000681872, ENST00000681933, ENST00000681954, ENST00000889211, ENST00000889212, ENST00000889213, ENST00000889214, ENST00000936206, ENST00000936207, ENST00000936208, ENST00000936209, ENST00000948310, ENST00000948311, ENST00000948312, ENST00000948313

RefSeq mRNA: 1 — MANE Select: NM_000918 NM_000918

CCDS: CCDS11787

Canonical transcript exons

ENST00000331483 — 11 exons

Exon	Start	End
ENSE00001769876	81843166	81844092
ENSE00002683270	81860327	81860535
ENSE00003489757	81859181	81859387
ENSE00003517743	81847243	81847347
ENSE00003556958	81855142	81855279
ENSE00003569967	81846947	81847072
ENSE00003581440	81845561	81845742
ENSE00003593761	81855453	81855586
ENSE00003635986	81845144	81845230
ENSE00003669280	81845871	81845991
ENSE00003684986	81846429	81846629

Expression profiles

Bgee: expression breadth ubiquitous, 293 present calls, max score 99.86.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 329.8390 / max 5195.1495, expressed in 1827 samples.

FANTOM5 promoters (14 alternative TSS)

Promoter ID	TPM avg	Samples expressed
168815	316.6750	1827
168804	2.4193	1066
168810	1.6878	1082
168796	1.5946	912
168813	1.1998	770
168802	1.1679	762
168807	0.9088	584
168811	0.8088	497
168814	0.7543	456
168809	0.7433	474

Top tissues by expression

294 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
stromal cell of endometrium	CL:0002255	99.86	gold quality
parotid gland	UBERON:0001831	99.84	gold quality
jejunal mucosa	UBERON:0000399	99.75	gold quality
body of pancreas	UBERON:0001150	99.75	gold quality
ileal mucosa	UBERON:0000331	99.71	gold quality
islet of Langerhans	UBERON:0000006	99.70	gold quality
right lobe of liver	UBERON:0001114	99.70	gold quality
duodenum	UBERON:0002114	99.65	gold quality
saliva-secreting gland	UBERON:0001044	99.57	gold quality
endometrium epithelium	UBERON:0004811	99.56	gold quality
pancreas	UBERON:0001264	99.54	gold quality
lower esophagus mucosa	UBERON:0035834	99.54	gold quality
type B pancreatic cell	CL:0000169	99.53	gold quality
adenohypophysis	UBERON:0002196	99.53	gold quality
left adrenal gland	UBERON:0001234	99.52	gold quality
minor salivary gland	UBERON:0001830	99.52	gold quality
right adrenal gland	UBERON:0001233	99.50	gold quality
left adrenal gland cortex	UBERON:0035825	99.50	gold quality
pituitary gland	UBERON:0000007	99.49	gold quality
liver	UBERON:0002107	99.49	gold quality
skin of leg	UBERON:0001511	99.48	gold quality
mouth mucosa	UBERON:0003729	99.48	gold quality
adrenal tissue	UBERON:0018303	99.48	gold quality
adrenal gland	UBERON:0002369	99.47	gold quality
esophagus mucosa	UBERON:0002469	99.47	gold quality
right adrenal gland cortex	UBERON:0035827	99.46	gold quality
skin of abdomen	UBERON:0001416	99.45	gold quality
body of stomach	UBERON:0001161	99.44	gold quality
mucosa of transverse colon	UBERON:0004991	99.43	gold quality
adrenal cortex	UBERON:0001235	99.41	gold quality

Single-cell (SCXA)

Detected in 16 experiment(s), a significant marker in 13.

Experiment	Marker?	Max mean expression
E-GEOD-100618	yes	1313.30
E-HCAD-5	yes	952.22
E-MTAB-9467	yes	55.06
E-CURD-122	yes	45.77
E-HCAD-10	yes	30.54
E-MTAB-9067	yes	21.79
E-MTAB-5061	yes	18.47
E-CURD-112	yes	15.83
E-HCAD-13	yes	11.68
E-CURD-46	yes	11.03
E-MTAB-10042	yes	8.77
E-HCAD-1	yes	8.64
E-MTAB-7303	no	2341.16
E-CURD-97	no	544.96
E-MTAB-9801	no	4.18

Regulation

Is transcription factor: no

Upstream regulators (CollecTRI, top): ESR1

miRNA regulators (miRDB)

39 targeting P4HB, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-6856-5P	100.00	65.47	1298
HSA-MIR-6758-5P	100.00	66.21	1470
HSA-MIR-4282	99.99	75.36	6408
HSA-MIR-12136	99.98	72.81	5713
HSA-MIR-548N	99.98	71.94	4170
HSA-MIR-5680	99.91	69.83	3421
HSA-MIR-1305	99.91	71.43	3443
HSA-MIR-548E-5P	99.89	72.73	4486
HSA-MIR-4492	99.87	68.25	3611
HSA-MIR-5002-5P	99.76	70.84	1763
HSA-MIR-670-5P	99.67	69.94	1565
HSA-MIR-548AV-5P	99.60	70.84	2107
HSA-MIR-548K	99.60	70.84	2107
HSA-MIR-762	99.58	66.61	1994
HSA-MIR-8054	99.48	70.81	2084
HSA-MIR-4498	99.47	67.42	2360
HSA-MIR-513A-3P	99.39	70.63	3620
HSA-MIR-513C-3P	99.39	70.63	3620
HSA-MIR-4292	99.16	65.57	1767
HSA-MIR-6791-5P	99.16	65.92	1844
HSA-MIR-3606-3P	99.11	69.84	3254
HSA-MIR-5001-5P	99.05	66.76	1972
HSA-MIR-3926	98.95	69.26	1438
HSA-MIR-5001-3P	98.91	67.28	1394
HSA-MIR-6829-5P	98.86	65.12	1480
HSA-MIR-3611	98.76	68.76	1290
HSA-MIR-12114	98.70	63.45	730
HSA-MIR-548S	98.50	67.17	1213
HSA-MIR-548AT-3P	98.37	64.98	580
HSA-MIR-548AY-3P	98.37	65.14	562

Literature-anchored findings (GeneRIF, showing 40)

• domain c is required for the stabilization and maintenance of the chaperone function of PDI under extreme conditions (PMID:15358778)
• data indicate that binding sites in three PDI domains, a, b’, and a’, contribute to efficient C-P4H tetramer assembly (PMID:15590633)
• PDI can be S-nitrosated and PDI-SNO can be denitrosated by PDI suggesting that this enzyme could be intimately involved in the transport of intracellular NO equivalents to the cell surface. (PMID:15611098)
• Data show that protein disulfide isomerase can switch its conformation from dimer to tetramer in its functions as a foldase. (PMID:15695804)
• analysis of the 2-His-1-Asp active-site motif in prolyl 4-hydroxylase (PMID:19890397)
• Functional PDI is rapidly secreted from human umbilical vein endothelial cells in culture upon activation with thrombin or after laser-induced stimulation. (PMID:20668226)
• these data revealed a redox-regulated chaperone function of PDI in delivering antigenic peptides from TAP to MHC-I. (PMID:21299467)
• TPM4, PDIA and SRC8 were also localized to the trophoblast cells, further highlighting the importance of these cytoskeletal remodelling proteins in early pregnancy (PMID:21373848)
• A mixed disulfide complex was formed with the catalytic domain A1 from human PDI consistent with a model for cotranslational oxidative protein folding wherein PDI acts as a placeholder that is relieved by the pairing of cysteines caused by substrate folding. (PMID:23141538)
• ). The results suggest that P4HB is a modifier gene inamyotrophic lateral sclerosis susceptibility and may represent a potential therapeutic target for amyotrophic lateral sclerosis . (PMID:23337974)
• Elevated P4HB expression is associated with temozolomide resistance in malignant glioma. (PMID:23444257)
• The crystal structure of the dimeric form of noncatalytic bb’ domains of human PDIA1 determined to 2.3 A resolution revealed that the formation of dimers occludes the substrate binding site. (PMID:24549644)
• PDI has a role as a competent regulator and a specific substrate of Ero1alpha govern efficient and faithful oxidative protein folding and maintain the ER redox homeostasis (PMID:25258311)
• Selective sequestration of PDI1A in a calcium depletion-mediated complex with the abundant chaperone calreticulin attenuates the effective concentration of this major lumenal thiol oxidant. (PMID:25575667)
• Cole-Carpenter syndrome is caused by a specific de novo mutation in P4HB that impairs the disulfide isomerase activity of protein disulfide isomerase. (PMID:25683117)
• Association of P4HB polymorphisms with sporadic amyotrophic lateral sclerosis susceptibility in the Chinese Han population. (PMID:26000911)
• the effect of the endoplasmic reticulum chaperone protein disulfide isomerase (PDI) on beta-cell dysfunction, was examined. (PMID:26607804)
• direct binding of PDIA1 to VWF, is reported. (PMID:26670633)
• Amyotrophic lateral sclerosis-linked PDIA1 mutations disrupt motor neuron connectivity. (PMID:26869642)
• These findings improve our understanding of PDI-protected aggregation of wild-type alpha-Syn and its H50Q familial mutant. (PMID:27142583)
• a mechanism of dual Ero1alpha regulation by dynamic redox interactions between PDI and the two Ero1alpha flexible loops that harbor the regulatory cysteines. (PMID:27703014)
• DIA1 was robustly secreted by physiological levels of arterial laminar shear in endothelial cells and supported alpha 5 integrin thiol oxidation. (PMID:28034831)
• P4HB promotes hepatocellular carcinoma progression by down-regulating GRP78 expression and subsequently promoting epithelial-to-mesenchymal transition. (PMID:28052026)
• analysis of antiplatelet activity of CxxC through binding to Cys400 in the PDI a0 domain, which can be further exploited as a model for sitedriven antithrombotic agent development (PMID:28109047)
• analysis of how redox affects human protein disulfide isomerase regulate binding affinity of 17 beta-estradiol (PMID:28257787)
• Kinetic-based trapping by intervening sequence variants of the active sites of protein-disulfide isomerase identifies platelet protein substrates. (PMID:28364042)
• Current findings indicate that thiol isomerase-mediated disulfide bond modification in receptors and plasma proteins is an important layer of control of thrombosis and vascular function more generally. (PMID:28598864)
• Peroxynitrite preferentially oxidizes the dithiol redox motifs of protein-disulfide isomerase. (PMID:29191937)
• Study demonstrated that the expression of P4HB is frequently upregulated at the mRNA and protein levels in diffuse gliomas. Its high expression was significantly correlated with high Ki-67, more TP53 mutations and poor survival outcome. These findings imply that high expression of P4HB plays an important role in diffuse glioma progression. (PMID:29207176)
• identify a potent and selective PDIA1 inhibitor, KSC-34, with 30-fold selectivity for the a site over the a’ site. KSC-34 displays time-dependent inhibition of PDIA1 reductase activity in vitro with a kinact/ KI of 9.66 x 10(3) M(-1) s(-1) and is selective for PDIA1 over other members of the PDI family, and other cellular cysteine-containing proteins. (PMID:29521097)
• Overexpression of HIF-1alpha and P4HB is associated with poor prognosis in patients with gastric cancer. (PMID:29904245)
• this study uncovers a molecular link between PDIA1 and Drp1 oxidoreduction. (PMID:29924999)
• High P4HB expression is associated with colon cancer. (PMID:30431122)
• Ras overactivation switches the pattern of PDIA1-dependent Rac1/Nox1 regulation, so that Ras-induced PDIA1 bypass can directly activate Rac1. PDIA1 may be a crucial regulator of redox-dependent adaptive processes related to cancer progression. (PMID:30760703)
• The cell surface trafficking of PDIA1, PDIA3, and PDIA6 is dependent on KDELR1, which travels in a dynamic manner to the cell surface. This transport is assumed to result in PDI cell surface association, which differs from PDI inducible secretion into the extracellular space. (PMID:30958660)
• PDI role in the unfolded protein response and DNA repair in the glioblastoma. (PMID:30996048)
• circP4HB enhances EMT and metastatic NSCLC disease through miR-133a-5p sequestration, leading to upregulation of vimentin. (PMID:31005252)
• Our results confirm that P4HB plays a significant role in the regulatory network of HIF-1a. Therefore, HIF-1alpha and P4HB may be considered potential biomarkers of Gastric cancer (GC). (PMID:31467922)
• Compared with adjacent normal tissues, both the mRNA and protein levels of P4HB in ccRCC tissues were enhanced. (PMID:31640086)
• Phosphorylation switches protein disulfide isomerase activity to maintain proteostasis and attenuate ER stress. (PMID:32149426)

Cross-species orthologs

11 orthologs

Organism	Symbol	Gene ID
danio_rerio	p4hb	ENSDARG00000105116
mus_musculus	P4hb	ENSMUSG00000025130
rattus_norvegicus	P4hb	ENSRNOG00000036689
drosophila_melanogaster	ERp60	FBGN0033663
drosophila_melanogaster	Tmx3	FBGN0036579
drosophila_melanogaster	Pdi	FBGN0286818
caenorhabditis_elegans		WBGENE00003962
caenorhabditis_elegans		WBGENE00003963
caenorhabditis_elegans	pdi-3	WBGENE00003964
caenorhabditis_elegans	M04D5.1	WBGENE00014807
caenorhabditis_elegans	ZK973.11	WBGENE00022836

Paralogs (13): ERP44 (ENSG00000023318), PDIA5 (ENSG00000065485), TMX4 (ENSG00000125827), ERP27 (ENSG00000139055), TMX1 (ENSG00000139921), PDIA6 (ENSG00000143870), TXNDC11 (ENSG00000153066), PDIA4 (ENSG00000155660), TMX3 (ENSG00000166479), PDIA3 (ENSG00000167004), PDILT (ENSG00000169340), PDIA2 (ENSG00000185615), TXNDC5 (ENSG00000239264)

Protein

Protein identifiers

Protein disulfide-isomerase — P07237 (reviewed: P07237)

Alternative names: Cellular thyroid hormone-binding protein, Prolyl 4-hydroxylase subunit beta, p55

All UniProt accessions (33): A0A024R8S5, A0A7P0T8C0, A0A7P0T8J3, A0A7P0T8X1, A0A7P0T940, A0A7P0T9D6, A0A7P0T9E3, A0A7P0T9K9, A0A7P0T9S9, A0A7P0T9U6, A0A7P0TA35, A0A7P0TA71, A0A7P0TA97, A0A7P0TAX9, A0A7P0TB26, A0A7P0TBA3, A0A7P0TBP8, A0A7P0Z476, A0A7P0Z4B2, A0A7P0Z4F8, A0A7P0Z4J0, A0A7P0Z4S2, B3KTQ9, P07237, H0Y3Z3, H7BZ94, I3L0S0, I3L1Y5, I3L3P5, I3L3U6, I3L4M2, I3L514, I3NI03

UniProt curated annotations — full annotation on UniProt →

Function. This multifunctional protein catalyzes the formation, breakage and rearrangement of disulfide bonds. At the cell surface, seems to act as a reductase that cleaves disulfide bonds of proteins attached to the cell. May therefore cause structural modifications of exofacial proteins. Inside the cell, seems to form/rearrange disulfide bonds of nascent proteins. At high concentrations and following phosphorylation by FAM20C, functions as a chaperone that inhibits aggregation of misfolded proteins. At low concentrations, facilitates aggregation (anti-chaperone activity). May be involved with other chaperones in the structural modification of the TG precursor in hormone biogenesis. Also acts as a structural subunit of various enzymes such as prolyl 4-hydroxylase and microsomal triacylglycerol transfer protein MTTP. Receptor for LGALS9; the interaction retains P4HB at the cell surface of Th2 T helper cells, increasing disulfide reductase activity at the plasma membrane, altering the plasma membrane redox state and enhancing cell migration.

Subunit / interactions. Heterodimer; heterodimerizes with the protein microsomal triglyceride transfer MTTP. Homodimer. Monomers and homotetramers may also occur. Interacts with P4HA2, forming a heterotetramer consisting of 2 alpha subunits (P4HA2) and 2 beta (P4HB), where P4HB plays the role of a structural subunit; this tetramer catalyzes the formation of 4-hydroxyproline in collagen. Also constitutes the structural subunit of the microsomal triacylglycerol transfer protein MTTP in mammalian cells. Stabilizes both enzymes and retain them in the ER without contributing to the catalytic activity. Binds UBQLN1. Interacts with ERO1B. Binds to CD4, and upon HIV-1 binding to the cell membrane, is part of a P4HB/PDI-CD4-CXCR4-gp120 complex. Interacts with ILDR2. Interacts with ERN1/IRE1A (via N-terminus); the interaction is enhanced by phosphorylation of P4HB by FAM20C in response to endoplasmic reticulum stress and results in attenuation of ERN1 activity.

Subcellular location. Endoplasmic reticulum. Endoplasmic reticulum lumen. Melanosome. Cell membrane.

Post-translational modifications. Phosphorylation of Ser-357 by FAM20C is induced by endoplasmic reticulum stress and results in a functional switch from oxidoreductase to molecular chaperone. It also promotes interaction with ERN1.

Disease relevance. Cole-Carpenter syndrome 1 (CLCRP1) [MIM:112240] A form of Cole-Carpenter syndrome, a disorder characterized by features of osteogenesis imperfecta such as bone deformities and severe bone fragility with frequent fractures, in association with craniosynostosis, ocular proptosis, hydrocephalus, growth failure and distinctive facial features. Craniofacial findings include marked frontal bossing, midface hypoplasia, and micrognathia. Despite the craniosynostosis and hydrocephalus, intellectual development is normal. CLCRP1 inheritance is autosomal dominant. The disease is caused by variants affecting the gene represented in this entry.

Miscellaneous. Reduces and may activate fusogenic properties of HIV-1 gp120 surface protein, thereby enabling HIV-1 entry into the cell.

Similarity. Belongs to the protein disulfide isomerase family.

RefSeq proteins (1): NP_000909* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR005788	PDI_thioredoxin-like_dom	Domain
IPR005792	Prot_disulphide_isomerase	Family
IPR013766	Thioredoxin_domain	Domain
IPR017937	Thioredoxin_CS	Conserved_site
IPR036249	Thioredoxin-like_sf	Homologous_superfamily

Pfam: PF00085, PF13848

Enzyme classification (BRENDA):

• EC 5.3.4.1 — protein disulfide-isomerase (BRENDA: 81 organisms, 481 substrates, 347 inhibitors, 35 Km, 6 kcat entries)

Substrate kinetics (BRENDA)

15 substrates with measured Km, best-characterized 15. Km ranges are aggregated across organisms/conditions.

Substrate	Km (mM)	Measurements
CYSTEINE	1–3	3
MYCOTHIOL-COUPLED HYDROXYETHYL DISULFIDE	0.46–33.69	3
RIBONUCLEASE	0.002–0.01	3
RNASE A	0.007–0.05	3
2-MERCAPTOETHANOL	0.2–0.8	2
DITHIOTHREITOL	0.003–0.0054	2
GSH	5–17	2
RNASE	0.028–0.063	2
SCRAMBLED RIBONUCLEASE	0.0011–0.0033	2
DENATURED-REDUCED LYSOZYME	0.0253	1
INSULIN	2.026	1
INSULIN-(SS)	0.005	1
SCRAMBLED REOXIDIZED LYSOZYME	0.0116	1
SCRAMBLED RNASE	0.02	1
SRNASE	—	0

UniProt features (100 total): strand 31, helix 18, sequence conflict 12, turn 7, site 6, modified residue 6, mutagenesis site 6, active site 4, domain 2, disulfide bond 2, signal peptide 1, chain 1, sequence variant 1, region of interest 1, short sequence motif 1, compositionally biased region 1

Structure

Experimental structures (PDB)

14 structures.

PDB	Method	Resolution (Å)
8GDY	X-RAY DIFFRACTION	2.05
3BJ5	X-RAY DIFFRACTION	2.2
4JU5	X-RAY DIFFRACTION	2.28
3UEM	X-RAY DIFFRACTION	2.29
6I7S	X-RAY DIFFRACTION	2.5
4EKZ	X-RAY DIFFRACTION	2.51
4EL1	X-RAY DIFFRACTION	2.88
8EOJ	ELECTRON MICROSCOPY	3.07
7ZSC	X-RAY DIFFRACTION	3.85
1BJX	SOLUTION NMR
1MEK	SOLUTION NMR
1X5C	SOLUTION NMR
2BJX	SOLUTION NMR
2K18	SOLUTION NMR

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-P07237-F1	88.62	0.71

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Catalytic / active sites (10): 400 (nucleophile); 54 (contributes to redox potential value); 55 (contributes to redox potential value); 120 (lowers pka of c-terminal cys of first active site); 398 (contributes to redox potential value); 399 (contributes to redox potential value); 461 (lowers pka of c-terminal cys of second active site); 53 (nucleophile); 56 (nucleophile); 397 (nucleophile)

Post-translational modifications (6): 200, 222, 271, 331, 357, 427

Disulfide bonds (2): 53–56, 397–400

Mutagenesis-validated functional residues (6):

Position	Phenotype
128	reduced interaction with ern1. abolishes interaction with ern1; when associated with w-403.
331	phosphomimetic mutant. does not affect enzyme or chaperone activity.
357	abolishes phosphorylation at this site but protein is still phosphorylated at other sites. no changes in chaperone or en
357	phosphomimetic mutant. reduced resistance to protease digestion, sugesting adoption of an open conformation. increased c
403	reduced interaction with ern1. abolishes interaction with ern1; when associated with i-128.
427	phosphomimetic mutant. does not affect enzyme or chaperone activity. does not increase binding to ern1.

Function

Pathways and Gene Ontology

Reactome pathways

12 pathways

ID	Pathway
R-HSA-1650814	Collagen biosynthesis and modifying enzymes
R-HSA-264876	Insulin processing
R-HSA-3299685	Detoxification of Reactive Oxygen Species
R-HSA-381426	Regulation of Insulin-like Growth Factor (IGF) transport and uptake by Insulin-like Growth Factor Binding Proteins (IGFBPs)
R-HSA-5358346	Hedgehog ligand biogenesis
R-HSA-8866423	VLDL assembly
R-HSA-8957275	Post-translational protein phosphorylation
R-HSA-8963888	Chylomicron assembly
R-HSA-8964041	LDL remodeling
R-HSA-9020591	Interleukin-12 signaling
R-HSA-9020933	Interleukin-23 signaling
R-HSA-9918432	Maturation of DENV proteins

MSigDB gene sets: 427 (showing top): MODULE_93, SHIPP_DLBCL_VS_FOLLICULAR_LYMPHOMA_UP, GRUETZMANN_PANCREATIC_CANCER_DN, REACTOME_CYTOKINE_SIGNALING_IN_IMMUNE_SYSTEM, GOMF_OXIDOREDUCTASE_ACTIVITY_ACTING_ON_PAIRED_DONORS_WITH_INCORPORATION_OR_REDUCTION_OF_MOLECULAR_OXYGEN, GOBP_RESPONSE_TO_PEPTIDE, MODULE_151, ENK_UV_RESPONSE_KERATINOCYTE_UP, GOBP_ALPHA_AMINO_ACID_METABOLIC_PROCESS, GOBP_RESPONSE_TO_ENDOPLASMIC_RETICULUM_STRESS, GOBP_POSITIVE_REGULATION_OF_LYMPHOCYTE_MIGRATION, GOBP_REGULATION_OF_HORMONE_LEVELS, GOCC_CELL_SURFACE, MODULE_478, GOBP_POSITIVE_REGULATION_OF_SUBSTRATE_ADHESION_DEPENDENT_CELL_SPREADING

GO Biological Process (15): protein folding (GO:0006457), endoplasmic reticulum to Golgi vesicle-mediated transport (GO:0006888), peptidyl-proline hydroxylation to 4-hydroxy-L-proline (GO:0018401), insulin processing (GO:0030070), protein folding in endoplasmic reticulum (GO:0034975), response to endoplasmic reticulum stress (GO:0034976), interleukin-12-mediated signaling pathway (GO:0035722), interleukin-23-mediated signaling pathway (GO:0038155), positive regulation of cell adhesion (GO:0045785), positive regulation of viral entry into host cell (GO:0046598), cellular response to hypoxia (GO:0071456), cellular response to interleukin-7 (GO:0098761), positive regulation of substrate adhesion-dependent cell spreading (GO:1900026), regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902175), positive regulation of T cell migration (GO:2000406)

GO Molecular Function (13): RNA binding (GO:0003723), protein disulfide isomerase activity (GO:0003756), actin binding (GO:0003779), procollagen-proline 4-dioxygenase activity (GO:0004656), integrin binding (GO:0005178), protein-disulfide reductase activity (GO:0015035), thiol oxidase activity (GO:0016972), enzyme binding (GO:0019899), protein heterodimerization activity (GO:0046982), protein binding (GO:0005515), isomerase activity (GO:0016853), protein-containing complex binding (GO:0044877), dioxygenase activity (GO:0051213)

GO Cellular Component (16): extracellular region (GO:0005576), endoplasmic reticulum (GO:0005783), endoplasmic reticulum lumen (GO:0005788), endoplasmic reticulum-Golgi intermediate compartment (GO:0005793), cytosol (GO:0005829), cytoskeleton (GO:0005856), focal adhesion (GO:0005925), external side of plasma membrane (GO:0009897), procollagen-proline 4-dioxygenase complex (GO:0016222), lamellipodium (GO:0030027), protein-containing complex (GO:0032991), endoplasmic reticulum chaperone complex (GO:0034663), melanosome (GO:0042470), extracellular exosome (GO:0070062), plasma membrane (GO:0005886), membrane (GO:0016020)

Reactome top-level categories

Rollup of top-10 pathways:

Category	Pathways
Plasma lipoprotein assembly	2
Interleukin-12 family signaling	2
Collagen formation	1
Peptide hormone metabolism	1
Cellular response to chemical stress	1
Metabolism of proteins	1
Signaling by Hedgehog	1
Post-translational protein modification	1
Plasma lipoprotein remodeling	1
Dengue Virus Genome Translation and Replication	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
cytoplasm	4
cellular anatomical structure	3
cellular response to stress	2
cytokine-mediated signaling pathway	2
catalytic activity, acting on a protein	2
disulfide oxidoreductase activity	2
binding	2
intracellular membrane-bounded organelle	2
endoplasmic reticulum protein-containing complex	2
cellular process	1
protein maturation	1
intercellular transport	1
intracellular transport	1
Golgi vesicle transport	1
modified amino acid metabolic process	1
peptidyl-proline hydroxylation	1
L-amino acid metabolic process	1
non-proteinogenic amino acid metabolic process	1
peptide hormone processing	1
insulin metabolic process	1
protein folding	1
cellular response to interleukin-12	1
cell adhesion	1
regulation of cell adhesion	1
positive regulation of cellular process	1
regulation of viral entry into host cell	1
symbiont entry into host cell	1
positive regulation by symbiont of entry into host	1
positive regulation of viral life cycle	1
response to hypoxia	1
cellular response to decreased oxygen levels	1
cellular response to cytokine stimulus	1
response to interleukin-7	1
positive regulation of cell-substrate adhesion	1
substrate adhesion-dependent cell spreading	1
regulation of substrate adhesion-dependent cell spreading	1
intrinsic apoptotic signaling pathway in response to oxidative stress	1
regulation of intrinsic apoptotic signaling pathway	1
T cell migration	1
positive regulation of lymphocyte migration	1

Protein interactions and networks

STRING

4045 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
P4HB	P4HA1	P13674	979
P4HB	P4HA2	O15460	974
P4HB	HSPA5	P11021	952
P4HB	CANX	P27824	945
P4HB	P4HA3	Q7Z4N8	941
P4HB	EGF	P01133	938
P4HB	CALR	P27797	878
P4HB	OS9	Q13438	840
P4HB	SEL1L	Q9UBV2	836
P4HB	HSP90B1	P14625	834
P4HB	HSPA4	P34932	834
P4HB	SYVN1	Q86TM6	822
P4HB	VCP	P55072	820
P4HB	PPIB	P23284	819
P4HB	DERL2	Q9GZP9	805

IntAct

457 interactions, top by confidence:

A	B	Type	Score
RBM8A	CASC3	psi-mi:“MI:0914”(association)	0.900
TAP1	TAPBP	psi-mi:“MI:0914”(association)	0.800
P4HA2	P4HB	psi-mi:“MI:0915”(physical association)	0.740
NDUFS3	NDUFS8	psi-mi:“MI:0914”(association)	0.730
PRELID3B	TRIAP1	psi-mi:“MI:0914”(association)	0.710
P4HB	GRN	psi-mi:“MI:0915”(physical association)	0.670
P4HA3	FAM171A2	psi-mi:“MI:0914”(association)	0.640
LRFN4	P4HB	psi-mi:“MI:0915”(physical association)	0.560
CHCHD2	P4HB	psi-mi:“MI:0915”(physical association)	0.560
FZD10	P4HB	psi-mi:“MI:0915”(physical association)	0.560
P4HB	LCE2D	psi-mi:“MI:0915”(physical association)	0.560
P4HB	KRTAP4-11	psi-mi:“MI:0915”(physical association)	0.560
P4HB	LCN2	psi-mi:“MI:0915”(physical association)	0.560
P4HB	NTM	psi-mi:“MI:0915”(physical association)	0.560
P4HB	LRFN4	psi-mi:“MI:0915”(physical association)	0.560
P4HB	ODF1	psi-mi:“MI:0915”(physical association)	0.560
P4HB	CHCHD2	psi-mi:“MI:0915”(physical association)	0.560
P4HB	CNNM3	psi-mi:“MI:0915”(physical association)	0.560
P4HB	ZNF69	psi-mi:“MI:0915”(physical association)	0.560
P4HB	NECTIN2	psi-mi:“MI:0915”(physical association)	0.560
P4HB	KRTAP5-9	psi-mi:“MI:0915”(physical association)	0.560
P4HB	PLCXD3	psi-mi:“MI:0915”(physical association)	0.560
CEP104	CCDC66	psi-mi:“MI:2364”(proximity)	0.540
SYMPK	CPSF4	psi-mi:“MI:0914”(association)	0.530
EBNA-LP	HAX1	psi-mi:“MI:0914”(association)	0.530
P4HB	ZBTB2	psi-mi:“MI:0914”(association)	0.530
NEK7	P4HA2	psi-mi:“MI:0914”(association)	0.510

BioGRID (609): P4HB (Two-hybrid), P4HB (Affinity Capture-MS), P4HB (Affinity Capture-MS), P4HB (Affinity Capture-MS), P4HB (Affinity Capture-MS), P4HB (Affinity Capture-MS), P4HB (Affinity Capture-MS), P4HB (Affinity Capture-MS), P4HB (Reconstituted Complex), P4HB (Affinity Capture-MS), SUCO (Affinity Capture-MS), ZNF292 (Affinity Capture-MS), P4HA2 (Affinity Capture-MS), ZBTB2 (Affinity Capture-MS), P4HB (Affinity Capture-MS)

ESM2 similar proteins: A2VE29, A6QLU8, D3Z6P0, H2N4I1, O00391, O08841, P04785, P05307, P07237, P08003, P09102, P09103, P13667, P21195, P30040, P38657, P38659, P57759, P81628, P97278, P97346, Q0VCM5, Q13087, Q14554, Q29052, Q2HWU2, Q2KIL5, Q499T2, Q4VIT4, Q503L9, Q5E936, Q5I0H9, Q5R5B6, Q5RCH2, Q5WA72, Q61702, Q67IX6, Q6DKJ4, Q6GM16, Q6IUU3

Diamond homologs: D3Z6P0, D4B2L8, O13704, O13811, O22263, O48773, O51890, P00275, P04785, P05307, P07237, P08003, P09102, P09103, P0A617, P0AGG4, P0AGG5, P0AGG6, P0AGG7, P10473, P11598, P13667, P21195, P23400, P27773, P29828, P30101, P34329, P38657, P38659, P38660, P38661, P46843, P52230, P52233, P52588, P52589, P54399, P55059, P73263

SIGNOR signaling

3 interactions.

A	Effect	B	Mechanism
P4HB	“up-regulates quantity by stabilization”	Collagen	binding
P4HB	“down-regulates activity”	ERN1	binding
FAM20C	“up-regulates activity”	P4HB	phosphorylation

Enriched among interaction partners

Reactome pathways and GO biological processes over-represented among this gene’s 160 IntAct physical interaction partners (hypergeometric vs the genome-wide background, BH-FDR, gene-set size 15–500, ranked by fold). A functional readout of the neighbourhood — distinct from this gene’s own memberships above, and biased toward well-studied / hub proteins, so read it as themes rather than proof.

Reactome pathways:

Pathway	Partners	Fold	FDR
mRNA 3’-end processing	7	12.5×	7e-04
Mitochondrial protein degradation	8	8.3×	1e-03

Disease & clinical

Clinical variants and AI predictions

ClinVar

423 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	1
Likely pathogenic	2
Uncertain significance	177
Likely benign	156
Benign	53

Top pathogenic / likely-pathogenic (3)

Variant ID	HGVS	Classification
189337	NM_000918.4(P4HB):c.1178A>G (p.Tyr393Cys)	Pathogenic
1175197	NM_000918.4(P4HB):c.236dup (p.Leu79fs)	Likely pathogenic
2169599	NM_000918.4(P4HB):c.1198T>C (p.Cys400Arg)	Likely pathogenic

SpliceAI

1662 predictions. Top by Δscore:

Variant	Effect	Δscore
17:81844089:GATC:G	acceptor_gain	1.0000
17:81844090:ATCC:A	acceptor_loss	1.0000
17:81844091:TC:T	acceptor_gain	1.0000
17:81844091:TCCT:T	acceptor_loss	1.0000
17:81844092:CC:C	acceptor_gain	1.0000
17:81844092:CCTG:C	acceptor_loss	1.0000
17:81844093:C:CC	acceptor_gain	1.0000
17:81844094:T:C	acceptor_loss	1.0000
17:81844098:A:AC	acceptor_gain	1.0000
17:81844098:A:C	acceptor_gain	1.0000
17:81844101:C:CT	acceptor_gain	1.0000
17:81844102:A:T	acceptor_gain	1.0000
17:81845142:A:AC	donor_gain	1.0000
17:81845143:C:CC	donor_gain	1.0000
17:81845143:CGT:C	donor_gain	1.0000
17:81845163:T:TA	donor_gain	1.0000
17:81845227:TGACC:T	acceptor_loss	1.0000
17:81845228:GACCT:G	acceptor_loss	1.0000
17:81845229:ACC:A	acceptor_loss	1.0000
17:81845230:CCTGT:C	acceptor_loss	1.0000
17:81845231:C:CA	acceptor_loss	1.0000
17:81845232:T:G	acceptor_loss	1.0000
17:81845559:ACCGT:A	donor_gain	1.0000
17:81845560:CCGTC:C	donor_gain	1.0000
17:81845563:T:A	donor_gain	1.0000
17:81845610:A:AC	donor_gain	1.0000
17:81845611:C:CC	donor_gain	1.0000
17:81845613:TTG:T	donor_gain	1.0000
17:81845739:GCAT:G	acceptor_gain	1.0000
17:81845740:CAT:C	acceptor_gain	1.0000

AlphaMissense

3394 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
17:81845209:G:T	R461S	1.000
17:81845598:G:T	P441H	1.000
17:81845599:G:A	P441S	1.000
17:81845600:G:C	F440L	1.000
17:81845600:G:T	F440L	1.000
17:81845601:A:C	F440C	1.000
17:81845602:A:G	F440L	1.000
17:81845630:G:C	N430K	1.000
17:81845630:G:T	N430K	1.000
17:81845701:A:G	W407R	1.000
17:81845701:A:T	W407R	1.000
17:81845720:G:C	C400W	1.000
17:81845721:C:A	C400F	1.000
17:81845721:C:T	C400Y	1.000
17:81845722:A:G	C400R	1.000
17:81845723:G:C	H399Q	1.000
17:81845723:G:T	H399Q	1.000
17:81845725:G:C	H399D	1.000
17:81845729:A:C	C397W	1.000
17:81845730:C:A	C397F	1.000
17:81845730:C:G	C397S	1.000
17:81845730:C:T	C397Y	1.000
17:81845731:A:G	C397R	1.000
17:81845731:A:T	C397S	1.000
17:81845732:C:A	W396C	1.000
17:81845732:C:G	W396C	1.000
17:81845734:A:G	W396R	1.000
17:81845734:A:T	W396R	1.000
17:81845739:G:T	A394D	1.000
17:81846573:G:C	F304L	1.000

dbSNP variants (sampled 300 via entrez): RS1000183609 (17:81854814 C>T), RS1000192969 (17:81857921 A>C), RS1000234519 (17:81855136 A>G), RS1000258567 (17:81860597 CCGCGCGCGCTGGCCGCGGCG>C,CCG,CCGCGCGCGCTGGCCGCGGCGCGCGCGCGCTGGCCGCGGCG,CCGCGCGCGCTGGCCGCGGCGCGCGCGCTGGCCGCGGCG), RS1000410127 (17:81859780 G>A,C), RS1000518078 (17:81853506 G>A,C), RS1000637508 (17:81843926 G>A), RS1000799552 (17:81858905 C>T), RS1000821729 (17:81849598 T>C,G), RS1000865622 (17:81859912 G>A,C), RS1001123372 (17:81859518 T>A,G), RS1001145475 (17:81858755 A>G), RS1001377524 (17:81845471 C>A,G,T), RS1001555130 (17:81846765 A>C), RS1001668523 (17:81852122 G>A,C)

Disease associations

OMIM: gene MIM:176790 | disease phenotypes: MIM:112240, MIM:166200

GenCC curated gene-disease

Disease	Classification	Inheritance
Cole-Carpenter syndrome 1	Strong	Autosomal dominant
Cole-Carpenter syndrome	Supportive	Autosomal dominant
osteogenesis imperfecta type 1	Supportive	Autosomal dominant

Mondo (4): Cole-Carpenter syndrome 1 (MONDO:0007204), osteogenesis imperfecta (MONDO:0019019), Cole-Carpenter syndrome (MONDO:0016085), osteogenesis imperfecta type 1 (MONDO:0008146)

Orphanet (2): Cole-Carpenter syndrome (Orphanet:2050), Osteogenesis imperfecta (Orphanet:666)

HPO phenotypes

39 total (30 of 39 shown, HPO-id order):

HPO	Term
HP:0000006	Autosomal dominant inheritance
HP:0000238	Hydrocephalus
HP:0000262	Turricephaly
HP:0000347	Micrognathia
HP:0000494	Downslanted palpebral fissures
HP:0000520	Proptosis
HP:0000586	Shallow orbits
HP:0000592	Blue sclerae
HP:0000682	Abnormal dental enamel morphology
HP:0000684	Delayed eruption of teeth
HP:0000691	Microdontia
HP:0000703	Dentinogenesis imperfecta
HP:0000772	Abnormal rib morphology
HP:0000938	Osteopenia
HP:0000944	Abnormal metaphysis morphology
HP:0001252	Hypotonia
HP:0001263	Global developmental delay
HP:0001334	Communicating hydrocephalus
HP:0001382	Joint hypermobility
HP:0001511	Intrauterine growth retardation
HP:0001608	Abnormality of the voice
HP:0001620	Abnormally high-pitched voice
HP:0002007	Frontal bossing
HP:0002645	Wormian bones
HP:0002650	Scoliosis
HP:0002652	Skeletal dysplasia
HP:0002757	Recurrent fractures
HP:0002808	Kyphosis
HP:0002953	Vertebral compression fracture
HP:0003312	Abnormal form of the vertebral bodies

GWAS associations

0 associations (top):

MeSH disease descriptors (2)

Descriptor	Name	Tree numbers
D010013	Osteogenesis Imperfecta	C05.116.099.708.685; C16.320.737; C17.300.200.540
C535963	Cole Carpenter syndrome (supp.)

Drugs & pharmacology

Drug and pharmacology data

Is drug target: yes

ChEMBL targets (2): CHEMBL2364681 (PROTEIN COMPLEX), CHEMBL5422 (SINGLE PROTEIN)

Molecules with ChEMBL bioactivity

1 molecules (phase ≥1), by development phase (incl. off-target/promiscuous compounds). Patent mentions across the top 20 by phase: 1,626 (via chembl_molecule»patent_compound — counts attach to the compound, not the gene–compound relationship, so off-target/promiscuous molecules can dominate).

Molecule	Name	Phase	Patents
CHEMBL250450	ISOQUERCETIN	2	1,626

PharmGKB: 1 entry (VIP=true, CPIC=false)

Binding affinities (BindingDB)

16 measured of 53 human assays (53 total across all organisms); most potent 16 below. Values come from heterogeneous assays and are not directly comparable.

Ligand	Measure	Value	Patent
Juniferdin derivative, 1	IC50	156 nM
Juniferdin derivative, 13	IC50	167 nM
ethyl 1-[(3-chloro-4-hydroxyphenyl)methyl]-4-(2-phenoxyethyl)piperidine-4-carboxylate	IC50	250 nM	US-10064853: Compounds for use in methods for treating diseases or conditions mediated by protein disulfide isomerase
Juniferdin derivative, 3	IC50	453 nM
Juniferdin derivative, 10	IC50	565 nM
Juniferdin derivative, 4	IC50	627 nM
tert-butyl 1-[(3-chloro-4-hydroxyphenyl)methyl]-4-(2-phenoxyethyl)piperidine-4-carboxylate	IC50	650 nM	US-10064853: Compounds for use in methods for treating diseases or conditions mediated by protein disulfide isomerase
Juniferdin derivative, 5	IC50	693 nM
propan-2-yl 1-[(3-chloro-4-hydroxyphenyl)methyl]-4-(2-phenoxyethyl)piperidine-4-carboxylate	IC50	850 nM	US-10064853: Compounds for use in methods for treating diseases or conditions mediated by protein disulfide isomerase
Juniferdin derivative, 7	IC50	958 nM
Juniferdin derivative, 17	IC50	1850 nM
ethyl 1-(3-chloro-4-hydroxybenzoyl)-4-(2-phenoxyethyl)piperidine-4-carboxylate	IC50	2250 nM	US-10064853: Compounds for use in methods for treating diseases or conditions mediated by protein disulfide isomerase
Juniferdin derivative, 14	IC50	2530 nM
1-[(3-chloro-4-hydroxyphenyl)methyl]-N-ethyl-N-methyl-4-(2-phenoxyethyl)piperidine-4-carboxamide	IC50	3000 nM	US-10064853: Compounds for use in methods for treating diseases or conditions mediated by protein disulfide isomerase
1-[(3-chloro-4-hydroxyphenyl)methyl]-N-cyclopentyl-4-(2-phenoxyethyl)piperidine-4-carboxamide	IC50	4000 nM	US-10064853: Compounds for use in methods for treating diseases or conditions mediated by protein disulfide isomerase
1-[(3-chloro-4-hydroxyphenyl)methyl]-4-(2-phenoxyethyl)-N-phenylpiperidine-4-carboxamide	IC50	22500 nM	US-10064853: Compounds for use in methods for treating diseases or conditions mediated by protein disulfide isomerase

ChEMBL bioactivities

250 potent at pChembl≥5 of 329 total, top 50 by pChembl (potency: 10 = 0.1 nM, 6 = 1 µM).

pChembl	Type	Value	Unit	Molecule
7.81	AC50	15.5	nM	CHEMBL1572115
7.64	IC50	23	nM	CHEMBL4748449
7.25	AC50	56.8	nM	CHEMBL2145932
7.24	AC50	57.3	nM	CHEMBL2145930
7.21	Kd	62	nM	CHEMBL4637290
7.14	IC50	72	nM	CHEMBL4786482
7.04	IC50	92	nM	CHEMBL1369923
6.96	IC50	110	nM	CHEMBL3741464
6.92	IC50	120	nM	CHEMBL4483086
6.90	AC50	125	nM	CHEMBL1987920
6.89	IC50	130	nM	CHEMBL4472710
6.89	IC50	130	nM	CHEMBL1319324
6.85	IC50	140	nM	CHEMBL4740031
6.82	IC50	150	nM	CHEMBL3703646
6.82	IC50	150	nM	CHEMBL1688556
6.80	IC50	160	nM	CHEMBL4459949
6.77	IC50	170	nM	CHEMBL4780610
6.77	IC50	170	nM	CHEMBL590899
6.77	IC50	170	nM	CHEMBL591855
6.75	IC50	180	nM	CHEMBL1557864
6.75	IC50	180	nM	CHEMBL4790355
6.72	IC50	190	nM	CHEMBL1536119
6.72	IC50	190	nM	CHEMBL600752
6.71	AC50	195	nM	CHEMBL2145895
6.68	IC50	210	nM	CHEMBL4446669
6.68	IC50	210	nM	CHEMBL4550951
6.64	IC50	230	nM	CHEMBL4472807
6.64	IC50	230	nM	CHEMBL1554780
6.64	IC50	230	nM	CHEMBL2323557
6.60	IC50	250	nM	CHEMBL1536119
6.57	IC50	270	nM	CHEMBL4799930
6.54	IC50	290	nM	CHEMBL4782811
6.54	IC50	290	nM	CHEMBL4763853
6.52	IC50	300	nM	CHEMBL1565145
6.52	IC50	300	nM	CHEMBL1979298
6.52	IC50	300	nM	CHEMBL4753733
6.50	AC50	318	nM	CHEMBL2145894
6.48	IC50	330	nM	CHEMBL1485589
6.47	IC50	340	nM	CHEMBL1360077
6.47	IC50	340	nM	CHEMBL4764068
6.46	IC50	350	nM	CHEMBL4464788
6.46	IC50	350	nM	CHEMBL1433812
6.46	IC50	350	nM	CHEMBL4755661
6.46	IC50	350	nM	CHEMBL4776190
6.44	IC50	360	nM	CHEMBL4745645
6.43	IC50	370	nM	CHEMBL1434798
6.42	AC50	376	nM	CHEMBL1402451
6.41	IC50	390	nM	CHEMBL4756890
6.41	IC50	390	nM	CHEMBL4747596
6.40	IC50	400	nM	CHEMBL4520508

PubChem BioAssay actives

214 with measured affinity, of 405 total; 50 most potent distinct compounds. Largely complementary to BindingDB; screening values are coarse (µM, 4 dp), so sub-nM hits tie at the floor.

Compound	Assay	Type	Value	Unit
6-[1,3-benzodioxol-5-yl(pyrrolidin-1-yl)methyl]-1,3-benzodioxol-5-ol	1724139: Inhibition of recombinant human wild-type N-terminal His-tagged PDIA1 expressed in Escherichia coli strain BL21(DE3) using bovine insulin as substrate preincubated for 1 hr followed by substrate addition	ic50	0.0230	uM
2-[[4-(cyclopropanecarbonyl)piperazin-1-yl]methyl]-1,2-benzothiazol-3-one	1650854: Reversible binding affinity to full length human N-terminal His6-tagged PDIA1 alpha domain (18 to 134 residues) expressed in Escherichia coli BL21 Gold (DE3) by isothermal titration calorimetry	kd	0.0620	uM
6-[1,3-benzodioxol-5-yl-(pyridin-2-ylamino)methyl]-1,3-benzodioxol-5-ol	1724139: Inhibition of recombinant human wild-type N-terminal His-tagged PDIA1 expressed in Escherichia coli strain BL21(DE3) using bovine insulin as substrate preincubated for 1 hr followed by substrate addition	ic50	0.0720	uM
6-[(4-chlorophenyl)-morpholin-4-ylmethyl]-1,3-benzodioxol-5-ol	1724139: Inhibition of recombinant human wild-type N-terminal His-tagged PDIA1 expressed in Escherichia coli strain BL21(DE3) using bovine insulin as substrate preincubated for 1 hr followed by substrate addition	ic50	0.0920	uM
7-[anilino(phenyl)methyl]quinolin-8-ol	1724139: Inhibition of recombinant human wild-type N-terminal His-tagged PDIA1 expressed in Escherichia coli strain BL21(DE3) using bovine insulin as substrate preincubated for 1 hr followed by substrate addition	ic50	0.1100	uM
methyl 3-[(E)-3-(3-hydroxyphenyl)-3-oxoprop-1-enyl]benzoate	1592021: Inhibition of recombinant human N-terminal His-tagged PDI expressed in Escherichia coli BL21 (DE3) pLysS assessed as reduction in enzyme-mediated bovine insulin aggregation	ic50	0.1200	uM
methyl 3-[(E)-3-[3-bromo-4-(hydroxymethyl)phenyl]-3-oxoprop-1-enyl]benzoate	1592021: Inhibition of recombinant human N-terminal His-tagged PDI expressed in Escherichia coli BL21 (DE3) pLysS assessed as reduction in enzyme-mediated bovine insulin aggregation	ic50	0.1300	uM
6-[(4-methoxyphenyl)-morpholin-4-ylmethyl]-1,3-benzodioxol-5-ol	1724139: Inhibition of recombinant human wild-type N-terminal His-tagged PDIA1 expressed in Escherichia coli strain BL21(DE3) using bovine insulin as substrate preincubated for 1 hr followed by substrate addition	ic50	0.1300	uM
7-[(4-fluorophenyl)-[(4-methyl-2-pyridinyl)amino]methyl]quinolin-8-ol	1724139: Inhibition of recombinant human wild-type N-terminal His-tagged PDIA1 expressed in Escherichia coli strain BL21(DE3) using bovine insulin as substrate preincubated for 1 hr followed by substrate addition	ic50	0.1400	uM
7-[(4-nitroanilino)-phenylmethyl]quinolin-8-ol	1724139: Inhibition of recombinant human wild-type N-terminal His-tagged PDIA1 expressed in Escherichia coli strain BL21(DE3) using bovine insulin as substrate preincubated for 1 hr followed by substrate addition	ic50	0.1500	uM
7-[(3-hydroxy-4-methoxyphenyl)-[(4-methyl-2-pyridinyl)amino]methyl]quinolin-8-ol	1724139: Inhibition of recombinant human wild-type N-terminal His-tagged PDIA1 expressed in Escherichia coli strain BL21(DE3) using bovine insulin as substrate preincubated for 1 hr followed by substrate addition	ic50	0.1500	uM
[(2E,4R,9E)-4-hydroxy-2,5,5,9-tetramethylcycloundeca-2,9-dien-1-yl] 4-hydroxybenzoate	1799701: Reductase Activity Assay from Article 10.1021/cb100387r: “Discovery of a small molecule PDI inhibitor that inhibits reduction of HIV-1 envelope glycoprotein gp120.”	ic50	0.1560	uM
4-[(E)-3-(3-cyanophenyl)prop-2-enoyl]-N,N-dipentylbenzenesulfonamide	1592021: Inhibition of recombinant human N-terminal His-tagged PDI expressed in Escherichia coli BL21 (DE3) pLysS assessed as reduction in enzyme-mediated bovine insulin aggregation	ic50	0.1600	uM
[(1R,4E,6R,11R)-6-hydroxy-4,7,7,11-tetramethyl-12-oxabicyclo[9.1.0]dodec-4-en-3-yl] 4-hydroxybenzoate	1799701: Reductase Activity Assay from Article 10.1021/cb100387r: “Discovery of a small molecule PDI inhibitor that inhibits reduction of HIV-1 envelope glycoprotein gp120.”	ic50	0.1670	uM
7-[(4-chlorophenyl)-(pyridin-2-ylamino)methyl]quinolin-8-ol	1724139: Inhibition of recombinant human wild-type N-terminal His-tagged PDIA1 expressed in Escherichia coli strain BL21(DE3) using bovine insulin as substrate preincubated for 1 hr followed by substrate addition	ic50	0.1700	uM
7-[(4-ethylphenyl)-(pyridin-2-ylamino)methyl]quinolin-8-ol	1724139: Inhibition of recombinant human wild-type N-terminal His-tagged PDIA1 expressed in Escherichia coli strain BL21(DE3) using bovine insulin as substrate preincubated for 1 hr followed by substrate addition	ic50	0.1700	uM
6-[(4-hydroxy-3,5-dimethoxyphenyl)-(pyridin-2-ylamino)methyl]-1,3-benzodioxol-5-ol	1724139: Inhibition of recombinant human wild-type N-terminal His-tagged PDIA1 expressed in Escherichia coli strain BL21(DE3) using bovine insulin as substrate preincubated for 1 hr followed by substrate addition	ic50	0.1700	uM
7-[(4-hydroxy-3,5-dimethoxyphenyl)-[(5-methyl-2-pyridinyl)amino]methyl]quinolin-8-ol	1724139: Inhibition of recombinant human wild-type N-terminal His-tagged PDIA1 expressed in Escherichia coli strain BL21(DE3) using bovine insulin as substrate preincubated for 1 hr followed by substrate addition	ic50	0.1800	uM
6-[pyrrolidin-1-yl-(3,4,5-trimethoxyphenyl)methyl]-1,3-benzodioxol-5-ol	1724139: Inhibition of recombinant human wild-type N-terminal His-tagged PDIA1 expressed in Escherichia coli strain BL21(DE3) using bovine insulin as substrate preincubated for 1 hr followed by substrate addition	ic50	0.1800	uM
7-[(pyridin-2-ylamino)-(2,4,6-trimethylphenyl)methyl]quinolin-8-ol	1724139: Inhibition of recombinant human wild-type N-terminal His-tagged PDIA1 expressed in Escherichia coli strain BL21(DE3) using bovine insulin as substrate preincubated for 1 hr followed by substrate addition	ic50	0.1900	uM
6-[(2,2-difluoro-1,3-benzodioxol-5-yl)-piperidin-1-ylmethyl]-1-benzofuran-7-ol	1724139: Inhibition of recombinant human wild-type N-terminal His-tagged PDIA1 expressed in Escherichia coli strain BL21(DE3) using bovine insulin as substrate preincubated for 1 hr followed by substrate addition	ic50	0.2000	uM
6-[piperidin-1-yl(pyridin-4-yl)methyl]-1-benzofuran-7-ol	1724139: Inhibition of recombinant human wild-type N-terminal His-tagged PDIA1 expressed in Escherichia coli strain BL21(DE3) using bovine insulin as substrate preincubated for 1 hr followed by substrate addition	ic50	0.2000	uM
7-[[(4-methyl-2-pyridinyl)amino]-phenylmethyl]quinolin-8-ol	1724139: Inhibition of recombinant human wild-type N-terminal His-tagged PDIA1 expressed in Escherichia coli strain BL21(DE3) using bovine insulin as substrate preincubated for 1 hr followed by substrate addition	ic50	0.2000	uM
ethyl 2-[[(8-hydroxyquinolin-7-yl)-phenylmethyl]amino]benzoate	1724139: Inhibition of recombinant human wild-type N-terminal His-tagged PDIA1 expressed in Escherichia coli strain BL21(DE3) using bovine insulin as substrate preincubated for 1 hr followed by substrate addition	ic50	0.2000	uM
6-[1,3-benzodioxol-5-yl(morpholin-4-yl)methyl]-1,3-benzodioxol-5-ol	1724139: Inhibition of recombinant human wild-type N-terminal His-tagged PDIA1 expressed in Escherichia coli strain BL21(DE3) using bovine insulin as substrate preincubated for 1 hr followed by substrate addition	ic50	0.2000	uM
6-[(4-fluorophenyl)-pyrrolidin-1-ylmethyl]-1,3-benzodioxol-5-ol	1724139: Inhibition of recombinant human wild-type N-terminal His-tagged PDIA1 expressed in Escherichia coli strain BL21(DE3) using bovine insulin as substrate preincubated for 1 hr followed by substrate addition	ic50	0.2000	uM
6-[[4-(dimethylamino)phenyl]-pyrrolidin-1-ylmethyl]-1,3-benzodioxol-5-ol	1724139: Inhibition of recombinant human wild-type N-terminal His-tagged PDIA1 expressed in Escherichia coli strain BL21(DE3) using bovine insulin as substrate preincubated for 1 hr followed by substrate addition	ic50	0.2000	uM
(E)-1-(3-hydroxyphenyl)-3-(4-pyridin-4-ylphenyl)prop-2-en-1-one	1592021: Inhibition of recombinant human N-terminal His-tagged PDI expressed in Escherichia coli BL21 (DE3) pLysS assessed as reduction in enzyme-mediated bovine insulin aggregation	ic50	0.2100	uM
4-[(E)-3-(3-fluoro-4-hydroxyphenyl)-3-oxoprop-1-enyl]benzonitrile	1592021: Inhibition of recombinant human N-terminal His-tagged PDI expressed in Escherichia coli BL21 (DE3) pLysS assessed as reduction in enzyme-mediated bovine insulin aggregation	ic50	0.2100	uM
(E)-3-[4-(benzimidazol-1-yl)phenyl]-1-(3-hydroxyphenyl)prop-2-en-1-one	1592021: Inhibition of recombinant human N-terminal His-tagged PDI expressed in Escherichia coli BL21 (DE3) pLysS assessed as reduction in enzyme-mediated bovine insulin aggregation	ic50	0.2300	uM
6-[(4-hydroxy-3-methoxyphenyl)-morpholin-4-ylmethyl]-1,3-benzodioxol-5-ol	1724139: Inhibition of recombinant human wild-type N-terminal His-tagged PDIA1 expressed in Escherichia coli strain BL21(DE3) using bovine insulin as substrate preincubated for 1 hr followed by substrate addition	ic50	0.2300	uM
6-[(4-fluorophenyl)-morpholin-4-ylmethyl]-1,3-benzodioxol-5-ol	1724139: Inhibition of recombinant human wild-type N-terminal His-tagged PDIA1 expressed in Escherichia coli strain BL21(DE3) using bovine insulin as substrate preincubated for 1 hr followed by substrate addition	ic50	0.2300	uM
ethyl 1-[(3-chloro-4-hydroxyphenyl)methyl]-4-(2-phenoxyethyl)piperidine-4-carboxylate	2034967: Non-covalent inhibition of PDI (unknown origin) by insulin aggregation assay	ic50	0.2500	uM
6-[(4-fluorophenyl)-piperidin-1-ylmethyl]-1,3-benzodioxol-5-ol	1724139: Inhibition of recombinant human wild-type N-terminal His-tagged PDIA1 expressed in Escherichia coli strain BL21(DE3) using bovine insulin as substrate preincubated for 1 hr followed by substrate addition	ic50	0.2700	uM
4-[piperidin-1-yl-(4-pyrrol-1-ylphenyl)methyl]-1H-indazol-5-ol	1724139: Inhibition of recombinant human wild-type N-terminal His-tagged PDIA1 expressed in Escherichia coli strain BL21(DE3) using bovine insulin as substrate preincubated for 1 hr followed by substrate addition	ic50	0.2900	uM
6-[(4-fluorophenyl)-piperidin-1-ylmethyl]-2,3-dihydro-1,4-benzodioxin-5-ol	1724139: Inhibition of recombinant human wild-type N-terminal His-tagged PDIA1 expressed in Escherichia coli strain BL21(DE3) using bovine insulin as substrate preincubated for 1 hr followed by substrate addition	ic50	0.2900	uM
6-[piperidin-1-yl-[4-(trifluoromethyl)phenyl]methyl]-1-benzofuran-7-ol	1724139: Inhibition of recombinant human wild-type N-terminal His-tagged PDIA1 expressed in Escherichia coli strain BL21(DE3) using bovine insulin as substrate preincubated for 1 hr followed by substrate addition	ic50	0.3000	uM
4-[[(8-hydroxyquinolin-7-yl)-phenylmethyl]amino]benzoic acid	1724139: Inhibition of recombinant human wild-type N-terminal His-tagged PDIA1 expressed in Escherichia coli strain BL21(DE3) using bovine insulin as substrate preincubated for 1 hr followed by substrate addition	ic50	0.3000	uM
6-[(3,4-dimethoxyphenyl)-morpholin-4-ylmethyl]-1,3-benzodioxol-5-ol	1724139: Inhibition of recombinant human wild-type N-terminal His-tagged PDIA1 expressed in Escherichia coli strain BL21(DE3) using bovine insulin as substrate preincubated for 1 hr followed by substrate addition	ic50	0.3000	uM
6-[(2-methoxyphenyl)-morpholin-4-ylmethyl]-1,3-benzodioxol-5-ol	1724139: Inhibition of recombinant human wild-type N-terminal His-tagged PDIA1 expressed in Escherichia coli strain BL21(DE3) using bovine insulin as substrate preincubated for 1 hr followed by substrate addition	ic50	0.3300	uM
4-[piperidin-1-yl-[4-(1,3-thiazol-2-yl)phenyl]methyl]-1H-indazol-5-ol	1724139: Inhibition of recombinant human wild-type N-terminal His-tagged PDIA1 expressed in Escherichia coli strain BL21(DE3) using bovine insulin as substrate preincubated for 1 hr followed by substrate addition	ic50	0.3400	uM
6-[(2-hydroxyphenyl)-morpholin-4-ylmethyl]-1,3-benzodioxol-5-ol	1724139: Inhibition of recombinant human wild-type N-terminal His-tagged PDIA1 expressed in Escherichia coli strain BL21(DE3) using bovine insulin as substrate preincubated for 1 hr followed by substrate addition	ic50	0.3400	uM
(E)-1-(3-hydroxyphenyl)-3-(4-pyridin-3-ylphenyl)prop-2-en-1-one	1592021: Inhibition of recombinant human N-terminal His-tagged PDI expressed in Escherichia coli BL21 (DE3) pLysS assessed as reduction in enzyme-mediated bovine insulin aggregation	ic50	0.3500	uM
4-[(4-fluorophenyl)-piperidin-1-ylmethyl]-1H-indazol-5-ol	1724139: Inhibition of recombinant human wild-type N-terminal His-tagged PDIA1 expressed in Escherichia coli strain BL21(DE3) using bovine insulin as substrate preincubated for 1 hr followed by substrate addition	ic50	0.3500	uM
7-[(3-fluorophenyl)-[(4-methyl-2-pyridinyl)amino]methyl]quinolin-8-ol	1724139: Inhibition of recombinant human wild-type N-terminal His-tagged PDIA1 expressed in Escherichia coli strain BL21(DE3) using bovine insulin as substrate preincubated for 1 hr followed by substrate addition	ic50	0.3500	uM
6-[1,3-benzodioxol-5-yl(piperidin-1-yl)methyl]-1,3-benzodioxol-5-ol	1724139: Inhibition of recombinant human wild-type N-terminal His-tagged PDIA1 expressed in Escherichia coli strain BL21(DE3) using bovine insulin as substrate preincubated for 1 hr followed by substrate addition	ic50	0.3500	uM
6-[(2,4-dimethoxyphenyl)-pyrrolidin-1-ylmethyl]-1,3-benzodioxol-5-ol	1724139: Inhibition of recombinant human wild-type N-terminal His-tagged PDIA1 expressed in Escherichia coli strain BL21(DE3) using bovine insulin as substrate preincubated for 1 hr followed by substrate addition	ic50	0.3600	uM
7-[(2-chloro-3-hydroxyphenyl)-(pyridin-2-ylamino)methyl]quinolin-8-ol	1724139: Inhibition of recombinant human wild-type N-terminal His-tagged PDIA1 expressed in Escherichia coli strain BL21(DE3) using bovine insulin as substrate preincubated for 1 hr followed by substrate addition	ic50	0.3700	uM
7-[(2,3-dimethoxyphenyl)-morpholin-4-ylmethyl]quinolin-8-ol	1724139: Inhibition of recombinant human wild-type N-terminal His-tagged PDIA1 expressed in Escherichia coli strain BL21(DE3) using bovine insulin as substrate preincubated for 1 hr followed by substrate addition	ic50	0.3900	uM
7-[(2-methoxyanilino)-phenylmethyl]quinolin-8-ol	1724139: Inhibition of recombinant human wild-type N-terminal His-tagged PDIA1 expressed in Escherichia coli strain BL21(DE3) using bovine insulin as substrate preincubated for 1 hr followed by substrate addition	ic50	0.3900	uM

CTD chemical–gene interactions

81 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Tunicamycin	increases expression	5
Cadmium Chloride	decreases expression, increases abundance, affects expression, affects cotreatment, increases expression	4
bisphenol A	affects expression, decreases expression, increases expression	3
Tobacco Smoke Pollution	increases metabolic processing, affects expression, increases expression	3
Thapsigargin	increases expression	3
chloropicrin	decreases expression	2
bisphenol S	decreases methylation, increases expression	2
Cadmium	affects cotreatment, increases expression, decreases expression, increases abundance	2
Copper	affects binding	2
Zinc	affects binding, increases expression	2
Cyclosporine	increases expression	2
aristolochic acid I	decreases expression	1
ME-344	increases expression	1
bisphenol F	increases expression	1
beta-N-methylamino-L-alanine	increases expression	1
bufotalin	affects expression	1
myristicin	decreases expression	1
pyrogallol 1,3-dimethyl ether	affects cotreatment, affects localization, increases expression, decreases expression	1
beta-lapachone	decreases expression	1
sulforaphane	affects binding	1
sodium arsenite	decreases expression	1
tetrabromobisphenol A	decreases expression	1
N-phenylmaleimide	decreases reaction, increases reduction, decreases activity	1
2,3-bis(3’-hydroxybenzyl)butyrolactone	affects cotreatment, increases expression	1
cupric oxide	decreases expression	1
epigallocatechin gallate	increases expression	1
phenylarsonous acid	decreases reaction, increases reduction, decreases activity	1
di-n-butylphosphoric acid	affects expression	1
cylindrospermopsin	decreases expression	1
nickel acetate	affects expression	1

ChEMBL screening assays

69 unique, capped per target: 64 binding, 5 functional

Representative assays (with source publication via chembl_document):

Assay ID	Type	Description	Source paper
CHEMBL1964080	Functional	PUBCHEM_BIOASSAY: Turbidimetric Biochemical Primary HTS to identify inhibitors of Protein Disulfide Isomerase Measured in Biochemical System Using Plate Reader - 2137-01_Inhibitor_Dose_CherryPick_Activity. (Class of assay: confirmatory)	PubChem BioAssay data set
CHEMBL3215127	Binding	PubChem BioAssay. Turbidometric Biochemical Primary HTS to identify inhibitors of Protein Disulfide Isomerase Measured in Biochemical System Using Plate Reader - 2137-01_Inhibitor_Dose_DryPowder_Activity_Set2. (Class of assay: confirmator	PubChem BioAssay data set

Cellosaurus cell lines

4 cell lines: 4 cancer cell line

First 10 cell lines (id-ordered, not curated):

Cellosaurus	Name	Category	Sex
CVCL_B1CJ	Abcam A-431 P4HB KO	Cancer cell line	Female
CVCL_E2FR	HAP1 P4HB (-) 1	Cancer cell line	Male
CVCL_E2FS	HAP1 P4HB (-) 2	Cancer cell line	Male
CVCL_F1M9	HyCyte A-549 KO-hP4HB	Cancer cell line	Male

Clinical trials (associated diseases)

77 trials via MONDO — disease-level, not drug-specific.

Trial	Phase	Status	Title
NCT00131469	PHASE4	COMPLETED	Study of Teriparatide (FORTEO) to Treat Adults With Osteogenesis Imperfecta
NCT00159419	PHASE4	COMPLETED	Bisphosphonate Therapy for Osteogenesis Imperfecta
NCT01713231	PHASE4	COMPLETED	Effect of High-Dose Vitamin D on Bone Density in Osteogenesis Imperfecta
NCT02303873	PHASE4	COMPLETED	Efficacy and Safety of Alendronate in Chinese Children or Adolescents With Osteogenesis Imperfecta
NCT03735537	PHASE4	COMPLETED	Treatment of Osteogenesis Imperfecta With Parathyroid Hormone and Zoledronic Acid
NCT04152551	PHASE4	RECRUITING	Effects of Bisphosphonates on OI-Related Hearing Loss
NCT00001305	PHASE3	COMPLETED	Growth Hormone Therapy in Osteogenesis Imperfecta
NCT00005901	PHASE3	COMPLETED	Pamidronate to Treat Osteogenesis Imperfecta in Children
NCT00106028	PHASE3	COMPLETED	Safety and Efficacy of Risedronate in the Treatment of Osteogenesis Imperfecta in Children
NCT00982124	PHASE3	COMPLETED	An Efficacy and Safety Trial of Intravenous Zoledronic Acid in Infants Less Than One Year of Age, With Severe Osteogenesis Imperfecta
NCT02352753	PHASE3	TERMINATED	Multicenter,Single-arm Study to Evaluate Efficacy, Safety, & Pharmacokinetics of Denosumab in Children w/ OI
NCT03638128	PHASE3	TERMINATED	Open-label Extension of Study 20130173 of Denosumab in Children and Young Adults With Osteogenesis Imperfecta
NCT05768854	PHASE3	ACTIVE_NOT_RECRUITING	Setrusumab vs Bisphosphonates in Pediatric Subjects With Osteogenesis Imperfecta
NCT05972551	PHASE3	ACTIVE_NOT_RECRUITING	Study to Evaluate Efficacy and Safety of Romosozumab Compared With Bisphosphonates in Children and Adolescents With Osteogenesis Imperfecta
NCT06636071	PHASE3	ACTIVE_NOT_RECRUITING	Setrusumab in Pediatric Japanese Subjects With Osteogenesis Imperfecta
NCT07366086	PHASE3	RECRUITING	Pediatric Safety Follow-up Study of Prior Treatment With Romosozumab for Osteogenesis Imperfecta
NCT00063479	PHASE2	COMPLETED	Bisphosphonate Treatment of Osteogenesis Imperfecta
NCT00131118	PHASE2	COMPLETED	Zoledronic Acid in Children (1 -17 Years) With Severe Osteogenesis Imperfecta
NCT01417091	PHASE2	COMPLETED	Safety, Pharmacokinetics and Pharmacodynamics of BPS804 in Osteogenesis Imperfecta
NCT01679080	PHASE2	TERMINATED	The Effect of Treatment With Teriparatide and Zoledronic Acid in Patients With Osteogenesis Imperfecta
NCT01799798	PHASE2	COMPLETED	Translational Therapy in Patients With Osteogenesis Imperfecta - A Pilot Trial on Treatment With the Rankl-Antibody Denosumab
NCT03208582	PHASE2	COMPLETED	Do Bisphosphonates Alter the Skeletal Response to Mechanical Stimulation in Children With Osteogenesis Imperfecta?
NCT03216486	PHASE2	WITHDRAWN	An Exploratory Study of BPS804 Treatment in Adult Patients With Type I, III or IV Osteogenesis Imperfecta
NCT05312697	PHASE2	TERMINATED	Long-term Extension Study of Setrusumab in Adults With Type I, III, or IV Osteogenesis Imperfecta
NCT07062588	PHASE2	RECRUITING	Osteogenesis Imperfecta Trial of AGA2115 for ADUlts With COL1A1 and/or COL1A2 GeNetic Variations (IDUN)
NCT07557446	PHASE2	NOT_YET_RECRUITING	A Dose REgimen-Finding Study of AGA2115 in Chinese Patients With Osteogenesis ImpeRfecta (EIR)
NCT00705120	PHASE1	COMPLETED	Treatment of Severe Osteogenesis Imperfecta by Allogeneic Bone Marrow Transplantation
NCT02172885	PHASE1	COMPLETED	Mesenchymal Stem Cell Based Therapy for the Treatment of Osteogenesis Imperfecta
NCT03064074	PHASE1	COMPLETED	Safety of Fresolimumab in the Treatment of Osteogenesis Imperfecta
NCT04545554	PHASE1	COMPLETED	Study to Evaluate Romosozumab in Children and Adolescents With Osteogenesis Imperfecta
NCT05231668	PHASE1	TERMINATED	Single Ascending Dose Study of SAR439459 in Adults With Osteogenesis Imperfecta (OI)
NCT06086613	PHASE1	COMPLETED	A First-in-Human Study Evaluating AGA2115 in Adult Healthy Volunteers
NCT05125809	PHASE2/PHASE3	ACTIVE_NOT_RECRUITING	Setrusumab vs Placebo for Osteogenesis Imperfecta
NCT03706482	PHASE1/PHASE2	ACTIVE_NOT_RECRUITING	Boost Brittle Bones Before Birth
NCT04623606	PHASE1/PHASE2	UNKNOWN	Boost to Brittle Bones - Stem Cell Transplantation for Treatment of Brittle Bones
NCT05559801	PHASE1/PHASE2	NOT_YET_RECRUITING	Mesenchymal Cell Therapy in Osteogenesis Imperfecta (OI)
NCT00001594	Not specified	COMPLETED	Evaluation and Intervention for the Effects of Osteogenesis Imperfecta
NCT00076830	Not specified	COMPLETED	Evaluation and Treatment of Patients With Connective Tissue Disease
NCT00187018	Not specified	COMPLETED	Marrow Mesenchymal Cell Therapy for Osteogenesis Imperfecta: A Pilot Study
NCT00655681	Not specified	COMPLETED	Prevention of Post Operative Bone Loss in Children