PAOX

Summary

PAOX (polyamine oxidase, HGNC:20837) is a protein-coding gene on chromosome 10q26.3, encoding Peroxisomal N(1)-acetyl-spermine/spermidine oxidase (Q6QHF9). Flavoenzyme which catalyzes the oxidation of N(1)-acetylspermine to spermidine and is thus involved in the polyamine back-conversion.

Enables polyamine oxidase activity. Involved in polyamine metabolic process and positive regulation of spermidine biosynthetic process. Predicted to be located in cytosol and peroxisomal matrix. Predicted to be active in cytoplasm. Implicated in lung non-small cell carcinoma.

Source: NCBI Gene 196743 — automated summary from GO annotations (Alliance of Genome Resources).

At a glance

• GWAS associations: 5
• Clinical variants (ClinVar): 89 total
• GTEx eGene: eQTL in 42 tissues, sQTL in 15 (q < 0.05)
• Constraint (gnomAD): pLI 0.00 (LoF-tolerant), LOEUF 1.29 (unconstrained)
• MANE Select transcript: NM_152911
• Notable: 89 clinical variants but no curated precision-oncology (CIViC) evidence yet

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:20837
Approved symbol	PAOX
Name	polyamine oxidase
Location	10q26.3
Locus type	gene with protein product
Status	Approved
Aliases	PAO
Ensembl gene	ENSG00000148832
Ensembl biotype	protein_coding
OMIM	615853
Entrez	196743

Gene structure

Transcript identifiers

Ensembl transcripts: 18 — 11 protein_coding, 4 nonsense_mediated_decay, 3 protein_coding_CDS_not_defined

MANE Select: ENST00000278060

Transcript support level (Ensembl TSL; 1 = fully mRNA-supported): TSL 1: 7, TSL 2: 2, TSL 3: 1

ENST00000278060, ENST00000356306, ENST00000357296, ENST00000368535, ENST00000476834, ENST00000480071, ENST00000483211, ENST00000528127, ENST00000529585, ENST00000530555, ENST00000877115, ENST00000877116, ENST00000877117, ENST00000963865, ENST00000963866, ENST00001107134, ENST00001114166, ENST00001142683

RefSeq mRNA: 3 — MANE Select: NM_152911 NM_152911, NM_207127, NM_207128

CCDS: CCDS7682, CCDS7683, CCDS7684

Canonical transcript exons

ENST00000278060 — 7 exons

Exon	Start	End
ENSE00002164654	133379262	133379497
ENSE00003499305	133391312	133391694
ENSE00003537478	133389590	133389747
ENSE00003561236	133383960	133384212
ENSE00003566247	133388956	133389068
ENSE00003607381	133381460	133381659
ENSE00003667900	133379999	133380485

Expression profiles

Bgee: expression breadth ubiquitous, 216 present calls, max score 95.83.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 5.2132 / max 68.5220, expressed in 1604 samples.

Highest expression (Bgee): sperm, testis, male germ cell, lower esophagus mucosa, male germ line stem cell (sensu Vertebrata) in testis.

Genetic regulation across tissues (GTEx eQTL / sQTL)

PAOX is an eGene in GTEx v10 — its expression is genetically regulated (eQTL) in 42 tissues and its splicing (sQTL) in 15 (q < 0.05). Strongest associations first; slope = normalized effect of the lead variant’s alternative allele.

showing 20 of 57 significant tissue × QTL associations:

Tissue	QTL	q-value	Slope	Lead variant
Muscle Skeletal	eqtl	6.6e-33	+0.50	10:133383915:G:A
Nerve Tibial	eqtl	4.2e-23	+0.33	10:133382797:C:A
Artery Tibial	eqtl	9.4e-23	+0.42	10:133383915:G:A
Adipose Subcutaneous	eqtl	1.4e-21	+0.44	10:133383915:G:A
Esophagus Muscularis	eqtl	7.5e-19	+0.40	10:133387624:A:G
Artery Aorta	eqtl	1.0e-17	+0.52	10:133383915:G:A
Esophagus Mucosa	eqtl	5.2e-15	+0.33	10:133383915:G:A
Esophagus Gastroesophageal Junction	eqtl	8.0e-15	+0.39	10:133383915:G:A
Lung	eqtl	2.2e-13	+0.31	10:133383915:G:A
Cells Cultured fibroblasts	eqtl	3.7e-13	-0.63	10:133389373:C:T
Colon Transverse	eqtl	1.5e-12	+0.38	10:133383915:G:A
Brain Cortex	eqtl	2.1e-12	+0.57	10:133376816:C:T
Colon Sigmoid	eqtl	7.5e-12	+0.37	10:133383915:G:A
Skin Sun Exposed Lower leg	eqtl	1.0e-11	-0.52	10:133389373:C:T
Esophagus Mucosa	sqtl	1.6e-11	-0.89	10:133391072:CGTTTTCCTGGCTGTTGATGGATACATGTGAGCT:C
Brain Nucleus accumbens basal ganglia	eqtl	1.9e-11	+0.45	10:133382797:C:A
Brain Hypothalamus	eqtl	1.2e-09	+0.42	10:133382797:C:A
Testis	eqtl	2.2e-09	+0.17	10:133382797:C:A
Brain Caudate basal ganglia	eqtl	3.3e-09	+0.40	10:133382797:C:A
Skin Not Sun Exposed Suprapubic	eqtl	3.3e-09	-0.52	10:133299745:G:A

FANTOM5 promoters

3 alternative TSS:

Promoter ID	TPM avg	Samples expressed
107793	3.1302	1420
107794	2.0708	1014
107792	0.0123	3

Top tissues by expression

showing 100 of 279 tissues by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
sperm	CL:0000019	95.83	gold quality
left testis	UBERON:0004533	93.72	gold quality
right testis	UBERON:0004534	93.54	gold quality
male germ cell	CL:0000015	93.30	gold quality
testis	UBERON:0000473	90.94	gold quality
lower esophagus mucosa	UBERON:0035834	86.33	gold quality
male germ line stem cell (sensu Vertebrata) in testis	CL:0000089 ∩ UBERON:0000473	86.11	gold quality
primordial germ cell in gonad	CL:0000670 ∩ UBERON:0000991	85.07	gold quality
right lobe of liver	UBERON:0001114	85.02	gold quality
esophagus mucosa	UBERON:0002469	81.72	gold quality
mucosa of transverse colon	UBERON:0004991	79.74	gold quality
spleen	UBERON:0002106	78.68	gold quality
granulocyte	CL:0000094	78.47	gold quality
sural nerve	UBERON:0015488	78.17	gold quality
esophagus	UBERON:0001043	77.68	gold quality
cervix squamous epithelium	UBERON:0006922	77.23	gold quality
ventricular zone	UBERON:0003053	77.06	gold quality
small intestine Peyer’s patch	UBERON:0003454	76.79	gold quality
C1 segment of cervical spinal cord	UBERON:0006469	76.76	gold quality
monocyte	CL:0000576	76.75	gold quality
leukocyte	CL:0000738	76.72	gold quality
mononuclear cell	CL:0000842	76.51	gold quality
parotid gland	UBERON:0001831	76.03	silver quality
small intestine	UBERON:0002108	75.42	gold quality
tendon of biceps brachii	UBERON:0008188	75.29	silver quality
ectocervix	UBERON:0012249	75.24	gold quality
liver	UBERON:0002107	74.98	gold quality
Brodmann (1909) area 9	UBERON:0013540	74.75	gold quality
spinal cord	UBERON:0002240	74.71	gold quality
prefrontal cortex	UBERON:0000451	74.37	gold quality
medial globus pallidus	UBERON:0002477	74.34	silver quality
amygdala	UBERON:0001876	74.30	gold quality
vagina	UBERON:0000996	74.02	gold quality
lower esophagus	UBERON:0013473	73.97	gold quality
lower esophagus muscularis layer	UBERON:0035833	73.91	gold quality
cortical plate	UBERON:0005343	73.89	gold quality
right coronary artery	UBERON:0001625	73.78	gold quality
duodenum	UBERON:0002114	73.44	gold quality
ganglionic eminence	UBERON:0004023	73.43	gold quality
esophagus squamous epithelium	UBERON:0006920	73.27	gold quality
esophagogastric junction muscularis propria	UBERON:0035841	73.21	gold quality
muscle layer of sigmoid colon	UBERON:0035805	73.18	gold quality
minor salivary gland	UBERON:0001830	73.17	gold quality
tibial nerve	UBERON:0001323	73.06	gold quality
olfactory segment of nasal mucosa	UBERON:0005386	73.00	gold quality
body of stomach	UBERON:0001161	72.97	gold quality
endothelial cell	CL:0000115	72.94	gold quality
transverse colon	UBERON:0001157	72.80	gold quality
right frontal lobe	UBERON:0002810	72.77	gold quality
gastrocnemius	UBERON:0001388	72.76	gold quality
popliteal artery	UBERON:0002250	72.71	gold quality
saliva-secreting gland	UBERON:0001044	72.70	gold quality
tibial artery	UBERON:0007610	72.70	gold quality
jejunal mucosa	UBERON:0000399	72.67	gold quality
prostate gland	UBERON:0002367	72.67	gold quality
squamous epithelium	UBERON:0006914	72.62	gold quality
descending thoracic aorta	UBERON:0002345	72.55	gold quality
right adrenal gland	UBERON:0001233	72.47	gold quality
metanephros cortex	UBERON:0010533	72.43	gold quality
aorta	UBERON:0000947	72.37	gold quality
right adrenal gland cortex	UBERON:0035827	72.29	gold quality
left adrenal gland cortex	UBERON:0035825	72.25	gold quality
muscle of leg	UBERON:0001383	72.21	gold quality
thoracic aorta	UBERON:0001515	72.13	gold quality
mouth mucosa	UBERON:0003729	72.11	gold quality
right ovary	UBERON:0002118	72.10	gold quality
endocervix	UBERON:0000458	72.07	gold quality
left adrenal gland	UBERON:0001234	72.02	gold quality
ascending aorta	UBERON:0001496	71.95	gold quality
adult organism	UBERON:0007023	71.89	gold quality
skin of abdomen	UBERON:0001416	71.85	gold quality
skin of leg	UBERON:0001511	71.83	gold quality
anterior cingulate cortex	UBERON:0009835	71.73	gold quality
epithelium of esophagus	UBERON:0001976	71.70	gold quality
cingulate cortex	UBERON:0003027	71.66	gold quality
left coronary artery	UBERON:0001626	71.46	gold quality
left ovary	UBERON:0002119	71.31	gold quality
adrenal cortex	UBERON:0001235	71.20	gold quality
hindlimb stylopod muscle	UBERON:0004252	71.05	gold quality
body of uterus	UBERON:0009853	71.04	gold quality
apex of heart	UBERON:0002098	70.98	gold quality
right hemisphere of cerebellum	UBERON:0014890	70.95	gold quality
intestine	UBERON:0000160	70.89	gold quality
coronary artery	UBERON:0001621	70.82	gold quality
lymph node	UBERON:0000029	70.69	gold quality
globus pallidus	UBERON:0001875	70.63	silver quality
body of pancreas	UBERON:0001150	70.62	gold quality
dorsolateral prefrontal cortex	UBERON:0009834	70.44	gold quality
adult mammalian kidney	UBERON:0000082	70.43	gold quality
left uterine tube	UBERON:0001303	70.43	gold quality
putamen	UBERON:0001874	70.38	gold quality
neocortex	UBERON:0001950	70.32	gold quality
cerebellar hemisphere	UBERON:0002245	70.21	gold quality
colon	UBERON:0001155	70.15	gold quality
cerebellar cortex	UBERON:0002129	70.11	gold quality
stomach	UBERON:0000945	70.06	gold quality
mucosa of stomach	UBERON:0001199	70.05	gold quality
frontal cortex	UBERON:0001870	70.00	gold quality
large intestine	UBERON:0000059	69.85	gold quality
zone of skin	UBERON:0000014	69.81	gold quality

Single-cell (SCXA)

Detected in 1 experiment(s), a significant marker in 1.

Experiment	Marker?	Max mean expression
E-ANND-3	yes	5.10

HPA expression

RNA tissue specificity: Tissue enhanced

showing 60 of 70 HPA tissues / cells by nTPM:

Tissue / cell	Axis	nTPM
Spinal cord	tissue	10.9
Medulla oblongata	tissue	8.5
Midbrain	tissue	8.2
Superior colliculi	tissue	8.2
Pons	tissue	7.9
Corpus callosum	tissue	7.9
Thalamus	tissue	7.6
Substantia nigra	tissue	7.3
Hippocampal formation	tissue	6.8
Periaqueductal gray	tissue	6.3
Cerebral cortex	tissue	6.2
Hypothalamus	tissue	6.2
Somatosensory cortex	tissue	6.2
Cerebellum	tissue	6.0
Caudate putamen	tissue	6.0
Motor cortex	tissue	5.8
Frontal cortex	tissue	5.8
Entorhinal cortex	tissue	5.6
Ventral forebrain	tissue	5.5
Retrosplenial and cingulate cortex	tissue	5.4
Septum	tissue	5.4
Temporal cortex	tissue	5.3
Insular cortex	tissue	5.2
Choroid plexus	tissue	5.1
Prefrontal cortex	tissue	5.0
Putamen	tissue	4.9
Amygdala	tissue	4.9
Occipital cortex	tissue	4.9
Retrosplenial cortex	tissue	4.8
Basal ganglia	tissue	4.7
Testis	tissue	4.3
Olfactory bulb	tissue	4.2
Nucleus accumbens	tissue	3.1
Hippocampus	tissue	2.8
Locus coeruleus	tissue	2.6
Postcentral gyrus	tissue	2.6
Vagina	tissue	2.4
Small intestine	tissue	2.4
Spleen	tissue	2.2
Liver	tissue	2.0
Kidney	tissue	1.8
Duodenum	tissue	1.7
Salivary gland	tissue	1.5
Adipose tissue	tissue	1.4
Prostate	tissue	1.3
Stomach 1	tissue	1.2
Seminal vesicle	tissue	1.0
Pituitary gland	tissue	0.9
Skin 1	tissue	0.9
Colon	tissue	0.8
Pancreas	tissue	0.8
Esophagus	tissue	0.7
Cervix	tissue	0.5
Heart muscle	tissue	0.5
Urinary bladder	tissue	0.5
Lymph node	tissue	0.4
Ovary	tissue	0.4
Skeletal muscle	tissue	0.4
Endometrium 1	tissue	0.4
Tonsil	tissue	0.4

Brain sub-regions (HPA Brain Atlas): detected in 189; highest nTPM — Ventral spinal cord (10.9), Dorsal spinal cord (10.8), White matter (7.9), Ventral hippocampus (6.8), Dorsal hippocampus (6.2).

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

Targeting PAOX by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific).

9 miRNAs:

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-7978	99.86	66.90	856
HSA-MIR-6745	99.74	65.33	1321
HSA-MIR-363-5P	99.46	64.51	1015
HSA-MIR-6770-5P	98.97	66.76	1853
HSA-MIR-6787-3P	97.75	66.17	1233
HSA-MIR-409-5P	97.31	68.07	364
HSA-MIR-215-3P	97.02	68.01	1209
HSA-MIR-6729-3P	96.91	66.79	703
HSA-MIR-1291	96.28	65.89	1224

Functional genomics

gnomAD constraint: pLI 5.43e-13, LOEUF 1.29, missense Z 0.0836 — population loss-of-function intolerance (pLI ≥ 0.9 = LoF-intolerant; lower LOEUF = more constrained). gnomAD

Regional missense constraint (gnomAD RMC): no regional variation along ENST00000278060 — one region, missense o/e 0.97.

Literature-anchored findings (GeneRIF, showing 6)

• SSAT and SMO(PAOh1) activities are the major mediators of the cellular response of breast tumor cells to polyamines while PAO plays little or no role in this response (PMID:16207710)
• polyamine oxidase degrades alpha-methylpolyamines in a stereospecific manner (PMID:16354669)
• PAO activity in children with type 1 diabetes mellitus was very high; higher blood HbA(1C) and MDA levels confirm the presence of oxidant stress demonstrate that PAO activity may participate in these circumstances (PMID:20405312)
• copy number gain in the polyamine oxidase (PAOX) gene locus was accompanied by a coordinated transcriptional up-regulation in Primary myelofibrosis patients (PMID:26547506)
• Gene polymorphisms of SFTPB rs7316, rs9752 and PAOX rs1046175 affect the diagnostic value of plasma Pro-SFTPB and DAS in Chinese Han non-small-cell lung cancer patients. (PMID:31016788)
• Polyamine Oxidase Expression Is Downregulated by 17beta-Estradiol via Estrogen Receptor 2 in Human MCF-7 Breast Cancer Cells. (PMID:35886868)

Cross-species orthologs

12 orthologs

Organism	Symbol	Gene ID
danio_rerio	paox	ENSDARG00000003380
danio_rerio		ENSDARG00000109596
mus_musculus	Paox	ENSMUSG00000025464
rattus_norvegicus	Paox	ENSRNOG00000018838
drosophila_melanogaster	CG10561	FBGN0002036
drosophila_melanogaster	CG7737	FBGN0033584
drosophila_melanogaster	CG5653	FBGN0035943
drosophila_melanogaster	CG7460	FBGN0036749
drosophila_melanogaster	CG6034	FBGN0036750
drosophila_melanogaster	CG8032	FBGN0037606
caenorhabditis_elegans	spr-5	WBGENE00005010
caenorhabditis_elegans		WBGENE00011615

Paralogs (7): KDM1A (ENSG00000004487), MAOB (ENSG00000069535), SMOX (ENSG00000088826), IL4I1 (ENSG00000104951), PPOX (ENSG00000143224), KDM1B (ENSG00000165097), MAOA (ENSG00000189221)

Mouse-model phenotypes

Observed phenotypes of the mouse ortholog (MGI:1916983) from MGI (Alliance of Genome Resources) — knockout/mutant phenotypes, ranked by annotation count. 8 distinct phenotype terms.

Mouse phenotype (MP)	Records
hyperactivity	1
abnormal retina vasculature morphology	1
thrombocytopenia	1
increased heart rate variability	1
increased circulating aspartate transaminase level	1
cardiovascular system phenotype	1
abnormal retina blood vessel morphology	1
decreased fasting circulating glucose level	1

Additional cross-species homologs

Sequence homologs in species beyond Ensembl Compara’s model organisms, by Diamond local protein alignment (% sequence identity; best hit per species). Lower-identity rows are more distant homologs. The matched accessions’ gene symbols aren’t in biobtree yet, so each row shows the UniProt accession.

Organism	UniProt	Identity	Method
Bos taurus	Q865R1	83.6%	Diamond
Arabidopsis thaliana	Q9SU79	50.9%	Diamond
Oryza sativa Japonica Group	Q5NAI7	50.0%	Diamond

Genomic neighbors (locus context)

Genes flanking this one on the chromosome (NCBI/Entrez gene neighborhood). Positional context only — some neighbors share regulatory elements (bidirectional promoters, antisense/overlapping transcripts), but chromosomal adjacency is not itself a functional relationship (see Interactions for that).

Symbol	Type	Entrez
ZNF511-PRAP1	protein-coding	104326056
PRAP1	protein-coding	118471
ECHS1	protein-coding	1892
FUOM	protein-coding	282969
MIR3944	ncRNA	100500911
SPRN	protein-coding	503542
MTG1	protein-coding	92170
SCART1	protein-coding	619207

Protein

Protein identifiers

Peroxisomal N(1)-acetyl-spermine/spermidine oxidase — Q6QHF9 (reviewed: Q6QHF9)

Alternative names: Polyamine oxidase

All UniProt accessions (1): Q6QHF9

UniProt curated annotations — full annotation on UniProt →

Function. Flavoenzyme which catalyzes the oxidation of N(1)-acetylspermine to spermidine and is thus involved in the polyamine back-conversion. Can also oxidize N(1)-acetylspermidine to putrescine. Substrate specificity: N(1)-acetylspermine = N(1)-acetylspermidine > N(1),N(12)-diacylspermine » spermine. Does not oxidize spermidine. Plays an important role in the regulation of polyamine intracellular concentration and has the potential to act as a determinant of cellular sensitivity to the antitumor polyamine analogs.

Subunit / interactions. Monomer.

Subcellular location. Peroxisome. Cytoplasm.

Tissue specificity. Widely expressed. Not detected in spleen. Expressed at lower level in neoplastic tissues.

Cofactor. Binds 1 FAD per subunit.

Induction. By polyamine analogs.

Pathway. Amine and polyamine metabolism; spermine metabolism.

Miscellaneous. Oxidizes N(1)-acetylated polyamines on the exo-side of their N(4)-amino groups. Plant PAO oxidizes spermine on the endo-side of the N(4)-nitrogen. May be produced at very low levels due to a premature stop codon in the mRNA, leading to nonsense-mediated mRNA decay.

Similarity. Belongs to the flavin monoamine oxidase family.

Isoforms (4)

UniProt ID	Names	Canonical?
Q6QHF9-2	1	yes
Q6QHF9-6	2
Q6QHF9-5	3
Q6QHF9-4	4

RefSeq proteins (3): NP_690875, NP_997010, NP_997011 (=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR002937	Amino_oxidase	Domain
IPR036188	FAD/NAD-bd_sf	Homologous_superfamily
IPR050281	L-amino-acid_oxidase-like	Family

Pfam: PF01593

Enzyme classification (BRENDA)

• EC 1.5.3.13 — N1-acetylpolyamine oxidase (BRENDA: 7 organisms, 77 substrates, 31 inhibitors, 53 Km, 31 kcat entries)

Substrate kinetics (BRENDA)

22 substrates with measured Km, best-characterized 15. Km ranges are aggregated across organisms/conditions.

Substrate	Km (mM)	Measurements
N1-ACETYLSPERMINE	0.0008–0.382	16
SPERMINE	0.0093–11	8
N1-ACETYLSPERMIDINE	0.0021–0.028	5
ALPHA-METHYLSPERMINE	0.011–0.019	4
N1-PHENYL-(R)-ALPHA-METHYLSPERMIDINE	0.0016–0.002	2
3-[4-(3-AMINOPROPOXY)BUTOXY]-N-BENZYLPROPAN-1-AM	0.06	1
ALPHA-METHYLSPERMIDINE	0.016	1
N-[(2R)-4-[(4-AMINOBUTYL)AMINO]BUTAN-2-YL]PYRIDI	0.0036	1
N-[(2S)-4-[(4-AMINOBUTYL)AMINO]BUTAN-2-YL]PYRIDI	0.0008	1
N1,N11-DIACETYLNORSPERMINE	0.0027	1
N1-(3-[[(THIOPHEN-2-YL)METHYL]AMINO]PROPYL)OCTAN	0.001	1
N1-BENZOYL-(R)-ALPHA-METHYLSPERMIDINE	0.0012	1
N1-BENZOYL-(S)-ALPHA-METHYLSPERMIDINE	0.0002	1
N1-BENZYLDODECANE-1,12-DIAMINE	0.025	1
N1-BENZYLSPERMINE	0.0002	1

Catalyzed reactions (Rhea)

• N(1)-acetylspermine + O2 + H2O = 3-acetamidopropanal + spermidine + H2O2 (RHEA:25800)
• N(1)-acetylspermidine + O2 + H2O = 3-acetamidopropanal + putrescine + H2O2 (RHEA:25812)
• N(1),N(12)-diacetylspermine + O2 + H2O = 3-acetamidopropanal + N(1)-acetylspermidine + H2O2 (RHEA:25868)

UniProt features (28 total): binding site 10, sequence conflict 9, splice variant 6, chain 1, short sequence motif 1, modified residue 1

Structure

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q6QHF9-F1	92.77	0.85

Human Protein Atlas

Protein class: Enzymes, ENZYME proteins, Oxidoreductases, Metabolic proteins, Predicted intracellular proteins

Protein evidence: Evidence at protein level

Subcellular location (HPA, imaging): centrosome; nucleoplasm

Antibody reliability (HPA): IF uncertain

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Ligand- & substrate-binding residues (10)

Position	Role
472	FAD
481–482	FAD
24	FAD
45	FAD
53	FAD
69–70	FAD
72	substrate
194	substrate
247	FAD
320	substrate

Post-translational modifications (1)

Type	Positions
N-acetylmethionine	1

Function

Pathways and Gene Ontology

Reactome pathways

2 curated (TAS) of 10; 0 disease pathways. Curated-first; evidence = TAS (manually curated) vs IEA (electronic inference).

10 pathways:

ID	Pathway	Evidence
R-HSA-351200	Interconversion of polyamines	curated
R-HSA-141334	PAOs oxidise polyamines to amines	curated
R-HSA-140179	Amine Oxidase reactions	—
R-HSA-211859	Biological oxidations	—
R-HSA-1430728	Metabolism	—
R-HSA-71291	Metabolism of amino acids and derivatives	—
R-HSA-351202	Metabolism of polyamines	—
R-HSA-9033241	Peroxisomal protein import	electronic
R-HSA-211945	Phase I - Functionalization of compounds	—
R-HSA-9609507	Protein localization	—

MSigDB gene sets: 97 (showing top): REACTOME_BIOLOGICAL_OXIDATIONS, GOBP_POSITIVE_REGULATION_OF_AMINE_METABOLIC_PROCESS, GOBP_REGULATION_OF_AMINE_METABOLIC_PROCESS, PID_INTEGRIN_A9B1_PATHWAY, GOBP_POLYAMINE_METABOLIC_PROCESS, BONOME_OVARIAN_CANCER_POOR_SURVIVAL_DN, GOMF_OXIDOREDUCTASE_ACTIVITY_ACTING_ON_THE_CH_NH_GROUP_OF_DONORS, IVANOVA_HEMATOPOIESIS_EARLY_PROGENITOR, DURCHDEWALD_SKIN_CARCINOGENESIS_UP, GOCC_MICROBODY, GOCC_MICROBODY_LUMEN, ZHANG_RESPONSE_TO_IKK_INHIBITOR_AND_TNF_UP, BRUINS_UVC_RESPONSE_VIA_TP53_GROUP_A, GOBP_POLYAMINE_BIOSYNTHETIC_PROCESS, GOBP_SPERMIDINE_METABOLIC_PROCESS

GO Biological Process (7): polyamine catabolic process (GO:0006598), putrescine biosynthetic process (GO:0009446), putrescine catabolic process (GO:0009447), spermidine catabolic process (GO:0046203), spermine catabolic process (GO:0046208), positive regulation of spermidine biosynthetic process (GO:1901307), spermine metabolic process (GO:0008215)

GO Molecular Function (3): polyamine oxidase activity (GO:0046592), N(1)-acetylpolyamine oxidase activity (GO:0052903), oxidoreductase activity (GO:0016491)

GO Cellular Component (4): cytoplasm (GO:0005737), peroxisomal matrix (GO:0005782), cytosol (GO:0005829), peroxisome (GO:0005777)

Reactome top-level categories

7 top-level categories:

Category	Pathways
Metabolism	2
Amine Oxidase reactions	1
Metabolism of polyamines	1
Protein localization	1
Phase I - Functionalization of compounds	1
Biological oxidations	1
Metabolism of amino acids and derivatives	1

GO top-level categories

20 GO namespaces:

Category	Terms
polyamine catabolic process	3
polyamine metabolic process	2
putrescine metabolic process	2
cellular anatomical structure	2
biogenic amine catabolic process	1
polyamine biosynthetic process	1
spermidine metabolic process	1
spermine metabolic process	1
spermidine biosynthetic process	1
positive regulation of biosynthetic process	1
positive regulation of amine metabolic process	1
regulation of spermidine biosynthetic process	1
oxidoreductase activity, acting on the CH-NH group of donors, oxygen as acceptor	1
polyamine oxidase activity	1
catalytic activity	1
intracellular anatomical structure	1
peroxisome	1
microbody lumen	1
cytoplasm	1
microbody	1

Experimentally-supported GO annotations

GO terms backed by direct experimental evidence (ECO experimental codes) — 7 of 14 annotations. The rest are phylogenetic / computational / electronic (IEA).

7 experimentally-supported GO terms:

GO term	NS	Evidence
polyamine catabolic process	BP	direct assay
positive regulation of spermidine biosynthetic process	BP	direct assay
putrescine biosynthetic process	BP	direct assay
putrescine catabolic process	BP	direct assay
spermidine catabolic process	BP	direct assay
spermine catabolic process	BP	direct assay
polyamine oxidase activity	MF	direct assay

Protein interactions and networks

STRING

showing 15 of 497 interactions by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
PAOX	SAT1	P21673	980
PAOX	SAT2	Q96F10	889
PAOX	GLYATL1	Q969I3	830
PAOX	SRM	P19623	825
PAOX	SMS	P52788	812
PAOX	ODC1	P11926	796
PAOX	AZIN2	Q96A70	715
PAOX	AGMAT	Q9BSE5	683
PAOX	AOC1	P19801	671
PAOX	NR0B1	P51843	608
PAOX	OTC	P00480	582
PAOX	OAZ2	O95190	563
PAOX	PMF1	Q6P1K2	539
PAOX	A0A087WT04	A0A087WT04	532
PAOX	DHPS	P49366	515

IntAct

BioGRID (3 interactions; top human partners by supporting records): APEX1 (Affinity Capture-RNA), DDX39A (Affinity Capture-RNA), PEX5 (Protein-peptide)

Disease & clinical

Genetic variants

Variant evidence for PAOX: 89 ClinVar records (0 pathogenic / likely pathogenic); 5 GWAS associations.

ClinVar

89 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	65
Likely benign	16
Benign	0

SpliceAI

Top 10 splice-impact sites by Δscore (adjacent positions with the same effect merged into one range; 40 predictions of 706):

Position(s)	Effect	Δscore	Sites
10:133380444	donor_gain	1.0000
10:133380482	donor_gain	1.0000
10:133381660–133381661	donor_loss	1.0000	5
10:133388954–133388955	acceptor_loss	1.0000	6
10:133389069–133389070	donor_loss	1.0000	4
10:133381458–133381459	acceptor_loss	0.9900	6
10:133389069	donor_loss	0.9900
10:133389588–133389589	acceptor_loss	0.9900	5
10:133389748–133389749	donor_loss	0.9900	5
10:133380486–133380487	donor_loss	0.9800	6

AlphaMissense

859 missense substitutions predicted likely pathogenic (of 3,297 scored), across 249 residues. Top 20 hotspot residues, ranked by the number of likely-pathogenic substitutions (of those reachable by a single-nucleotide change), then by mean score:

Residue	Likely-pathogenic substitutions	Mean am_pathogenicity	Max am_pathogenicity
F469	8	0.928	0.984
H72	8	0.905	0.979
N78	8	0.903	0.991
D218	8	0.881	0.932
H483	8	0.871	0.926
F367	8	0.791	0.957
W427	7	0.966	0.990
F327	7	0.958	0.987
E472	7	0.947	0.990
F81	7	0.945	0.987
E392	7	0.931	0.978
W70	7	0.930	0.973
W332	7	0.922	0.974
W252	7	0.918	0.961
F382	7	0.898	0.985
E45	7	0.887	0.939
W360	7	0.877	0.968
E191	7	0.854	0.928
E492	7	0.853	0.956
F317	7	0.849	0.975

HPA cancer prognostics

RNA cancer specificity: Low cancer specificity

Human Protein Atlas survival analysis — favorable = higher expression predicts better survival.

1 prognostic cancer types:

Cancer	Prognostic	p-value
Liver Hepatocellular Carcinoma (validation)	favorable	0.000146

Disease associations

OMIM: gene MIM:615853 | disease phenotypes:

GWAS associations

5 associations:

Study	Trait	p-value
GCST012020_28	Serum metabolite levels	8e-30
GCST009735_36	Urinary metabolite modules (eigenmetabolites) in chronic kidney disease	9e-17
GCST012020_27	Serum metabolite levels	1e-16
GCST009733_20	Urinary metabolite levels in chronic kidney disease	1e-14
GCST009733_100	Urinary metabolite levels in chronic kidney disease	7e-12

EFO canonical traits (from GWAS)

1 canonical traits:

EFO ID	Trait name
EFO:0005116	urinary metabolite measurement

Drugs & pharmacology

Drug and pharmacology data

Is drug target: yes

ChEMBL targets (1): CHEMBL2105 (SINGLE PROTEIN)

PharmGKB: 1 entry (CPIC guideline: no)

Binding affinities (BindingDB)

136 measured of 143 human assays (145 total across all organisms); most potent 50 below. Values come from heterogeneous assays and are not directly comparable.

Ligand	Measure	Value	Patent
N,N’-BIS(2,3-BUTADIENYL)-1,4-BUTANE-DIAMINE	KI	90 nM
CHEMBL176596	KI	96 nM
CHEMBL367753	KI	100 nM
N-Buta-2,3-dienyl-N’-methyl-butane-1,4-diamine	KI	300 nM
CHEMBL175345	KI	630 nM
N*1*-Buta-2,3-dienyl-butane-1,4-diamine	KI	700 nM
CHEMBL175307	KI	1000 nM
7-Amino-heptan-2-one	KI	2200 nM
N-[2-(1H-imidazol-5-yl)ethyl]-5,7-diphenylpyrazolo[1,5-a]pyrimidine-2-carboxamide	IC50	11000 nM	US-20250161307: PYRAZOLOPYRIMIDINES AS MODULATORS OF SPERMINE OXIDASE
5,7-diphenyl-N-[3-(pyridin-2-ylamino)propyl]pyrazolo[1,5-a]pyrimidine-2-carboxamide	IC50	22000 nM	US-20250161307: PYRAZOLOPYRIMIDINES AS MODULATORS OF SPERMINE OXIDASE
CHEMBL176530	KI	26000 nM
CHEMBL177305	KI	31000 nM
N-[2-(1H-imidazol-2-yl)ethyl]-5,7-diphenylpyrazolo[1,5-a]pyrimidine-2-carboxamide	IC50	35000 nM	US-20250161307: PYRAZOLOPYRIMIDINES AS MODULATORS OF SPERMINE OXIDASE
N-[3-(1H-imidazol-5-yl)propyl]-5,7-diphenylpyrazolo[1,5-a]pyrimidine-2-carboxamide	IC50	49000 nM	US-20250161307: PYRAZOLOPYRIMIDINES AS MODULATORS OF SPERMINE OXIDASE
CHEMBL174669	KI	75000 nM
5,7-diphenyl-N-[2-(pyridin-2-ylamino)ethyl]pyrazolo[1,5-a]pyrimidine-2-carboxamide	IC50	85000 nM	US-20250161307: PYRAZOLOPYRIMIDINES AS MODULATORS OF SPERMINE OXIDASE
N-[3-(methylamino)propyl]-5,7-diphenylpyrazolo[1,5-a]pyrimidine-2-carboxamide	IC50	103000 nM	US-20250161307: PYRAZOLOPYRIMIDINES AS MODULATORS OF SPERMINE OXIDASE
CHEMBL177890	KI	110000 nM
N-(3-aminopropyl)-5,7-diphenylpyrazolo[1,5-a]pyrimidine-2-carboxamide	IC50	119000 nM	US-20250161307: PYRAZOLOPYRIMIDINES AS MODULATORS OF SPERMINE OXIDASE
N-(3-imidazol-1-ylpropyl)-7-(3-methylphenyl)-5-phenylpyrazolo[1,5-a]pyrimidine-2-carboxamide	IC50	123000 nM	US-20250161307: PYRAZOLOPYRIMIDINES AS MODULATORS OF SPERMINE OXIDASE
5,7-diphenyl-N-(4-pyrrolidin-1-ylbutyl)pyrazolo[1,5-a]pyrimidine-2-carboxamide	IC50	129000 nM	US-20250161307: PYRAZOLOPYRIMIDINES AS MODULATORS OF SPERMINE OXIDASE
CHEMBL174887	KI	130000 nM
N-(3-imidazol-1-ylpropyl)-7-phenyl-5-[4-(trifluoromethyl)phenyl]pyrazolo[1,5-a]pyrimidine-2-carboxamide	IC50	181000 nM	US-20250161307: PYRAZOLOPYRIMIDINES AS MODULATORS OF SPERMINE OXIDASE
5,7-diphenyl-N-(pyrrolidin-2-ylmethyl)pyrazolo[1,5-a]pyrimidine-2-carboxamide	IC50	197000 nM	US-20250161307: PYRAZOLOPYRIMIDINES AS MODULATORS OF SPERMINE OXIDASE
N-(azetidin-3-yl)-5,7-diphenylpyrazolo[1,5-a]pyrimidine-2-carboxamide	IC50	213000 nM	US-20250161307: PYRAZOLOPYRIMIDINES AS MODULATORS OF SPERMINE OXIDASE
N-(2-imidazol-1-ylethyl)-5,7-diphenylpyrazolo[1,5-a]pyrimidine-2-carboxamide	IC50	233000 nM	US-20250161307: PYRAZOLOPYRIMIDINES AS MODULATORS OF SPERMINE OXIDASE
CHEMBL176764	KI	260000 nM
N-(3-imidazol-1-ylpropyl)-7-(2-methoxyphenyl)-5-phenylpyrazolo[1,5-a]pyrimidine-2-carboxamide	IC50	289000 nM	US-20250161307: PYRAZOLOPYRIMIDINES AS MODULATORS OF SPERMINE OXIDASE
N-(3-imidazol-1-ylpropyl)-7-(3-methoxyphenyl)-5-phenylpyrazolo[1,5-a]pyrimidine-2-carboxamide	IC50	291000 nM	US-20250161307: PYRAZOLOPYRIMIDINES AS MODULATORS OF SPERMINE OXIDASE
5,7-diphenyl-N-(5,6,7,8-tetrahydroimidazo[1,2-a]pyridin-6-ylmethyl)pyrazolo[1,5-a]pyrimidine-2-carboxamide	IC50	306000 nM	US-20250161307: PYRAZOLOPYRIMIDINES AS MODULATORS OF SPERMINE OXIDASE
N-[(1-methylpyrrolidin-3-yl)methyl]-5,7-diphenylpyrazolo[1,5-a]pyrimidine-2-carboxamide	IC50	307000 nM	US-20250161307: PYRAZOLOPYRIMIDINES AS MODULATORS OF SPERMINE OXIDASE
N-Methyl-N’-prop-2-ynyl-butane-1,4-diamine	KI	310000 nM
N-[3-(azetidin-1-yl)propyl]-5,7-diphenylpyrazolo[1,5-a]pyrimidine-2-carboxamide	IC50	362000 nM	US-20250161307: PYRAZOLOPYRIMIDINES AS MODULATORS OF SPERMINE OXIDASE
CHEMBL436093	KI	376000 nM
7-(3-hydroxyphenyl)-N-(3-imidazol-1-ylpropyl)-5-phenylpyrazolo[1,5-a]pyrimidine-2-carboxamide	IC50	387000 nM	US-20250161307: PYRAZOLOPYRIMIDINES AS MODULATORS OF SPERMINE OXIDASE
N-[3-(1-methylimidazol-2-yl)propyl]-5,7-diphenylpyrazolo[1,5-a]pyrimidine-2-carboxamide	IC50	397000 nM	US-20250161307: PYRAZOLOPYRIMIDINES AS MODULATORS OF SPERMINE OXIDASE
N*1*-Prop-2-ynyl-butane-1,4-diamine	KI	425000 nM
7-cyclobutyl-N-(3-imidazol-1-ylpropyl)-5-phenylpyrazolo[1,5-a]pyrimidine-2-carboxamide	IC50	470000 nM	US-20250161307: PYRAZOLOPYRIMIDINES AS MODULATORS OF SPERMINE OXIDASE
5-(4-fluorophenyl)-N-(1-methylazetidin-3-yl)-7-phenylpyrazolo[1,5-a]pyrimidine-2-carboxamide	IC50	485000 nM	US-20250161307: PYRAZOLOPYRIMIDINES AS MODULATORS OF SPERMINE OXIDASE
N-(1-methylazetidin-3-yl)-5-phenyl-7-pyridin-2-ylpyrazolo[1,5-a]pyrimidine-2-carboxamide	IC50	520000 nM	US-20250161307: PYRAZOLOPYRIMIDINES AS MODULATORS OF SPERMINE OXIDASE
N-[(1-cyclopropylpyrrolidin-3-yl)methyl]-5,7-diphenylpyrazolo[1,5-a]pyrimidine-2-carboxamide	IC50	535000 nM	US-20250161307: PYRAZOLOPYRIMIDINES AS MODULATORS OF SPERMINE OXIDASE
7-(3-acetamidophenyl)-N-(3-imidazol-1-ylpropyl)-5-phenylpyrazolo[1,5-a]pyrimidine-2-carboxamide	IC50	544000 nM	US-20250161307: PYRAZOLOPYRIMIDINES AS MODULATORS OF SPERMINE OXIDASE
N-(1-methylazetidin-3-yl)-7-phenyl-5-[2-(trifluoromethyl)phenyl]pyrazolo[1,5-a]pyrimidine-2-carboxamide	IC50	547000 nM	US-20250161307: PYRAZOLOPYRIMIDINES AS MODULATORS OF SPERMINE OXIDASE
5,7-diphenyl-N-(pyrrolidin-3-ylmethyl)pyrazolo[1,5-a]pyrimidine-2-carboxamide	IC50	641000 nM	US-20250161307: PYRAZOLOPYRIMIDINES AS MODULATORS OF SPERMINE OXIDASE
N-(1-methylazetidin-3-yl)-5-phenyl-7-pyrimidin-2-ylpyrazolo[1,5-a]pyrimidine-2-carboxamide	IC50	643000 nM	US-20250161307: PYRAZOLOPYRIMIDINES AS MODULATORS OF SPERMINE OXIDASE
CHEMBL177777	KI	650000 nM
5-(3-fluorophenyl)-N-(1-methylazetidin-3-yl)-7-phenylpyrazolo[1,5-a]pyrimidine-2-carboxamide	IC50	666000 nM	US-20250161307: PYRAZOLOPYRIMIDINES AS MODULATORS OF SPERMINE OXIDASE
N-[3-(dimethylamino)propyl]-5,7-diphenylpyrazolo[1,5-a]pyrimidine-2-carboxamide	IC50	680000 nM	US-20250161307: PYRAZOLOPYRIMIDINES AS MODULATORS OF SPERMINE OXIDASE
N-(3-imidazol-1-ylpropyl)-5,7-diphenylpyrazolo[1,5-a]pyrimidine-2-carboxamide	IC50	739000 nM	US-20250161307: PYRAZOLOPYRIMIDINES AS MODULATORS OF SPERMINE OXIDASE
CHEMBL81241	KI	800000 nM

ChEMBL bioactivities

11 potent at pChembl≥5 of 14 total, top 11 by pChembl (potency: 10 = 0.1 nM, 6 = 1 µM).

pChembl	Type	Value	Unit	Molecule
7.05	Ki	90	nM	CHEMBL417844
7.02	Ki	96	nM	CHEMBL176596
7.00	Ki	100	nM	CHEMBL367753
6.75	Ki	180	nM	CHEMBL173782
6.52	Ki	300	nM	CHEMBL293698
6.20	Ki	630	nM	CHEMBL175345
6.16	Ki	700	nM	CHEMBL59622
6.10	IC50	790	nM	CHEMBL5094181
6.00	Ki	1000	nM	CHEMBL175307
5.68	IC50	2100	nM	CHEMBL5092747
5.66	Ki	2200	nM	CHEMBL176843

PubChem BioAssay actives

10 with measured affinity, of 83 total; 10 most potent distinct compounds. Largely complementary to BindingDB; screening values are coarse (µM, 4 dp), so sub-nM hits tie at the floor.

Compound	Assay	Type	Value	Unit
N,N’-bis(buta-2,3-dienyl)butane-1,4-diamine	162582: Inhibitory activity measured as apparent dissociation constant against Polyamine oxidase (PAO) from pig liver	ki	0.0900	uM
7-[3-(dimethylamino)propylamino]heptan-2-one	144352: Ability to inhibit the deacetylation of [acetyl-3H]-N8-Acetylspermidine deacetylase in rat liver.	ki	0.0960	uM
7-[3-(diethylamino)propylamino]heptan-2-one	144352: Ability to inhibit the deacetylation of [acetyl-3H]-N8-Acetylspermidine deacetylase in rat liver.	ki	0.1000	uM
Chlorhexidine	1803253: Enzyme Inhibition Assay from Article 10.3109/14756366.2011.650691: “Inhibition of acetylpolyamine and spermine oxidases by the polyamine analogue chlorhexidine.”	ki	0.1000	uM
7-(3-aminopropylamino)heptan-2-one	144352: Ability to inhibit the deacetylation of [acetyl-3H]-N8-Acetylspermidine deacetylase in rat liver.	ki	0.1800	uM
N’-buta-2,3-dienyl-N-methylbutane-1,4-diamine	162582: Inhibitory activity measured as apparent dissociation constant against Polyamine oxidase (PAO) from pig liver	ki	0.3000	uM
7-(4-methylpiperazin-1-yl)heptan-2-one	144352: Ability to inhibit the deacetylation of [acetyl-3H]-N8-Acetylspermidine deacetylase in rat liver.	ki	0.6300	uM
N’-buta-2,3-dienylbutane-1,4-diamine	162582: Inhibitory activity measured as apparent dissociation constant against Polyamine oxidase (PAO) from pig liver	ki	0.7000	uM
7-(3-morpholin-4-ylpropylamino)heptan-2-one	144352: Ability to inhibit the deacetylation of [acetyl-3H]-N8-Acetylspermidine deacetylase in rat liver.	ki	1.0000	uM
7-aminoheptan-2-one	144349: Inhibition of deacetylation of [acetyl-3H]-N8-Acetylspermidine deacetylase in rat liver	ki	2.2000	uM

CTD chemical–gene interactions

25 total (human), top 25 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Benzo(a)pyrene	decreases expression, increases methylation	2
Smoke	decreases expression, increases abundance, increases expression	2
Cyclosporine	decreases methylation, decreases expression	2
GSK-J4	decreases expression	1
afuresertib	increases expression	1
methylmercuric chloride	decreases expression	1
sulforaphane	decreases expression	1
tris(1,3-dichloro-2-propyl)phosphate	decreases expression	1
di-n-butylphosphoric acid	affects expression	1
jinfukang	affects cotreatment, increases expression	1
Sunitinib	increases expression	1
Arsenic Trioxide	increases expression	1
Air Pollutants	increases abundance, increases expression	1
Arsenic	affects methylation	1
Cisplatin	affects cotreatment, increases expression	1
Coal	increases abundance, increases expression	1
Diazinon	increases methylation	1
Folic Acid	decreases expression	1
Selenium	affects cotreatment, decreases expression	1
Silicon Dioxide	decreases expression	1
Testosterone	decreases expression	1
Urethane	decreases expression	1
Valproic Acid	increases methylation	1
Vitamin E	affects cotreatment, decreases expression	1
Aflatoxin B1	decreases expression	1

ChEMBL screening assays

16 unique, capped per target: 12 binding, 4 admet

Representative assays (with source publication via chembl_document):

Assay ID	Type	Description	Source paper
CHEMBL2185104	Binding	Activity of APAO in human DU145 cells assessed per ug DNA at 100 uM after 72 hrs in presence of serum amine oxidase inhibitor aminoguanidine (RVb = 662 +/- 48 pmol/h per ug DNA)	The use of novel C-methylated spermidine derivatives to investigate the regulation of polyamine metabolism. — *J Med Chem*
CHEMBL2185553	ADMET	Metabolic stability of the compound assessed as human recombinant APAO-mediated compound degradation at 0.5 to 1 mM after 5 to 60 mins	The use of novel C-methylated spermidine derivatives to investigate the regulation of polyamine metabolism. — *J Med Chem*

Clinical trials (associated diseases)

Via MONDO — disease-level, not drug-specific.

Predicted chemistry — Sugi Predict

The predicted patent-compound landscape for PAOX across ~30M SureChEMBL compounds — explore on Sugi Predict.