PAQR4

Summary

PAQR4 (progestin and adipoQ receptor family member 4, HGNC:26386) is a protein-coding gene on chromosome 16p13.3, encoding Progestin and adipoQ receptor family member 4 (Q8N4S7). Plays a role in maintaining adipose tissue function through the regulation of ceramide levels.

Enables molecular adaptor activity. Involved in protein stabilization and regulation of ceramide biosynthetic process. Located in Golgi membrane.

Source: NCBI Gene 124222 — RefSeq curated summary.

At a glance

• Clinical variants (ClinVar): 74 total
• MANE Select transcript: NM_152341

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:26386
Approved symbol	PAQR4
Name	progestin and adipoQ receptor family member 4
Location	16p13.3
Locus type	gene with protein product
Status	Approved
Aliases	FLJ30002
Ensembl gene	ENSG00000162073
Ensembl biotype	protein_coding
OMIM	614578
Entrez	124222

Gene structure

Transcript identifiers

Ensembl transcripts: 6 — 6 protein_coding

ENST00000293978, ENST00000318782, ENST00000572687, ENST00000574988, ENST00000576565, ENST00000896898

RefSeq mRNA: 5 — MANE Select: NM_152341 NM_001284511, NM_001284512, NM_001284513, NM_001324118, NM_152341

CCDS: CCDS10485, CCDS66911, CCDS66912, CCDS73814

Canonical transcript exons

ENST00000318782 — 3 exons

Exon	Start	End
ENSE00001838369	2971515	2973484
ENSE00001859101	2969348	2969840
ENSE00003632502	2971157	2971378

Expression profiles

Bgee: expression breadth ubiquitous, 243 present calls, max score 97.66.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 12.4876 / max 182.8701, expressed in 1621 samples.

FANTOM5 promoters (5 alternative TSS)

Promoter ID	TPM avg	Samples expressed
152344	10.9713	1596
152343	0.6434	424
152345	0.5687	292
152342	0.2009	77
152346	0.1032	36

Top tissues by expression

289 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
C1 segment of cervical spinal cord	UBERON:0006469	97.66	gold quality
inferior vagus X ganglion	UBERON:0005363	97.22	gold quality
spinal cord	UBERON:0002240	97.07	gold quality
subthalamic nucleus	UBERON:0001906	92.77	gold quality
ventral tegmental area	UBERON:0002691	92.19	gold quality
pigmented layer of retina	UBERON:0001782	92.18	gold quality
retina	UBERON:0000966	92.15	gold quality
right frontal lobe	UBERON:0002810	91.76	gold quality
midbrain	UBERON:0001891	91.49	gold quality
prefrontal cortex	UBERON:0000451	91.43	gold quality
substantia nigra	UBERON:0002038	91.36	gold quality
Brodmann (1909) area 9	UBERON:0013540	91.02	gold quality
medulla oblongata	UBERON:0001896	90.60	gold quality
dorsal plus ventral thalamus	UBERON:0001897	90.40	gold quality
putamen	UBERON:0001874	90.35	gold quality
amygdala	UBERON:0001876	90.10	gold quality
pons	UBERON:0000988	90.08	gold quality
superior vestibular nucleus	UBERON:0007227	89.68	gold quality
lateral globus pallidus	UBERON:0002476	89.33	gold quality
corpus callosum	UBERON:0002336	89.25	gold quality
endometrium epithelium	UBERON:0004811	89.22	gold quality
ganglionic eminence	UBERON:0004023	89.15	gold quality
Ammon’s horn	UBERON:0001954	89.05	gold quality
substantia nigra pars reticulata	UBERON:0001966	88.81	gold quality
ventricular zone	UBERON:0003053	88.74	gold quality
frontal cortex	UBERON:0001870	88.65	gold quality
neocortex	UBERON:0001950	88.36	gold quality
dorsolateral prefrontal cortex	UBERON:0009834	88.33	gold quality
cingulate cortex	UBERON:0003027	88.23	gold quality
anterior cingulate cortex	UBERON:0009835	88.12	gold quality

Single-cell (SCXA)

Detected in 1 experiment(s), a significant marker in 0.

Experiment	Marker?	Max mean expression
E-ANND-3	no	1.72

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

79 targeting PAQR4, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-4533	100.00	69.48	2758
HSA-MIR-4747-5P	100.00	67.90	2681
HSA-MIR-5196-5P	100.00	67.98	2761
HSA-MIR-4534	99.99	66.58	1907
HSA-MIR-12136	99.98	72.81	5713
HSA-MIR-4487	99.96	64.58	1252
HSA-MIR-6721-5P	99.93	68.92	2981
HSA-MIR-6780A-5P	99.88	66.69	2776
HSA-MIR-4492	99.87	68.25	3611
HSA-MIR-4728-5P	99.85	69.39	4718
HSA-MIR-6785-5P	99.82	68.68	4428
HSA-MIR-6756-5P	99.82	67.97	2466
HSA-MIR-1273H-5P	99.77	66.32	2471
HSA-MIR-4319	99.76	69.83	2586
HSA-MIR-6764-5P	99.75	67.89	2304
HSA-MIR-6745	99.74	65.33	1321
HSA-MIR-149-3P	99.72	68.22	3963
HSA-MIR-1200	99.71	70.42	1838
HSA-MIR-378G	99.71	64.90	1106
HSA-MIR-30B-3P	99.70	65.76	2325
HSA-MIR-3689A-3P	99.70	65.73	2306
HSA-MIR-3689B-3P	99.70	65.71	2311
HSA-MIR-3689C	99.70	65.71	2311
HSA-MIR-6779-5P	99.70	65.76	2363
HSA-MIR-6883-5P	99.69	68.05	3785
HSA-MIR-6766-5P	99.68	67.70	2325
HSA-MIR-6762-3P	99.66	66.94	1188
HSA-MIR-545-5P	99.66	70.18	2308
HSA-MIR-6887-3P	99.66	67.83	1778
HSA-MIR-561-3P	99.64	70.90	3647

Literature-anchored findings (GeneRIF, showing 8)

• Data indicate that PAQR4 has a tumorigenic effect on human breast cancers, and such effect is associated with a modulatory activity of PAQR4 on protein degradation of CDK4 (PMID:29228296)
• PAQR4 (Progestin and AdipoQ Receptor 4) expression is closely associated with progression of many cancers and microRNA (miRNA) processing. (PMID:30322804)
• PAQR4 promotes chemoresistance in non-small cell lung cancer through inhibiting Nrf2 protein degradation. (PMID:32206121)
• Golgi-Localized PAQR4 Mediates Antiapoptotic Ceramidase Activity in Breast Cancer. (PMID:32291319)
• PAQR4 promotes the development of hepatocellular carcinoma by activating PI3K/AKT pathway. (PMID:34718369)
• Overexpressed PAQR4 predicts poor overall survival and construction of a prognostic nomogram based on PAQR family for hepatocellular carcinoma. (PMID:35240821)
• VEZF1, destabilized by STUB1, affects cellular growth and metastasis of hepatocellular carcinoma by transcriptionally regulating PAQR4. (PMID:36241701)
• High PAQR4 mRNA Expression May Play a Key Role in Prognosis of Kidney Renal Papillary Cell Carcinoma. (PMID:37945022)

Cross-species orthologs

6 orthologs

Organism	Symbol	Gene ID
danio_rerio	paqr4b	ENSDARG00000074160
danio_rerio	paqr4a	ENSDARG00000076960
mus_musculus	Paqr4	ENSMUSG00000023909
rattus_norvegicus	Paqr4	ENSRNOG00000069091
drosophila_melanogaster	CG33203	FBGN0053203
caenorhabditis_elegans		WBGENE00019643

Paralogs (10): ADIPOR2 (ENSG00000006831), MMD (ENSG00000108960), MMD2 (ENSG00000136297), PAQR5 (ENSG00000137819), ADIPOR1 (ENSG00000159346), PAQR6 (ENSG00000160781), PAQR3 (ENSG00000163291), PAQR8 (ENSG00000170915), PAQR7 (ENSG00000182749), PAQR9 (ENSG00000188582)

Protein

Protein identifiers

Progestin and adipoQ receptor family member 4 — Q8N4S7 (reviewed: Q8N4S7)

Alternative names: Progestin and adipoQ receptor family member IV

All UniProt accessions (3): Q8N4S7, I3L1A2, I3L265

UniProt curated annotations — full annotation on UniProt →

Function. Plays a role in maintaining adipose tissue function through the regulation of ceramide levels. Mediates the stability of ceramide synthetases, CERS2 and CERS5, and their activities.

Subunit / interactions. Interacts with CERS2 and CERS5; the interaction regulates CERS2 and CERS5 stabilities and activities and is inhibited in presence of ceramides.

Subcellular location. Golgi apparatus membrane.

Tissue specificity. Relatively widely expressed in a range of tissues. Expressed in subcutaneous white adipose tissue.

Induction. Expression is up-regulated in subcutaneous white adipose tissue of obese individuals.

Similarity. Belongs to the ADIPOR family.

Isoforms (3)

UniProt ID	Names	Canonical?
Q8N4S7-1	1	yes
Q8N4S7-2	2
Q8N4S7-3	3

RefSeq proteins (5): NP_001271440, NP_001271441, NP_001271442, NP_001311047, NP_689554* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR004254	AdipoR/HlyIII-related	Family

Pfam: PF03006

UniProt features (12 total): transmembrane region 6, sequence conflict 3, splice variant 2, chain 1

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q8N4S7-F1	94.58	0.94

Function

Pathways and Gene Ontology

Reactome pathways

0 pathways

MSigDB gene sets: 185 (showing top): GSE45365_CTRL_VS_MCMV_INFECTION_NK_CELL_UP, GSE45365_NK_CELL_VS_CD8A_DC_UP, E2F_Q4, E2F_Q4_01, BUYTAERT_PHOTODYNAMIC_THERAPY_STRESS_DN, PAX4_01, TGCGCANK_UNKNOWN, E2F4DP1_01, FISCHER_G1_S_CELL_CYCLE, GRAESSMANN_APOPTOSIS_BY_DOXORUBICIN_UP, GRAESSMANN_RESPONSE_TO_MC_AND_DOXORUBICIN_UP, DACOSTA_UV_RESPONSE_VIA_ERCC3_UP, GOBP_REGULATION_OF_CELLULAR_COMPONENT_BIOGENESIS, GOBP_CERAMIDE_BIOSYNTHETIC_PROCESS, GOBP_REGULATION_OF_LIPID_BIOSYNTHETIC_PROCESS

GO Biological Process (2): protein stabilization (GO:0050821), regulation of ceramide biosynthetic process (GO:2000303)

GO Molecular Function (2): molecular adaptor activity (GO:0060090), metal ion binding (GO:0046872)

GO Cellular Component (3): Golgi membrane (GO:0000139), Golgi apparatus (GO:0005794), membrane (GO:0016020)

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
regulation of protein stability	1
ceramide biosynthetic process	1
regulation of sphingolipid biosynthetic process	1
molecular_function	1
binding	1
cation binding	1
Golgi apparatus	1
bounding membrane of organelle	1
cytoplasm	1
endomembrane system	1
intracellular membrane-bounded organelle	1
cellular anatomical structure	1

Protein interactions and networks

STRING

564 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
PAQR4	PAQR9	Q6ZVX9	574
PAQR4	TPD52	P55327	557
PAQR4	CREB3L4	Q8TEY5	530
PAQR4	MMD	Q15546	481
PAQR4	FLYWCH1	Q4VC44	478
PAQR4	PAQR6	Q6TCH4	419
PAQR4	MMD2	Q8IY49	385
PAQR4	PRSS21	Q9Y6M0	384
PAQR4	IFT140	Q96RY7	379
PAQR4	PTGR3	Q8N4Q0	375
PAQR4	SMIM43	Q4W5P6	374
PAQR4	MEIOB	Q8N635	372
PAQR4	TMEM235	A6NFC5	366
PAQR4	FLYWCH2	Q96CP2	364
PAQR4	FAM53C	Q9NYF3	360

IntAct

5 interactions, top by confidence:

A	B	Type	Score
FAM136A	RBFOX3	psi-mi:“MI:0914”(association)	0.640
FAM136A	PIK3C2A	psi-mi:“MI:0914”(association)	0.530
KCNA2	TMEM129	psi-mi:“MI:0914”(association)	0.350
TIMM8A	MT-ATP8	psi-mi:“MI:0914”(association)	0.350

BioGRID (13): PAQR4 (Affinity Capture-MS), PAQR4 (Affinity Capture-RNA), CDK4 (Affinity Capture-Western), PAQR4 (Affinity Capture-Western), SKP2 (Affinity Capture-Western), PAQR4 (Affinity Capture-Western), NFE2L2 (Affinity Capture-Western), KEAP1 (Affinity Capture-Western), NFE2L2 (Reconstituted Complex), KEAP1 (Reconstituted Complex), PAQR4 (Affinity Capture-MS), PAQR4 (Affinity Capture-MS), PAQR4 (Affinity Capture-MS)

ESM2 similar proteins: A2A559, A2V7M9, A6H7B8, A6X919, A7YWP2, A8KBG2, A8WFS8, B2GV22, D4AD75, E1BYA3, F1Q8R9, O08888, O45145, O49639, P25625, P38298, P70245, Q0VFE3, Q15125, Q290J8, Q2ABP2, Q2ABP3, Q3SZ36, Q3TQR0, Q568I2, Q5M9A7, Q60490, Q60WT2, Q68EV0, Q6P0S3, Q753H5, Q7K0P4, Q801D8, Q801G2, Q8C2R7, Q8N4S7, Q8R4X1, Q8T8L8, Q8TDN7, Q91VH1

Diamond homologs: A8WZU4, B7F9G7, Q03419, Q10PI5, Q12442, Q6ETK9, Q753H5, Q84N34, Q865K9, Q86V24, Q8BQS5, Q8N4S7, Q93ZH9, Q94177, Q9JJE4, Q9SVF3, Q9SZG0, Q9VCY8, Q9ZUH8, Q09749, Q09910, Q6TCG2, Q6TCG5, Q6TCG8, Q6TCH4, Q6TCH7, Q6ZVX9, Q91VH1, Q96A54, Q6DC77, Q7ZVH1, Q801D8, Q801G2, Q80ZE4, Q80ZE5, Q865K8, Q86WK9, Q8TEZ7, Q9DCU0, Q9NXK6

SIGNOR signaling

0 interactions.

Disease & clinical

Clinical variants and AI predictions

ClinVar

74 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	63
Likely benign	5
Benign	0

Top pathogenic / likely-pathogenic (0)

SpliceAI

685 predictions. Top by Δscore:

Variant	Effect	Δscore
16:2969836:GCACG:G	donor_gain	1.0000
16:2969837:CACGG:C	donor_loss	1.0000
16:2969839:CGG:C	donor_loss	1.0000
16:2969840:GGT:G	donor_loss	1.0000
16:2971513:AGG:A	acceptor_gain	1.0000
16:2971514:GGG:G	acceptor_gain	1.0000
16:2969841:G:GG	donor_gain	0.9900
16:2969842:T:A	donor_loss	0.9900
16:2971510:TGCA:T	acceptor_loss	0.9900
16:2971513:A:AG	acceptor_gain	0.9900
16:2971513:A:T	acceptor_loss	0.9900
16:2971513:AG:A	acceptor_gain	0.9900
16:2971513:AGGG:A	acceptor_gain	0.9900
16:2971514:G:GC	acceptor_loss	0.9900
16:2971514:G:GG	acceptor_gain	0.9900
16:2971514:GG:G	acceptor_gain	0.9900
16:2971514:GGGG:G	acceptor_gain	0.9900
16:2971514:GGGGC:G	acceptor_gain	0.9900
16:2973060:CATCC:C	acceptor_gain	0.9900
16:2973062:TCC:T	acceptor_gain	0.9900
16:2973063:CC:C	acceptor_gain	0.9900
16:2973063:CCC:C	acceptor_gain	0.9900
16:2973064:CC:C	acceptor_gain	0.9900
16:2973304:CCCGC:C	acceptor_gain	0.9900
16:2973305:CCGCC:C	acceptor_gain	0.9900
16:2969839:CG:C	donor_gain	0.9800
16:2969840:GG:G	donor_gain	0.9800
16:2971375:CTTGG:C	donor_loss	0.9800
16:2971378:GGTG:G	donor_loss	0.9800
16:2971379:GTGA:G	donor_loss	0.9800

AlphaMissense

1717 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
16:2971842:C:T	S239F	0.998
16:2969735:T:C	F21L	0.997
16:2969737:C:A	F21L	0.997
16:2969737:C:G	F21L	0.997
16:2969827:C:A	N51K	0.997
16:2969827:C:G	N51K	0.997
16:2971346:A:C	D119A	0.997
16:2971346:A:T	D119V	0.997
16:2971844:C:G	H240D	0.997
16:2969817:A:T	E48V	0.996
16:2971288:C:G	H100D	0.995
16:2971347:C:A	D119E	0.995
16:2971347:C:G	D119E	0.995
16:2971846:C:A	H240Q	0.995
16:2971846:C:G	H240Q	0.995
16:2969815:C:A	N47K	0.994
16:2969815:C:G	N47K	0.994
16:2971290:C:A	H100Q	0.994
16:2971290:C:G	H100Q	0.994
16:2971844:C:A	H240N	0.994
16:2969818:A:C	E48D	0.993
16:2969818:A:T	E48D	0.993
16:2971346:A:G	D119G	0.993
16:2971842:C:A	S239Y	0.993
16:2971855:G:A	M243I	0.993
16:2971855:G:C	M243I	0.993
16:2971855:G:T	M243I	0.993
16:2971804:G:C	E226D	0.992
16:2971804:G:T	E226D	0.992
16:2971857:A:G	H244R	0.992

dbSNP variants (sampled 300 via entrez): RS1000003667 (16:2969564 T>G), RS1000174286 (16:2973725 C>A,G), RS1000556724 (16:2968820 ACGCCTTCAGAGGCCTGGGTACCGTGGAG>A), RS1001288145 (16:2973325 G>A,C), RS1001398623 (16:2969901 G>A,C), RS1001471825 (16:2970123 C>T), RS1001602141 (16:2969240 A>G), RS1002174120 (16:2970176 G>A), RS1002869610 (16:2968425 C>T), RS1002906665 (16:2969892 G>A,T), RS1003559589 (16:2968119 G>A,C,T), RS1003687218 (16:2967592 C>T), RS1003856887 (16:2973628 C>T), RS1004236179 (16:2967612 G>A), RS1004419836 (16:2969242 G>A,C)

Disease associations

OMIM: gene MIM:614578 | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

0 associations (top):

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

47 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
sodium arsenite	increases abundance, increases expression, decreases expression	5
Valproic Acid	affects expression, decreases expression, increases methylation	3
Benzo(a)pyrene	affects methylation, increases expression	2
Tobacco Smoke Pollution	affects expression, decreases expression	2
Particulate Matter	increases abundance, affects cotreatment, decreases expression	2
aristolochic acid I	decreases expression	1
GSK-J4	decreases expression	1
triphenyl phosphate	affects expression	1
pirinixic acid	affects binding, decreases expression, increases activity	1
tris(1,3-dichloro-2-propyl)phosphate	decreases expression	1
cobaltous chloride	decreases expression	1
zinc chromate	decreases expression, increases abundance	1
cupric chloride	increases expression	1
S-(1,2-dichlorovinyl)cysteine	affects response to substance, increases expression, affects cotreatment, decreases expression	1
chromium hexavalent ion	decreases expression, increases abundance	1
erucylphospho-N,N,N-trimethylpropylammonium	decreases expression	1
abrine	decreases expression	1
(4-amino-1,4-dihydro-3-(2-pyridyl)-5-thioxo-1,2,4-triazole)copper(II)	increases expression	1
jinfukang	increases expression	1
MT19c compound	decreases expression	1
Sunitinib	decreases expression	1
Leflunomide	decreases expression	1
Acetaminophen	increases expression	1
Air Pollutants	decreases expression, increases abundance	1
Arsenic	increases abundance, decreases expression	1
Cadmium	increases expression	1
Cisplatin	increases expression	1
Demecolcine	decreases expression	1
Doxorubicin	decreases expression	1
Estradiol	increases expression	1

Cellosaurus cell lines

1 cell lines: 1 cancer cell line

First 10 cell lines (id-ordered, not curated):

Cellosaurus	Name	Category	Sex
CVCL_B1ZX	Abcam HeLa PAQR4 KO	Cancer cell line	Female

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.