PDXK

Summary

PDXK (pyridoxal kinase, HGNC:8819) is a protein-coding gene on chromosome 21q22.3, encoding Pyridoxal kinase (O00764). Catalyzes the phosphorylation of the dietary vitamin B6 vitamers pyridoxal (PL), pyridoxine (PN) and pyridoxamine (PM) to form pyridoxal 5’-phosphate (PLP), pyridoxine 5’-phosphate (PNP) and pyridoxamine 5’-phosphate (PMP), respectively.

The protein encoded by this gene phosphorylates vitamin B6, a step required for the conversion of vitamin B6 to pyridoxal-5-phosphate, an important cofactor in intermediary metabolism. The encoded protein is cytoplasmic and probably acts as a homodimer. Alternatively spliced transcript variants have been described, but their biological validity has not been determined.

Source: NCBI Gene 8566 — RefSeq curated summary.

At a glance

• Gene–disease (curated): neuropathy, hereditary motor and sensory, type VIc, with optic atrophy (Strong, GenCC)
• GWAS associations: 4
• Clinical variants (ClinVar): 114 total — 4 pathogenic, 1 likely-pathogenic
• GTEx eGene: eQTL in 32 tissues, sQTL in 34 (q < 0.05)
• Phenotypes (HPO): 18
• ChEMBL bioactivity: 6 clinical-phase molecules tested; no curated mechanism-of-action drug
• Constraint (gnomAD): pLI 0.77 (intermediate), LOEUF 0.60 (moderately constrained)
• MANE Select transcript: NM_003681

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:8819
Approved symbol	PDXK
Name	pyridoxal kinase
Location	21q22.3
Locus type	gene with protein product
Status	Approved
Aliases	PNK, PKH, FLJ21324, PRED79, FLJ31940, MGC15873
Ensembl gene	ENSG00000160209
Ensembl biotype	protein_coding
OMIM	179020
Entrez	8566

Gene structure

Transcript identifiers

Ensembl transcripts: 35 — 15 protein_coding, 13 protein_coding_CDS_not_defined, 7 nonsense_mediated_decay

MANE Select: ENST00000291565

Transcript support level (Ensembl TSL; 1 = fully mRNA-supported): TSL 1: 4, TSL 2: 4, TSL 3: 7, TSL 5: 4

ENST00000291565, ENST00000327574, ENST00000343528, ENST00000398078, ENST00000398081, ENST00000398085, ENST00000438837, ENST00000461123, ENST00000467908, ENST00000468090, ENST00000468392, ENST00000470029, ENST00000472777, ENST00000476084, ENST00000476313, ENST00000481512, ENST00000490666, ENST00000498040, ENST00000621478, ENST00000867731, ENST00000867732, ENST00000867733, ENST00000933237, ENST00000933238, ENST00000941196, ENST00000975542, ENST00000975543, ENST00000975545, ENST00000975547, ENST00000975548, ENST00001075229, ENST00001121642, ENST00001121643, ENST00001128015, ENST00001131603

RefSeq mRNA: 2 — MANE Select: NM_003681 NM_001331030, NM_003681

CCDS: CCDS13699, CCDS82679

Canonical transcript exons

ENST00000291565 — 11 exons

Exon	Start	End
ENSE00001861574	43719129	43719381
ENSE00003489627	43750500	43750545
ENSE00003511412	43743724	43743807
ENSE00003534315	43748995	43749080
ENSE00003552597	43753583	43753719
ENSE00003583352	43752518	43752629
ENSE00003585237	43734069	43734123
ENSE00003647981	43755698	43755764
ENSE00003670847	43741667	43741771
ENSE00003694032	43746079	43746125
ENSE00003849330	43755951	43762299

Expression profiles

Bgee: expression breadth ubiquitous, 295 present calls, max score 99.63.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 92.9692 / max 1145.3604, expressed in 1828 samples.

Highest expression (Bgee): testis, adult organism, sperm, renal medulla, male germ cell.

Genetic regulation across tissues (GTEx eQTL / sQTL)

PDXK is an eGene in GTEx v10 — its expression is genetically regulated (eQTL) in 32 tissues and its splicing (sQTL) in 34 (q < 0.05). Strongest associations first; slope = normalized effect of the lead variant’s alternative allele.

showing 20 of 66 significant tissue × QTL associations:

Tissue	QTL	q-value	Slope	Lead variant
Muscle Skeletal	sqtl	2.2e-110	-2.18	21:43741018:G:C
Thyroid	sqtl	5.7e-49	+1.82	21:43741018:G:C
Heart Atrial Appendage	sqtl	2.3e-44	+1.99	21:43741018:G:C
Esophagus Muscularis	sqtl	5.3e-42	-1.86	21:43741018:G:C
Heart Left Ventricle	sqtl	9.1e-39	-1.85	21:43741018:G:C
Nerve Tibial	sqtl	6.7e-34	+0.89	21:43737667:AGGGCCAGGAGCCTGCCGACGGACACCAGCGAGGGGCCAGGCC:A
Esophagus Mucosa	eqtl	6.8e-34	-0.34	21:43697239:G:A
Whole Blood	eqtl	2.9e-33	+0.32	21:43734293:CAG:C
Breast Mammary Tissue	sqtl	4.2e-32	-1.55	21:43741018:G:C
Stomach	sqtl	1.8e-27	-1.57	21:43741018:G:C
Prostate	sqtl	3.4e-27	+2.00	21:43741018:G:C
Esophagus Gastroesophageal Junction	sqtl	4.5e-27	-1.98	21:43741018:G:C
Spleen	sqtl	1.9e-26	-2.02	21:43741018:G:C
Pituitary	sqtl	2.9e-26	+1.99	21:43741018:G:C
Skin Sun Exposed Lower leg	sqtl	1.5e-22	-1.36	21:43741018:G:C
Artery Aorta	eqtl	1.3e-20	-0.35	21:43697558:A:G
Colon Sigmoid	sqtl	2.3e-20	-1.70	21:43741018:G:C
Heart Atrial Appendage	eqtl	1.0e-19	+0.76	21:43741018:G:C
Brain Frontal Cortex BA9	sqtl	2.1e-16	-1.66	21:43741018:G:C
Ovary	sqtl	1.5e-15	+1.95	21:43741018:G:C

FANTOM5 promoters

showing 10 of 13 alternative TSS:

Promoter ID	TPM avg	Samples expressed
189377	87.4126	1828
189389	1.5394	929
189381	1.1449	492
189380	1.0233	408
189388	0.5172	244
189384	0.4177	5
189379	0.2577	124
189382	0.2364	53
189383	0.2130	103
189376	0.0898	39

Top tissues by expression

showing 100 of 299 tissues by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
left testis	UBERON:0004533	99.63	gold quality
right testis	UBERON:0004534	99.57	gold quality
adult organism	UBERON:0007023	98.31	gold quality
sperm	CL:0000019	98.25	gold quality
renal medulla	UBERON:0000362	98.07	gold quality
male germ cell	CL:0000015	97.96	gold quality
dorsal motor nucleus of vagus nerve	UBERON:0002870	97.77	gold quality
adenohypophysis	UBERON:0002196	97.48	gold quality
testis	UBERON:0000473	97.32	gold quality
pituitary gland	UBERON:0000007	97.18	gold quality
metanephros cortex	UBERON:0010533	96.85	gold quality
Brodmann (1909) area 23	UBERON:0013554	96.84	gold quality
right frontal lobe	UBERON:0002810	96.75	gold quality
Brodmann (1909) area 46	UBERON:0006483	96.74	gold quality
nucleus accumbens	UBERON:0001882	96.73	gold quality
postcentral gyrus	UBERON:0002581	96.73	gold quality
parietal lobe	UBERON:0001872	96.67	gold quality
CA1 field of hippocampus	UBERON:0003881	96.63	gold quality
minor salivary gland	UBERON:0001830	96.60	gold quality
olfactory segment of nasal mucosa	UBERON:0005386	96.59	gold quality
inferior olivary complex	UBERON:0002127	96.57	gold quality
amygdala	UBERON:0001876	96.31	gold quality
apex of heart	UBERON:0002098	96.27	gold quality
putamen	UBERON:0001874	96.16	gold quality
superior frontal gyrus	UBERON:0002661	96.15	gold quality
body of pancreas	UBERON:0001150	96.14	gold quality
temporal lobe	UBERON:0001871	96.13	gold quality
mouth mucosa	UBERON:0003729	96.13	gold quality
upper lobe of left lung	UBERON:0008952	96.13	gold quality
entorhinal cortex	UBERON:0002728	96.12	gold quality
stromal cell of endometrium	CL:0002255	96.11	gold quality
hypothalamus	UBERON:0001898	96.10	gold quality
gingival epithelium	UBERON:0001949	96.00	gold quality
upper lobe of lung	UBERON:0008948	95.99	gold quality
Brodmann (1909) area 9	UBERON:0013540	95.96	gold quality
caudate nucleus	UBERON:0001873	95.93	gold quality
primary visual cortex	UBERON:0002436	95.90	gold quality
nerve	UBERON:0001021	95.86	gold quality
saliva-secreting gland	UBERON:0001044	95.86	gold quality
tibial nerve	UBERON:0001323	95.86	gold quality
monocyte	CL:0000576	95.80	gold quality
esophagus mucosa	UBERON:0002469	95.79	gold quality
dorsolateral prefrontal cortex	UBERON:0009834	95.78	gold quality
occipital lobe	UBERON:0002021	95.77	gold quality
middle temporal gyrus	UBERON:0002771	95.74	gold quality
lower esophagus mucosa	UBERON:0035834	95.59	gold quality
forebrain	UBERON:0001890	95.57	gold quality
cingulate cortex	UBERON:0003027	95.54	gold quality
telencephalon	UBERON:0001893	95.44	gold quality
orbitofrontal cortex	UBERON:0004167	95.44	gold quality
anterior cingulate cortex	UBERON:0009835	95.42	gold quality
pancreas	UBERON:0001264	95.35	gold quality
mononuclear cell	CL:0000842	95.34	gold quality
prefrontal cortex	UBERON:0000451	95.34	gold quality
adipose tissue	UBERON:0001013	95.30	gold quality
Ammon’s horn	UBERON:0001954	95.28	gold quality
ventral tegmental area	UBERON:0002691	95.28	gold quality
brain	UBERON:0000955	95.23	gold quality
lateral nuclear group of thalamus	UBERON:0002736	95.21	gold quality
leukocyte	CL:0000738	95.15	gold quality
cerebral cortex	UBERON:0000956	95.13	gold quality
central nervous system	UBERON:0001017	95.13	gold quality
adipose tissue of abdominal region	UBERON:0007808	95.11	gold quality
islet of Langerhans	UBERON:0000006	95.09	gold quality
superior vestibular nucleus	UBERON:0007227	95.04	gold quality
endometrium epithelium	UBERON:0004811	95.03	gold quality
omental fat pad	UBERON:0010414	94.99	gold quality
peritoneum	UBERON:0002358	94.98	gold quality
mucosa of transverse colon	UBERON:0004991	94.98	gold quality
connective tissue	UBERON:0002384	94.96	gold quality
gingiva	UBERON:0001828	94.95	gold quality
frontal cortex	UBERON:0001870	94.95	gold quality
right adrenal gland	UBERON:0001233	94.92	gold quality
neocortex	UBERON:0001950	94.92	gold quality
right hemisphere of cerebellum	UBERON:0014890	94.88	gold quality
left adrenal gland cortex	UBERON:0035825	94.81	gold quality
right adrenal gland cortex	UBERON:0035827	94.80	gold quality
gall bladder	UBERON:0002110	94.79	gold quality
left adrenal gland	UBERON:0001234	94.72	gold quality
subcutaneous adipose tissue	UBERON:0002190	94.72	gold quality
bone marrow cell	CL:0002092	94.70	gold quality
midbrain	UBERON:0001891	94.67	gold quality
substantia nigra	UBERON:0002038	94.66	gold quality
adult mammalian kidney	UBERON:0000082	94.61	gold quality
medial globus pallidus	UBERON:0002477	94.60	gold quality
right lung	UBERON:0002167	94.57	gold quality
endothelial cell	CL:0000115	94.50	gold quality
medulla oblongata	UBERON:0001896	94.46	gold quality
adrenal cortex	UBERON:0001235	94.45	gold quality
left lobe of thyroid gland	UBERON:0001120	94.39	gold quality
substantia nigra pars compacta	UBERON:0001965	94.36	gold quality
rectum	UBERON:0001052	94.35	gold quality
cerebellar hemisphere	UBERON:0002245	94.29	gold quality
substantia nigra pars reticulata	UBERON:0001966	94.26	gold quality
adrenal gland	UBERON:0002369	94.21	gold quality
cerebellar cortex	UBERON:0002129	94.10	gold quality
globus pallidus	UBERON:0001875	94.05	gold quality
pons	UBERON:0000988	94.01	gold quality
right lobe of thyroid gland	UBERON:0001119	93.92	gold quality
body of stomach	UBERON:0001161	93.88	gold quality

Single-cell (SCXA)

Detected in 2 experiment(s), a significant marker in 2.

Experiment	Marker?	Max mean expression
E-ANND-3	yes	14.25
E-HCAD-13	yes	7.25

HPA expression

RNA tissue specificity: Tissue enhanced

showing 60 of 80 HPA tissues / cells by nTPM:

Tissue / cell	Axis	nTPM	Protein (IHC)
Postcentral gyrus	tissue	174.8
Hippocampus	tissue	137.3	low
Locus coeruleus	tissue	136.8
Nucleus accumbens	tissue	132.4
Caudate putamen	tissue	103.1
Frontal cortex	tissue	65.6
Choroid plexus	tissue	65.4
Cerebral cortex	tissue	51.2	high
Insular cortex	tissue	51.2
Motor cortex	tissue	50.8
Prefrontal cortex	tissue	49.8
Somatosensory cortex	tissue	48.9
Hippocampal formation	tissue	48.7
Entorhinal cortex	tissue	48.7
Hypothalamus	tissue	47.4
Thalamus	tissue	46.7
Temporal cortex	tissue	45.9
Occipital cortex	tissue	45.2
Amygdala	tissue	43.6
Retrosplenial and cingulate cortex	tissue	43.6
Retrosplenial cortex	tissue	43.2
Pons	tissue	42.9
Ventral forebrain	tissue	40.3
Septum	tissue	40.3
Superior colliculi	tissue	38.5
Basal ganglia	tissue	38.2	medium
Pituitary gland	tissue	36.5
Midbrain	tissue	35.4
Cerebellum	tissue	35.1	low
Putamen	tissue	33.8
Substantia nigra	tissue	30.8
Periaqueductal gray	tissue	30.4
Olfactory bulb	tissue	25.0
Medulla oblongata	tissue	24.7
Adipose tissue	tissue	24.1	medium
Small intestine	tissue	18.2	medium
Kidney	tissue	17.0	medium
Parathyroid gland	tissue	16.7	not detected
Lung	tissue	16.1	medium
Salivary gland	tissue	15.6	low
Spinal cord	tissue	15.6
Testis	tissue	14.4	medium
Duodenum	tissue	13.3	medium
Vagina	tissue	12.6	not detected
Bone marrow	tissue	12.2	low
Stomach 1	tissue	12.1	medium
Skin 1	tissue	11.1	not detected
Colon	tissue	10.9	medium
Ovary	tissue	10.5	low
Pancreas	tissue	10.5	low
Breast	tissue	10.3	medium
Seminal vesicle	tissue	10.0	low
Adrenal gland	tissue	9.9	medium
Epididymis	tissue	9.6	medium
Thyroid gland	tissue	9.5	low
Thymus	tissue	9.5
Fallopian tube	tissue	9.5	low
Retina	tissue	9.3
Heart muscle	tissue	9.0	not detected
Rectum	tissue	8.8	medium

Brain sub-regions (HPA Brain Atlas): detected in 191; highest nTPM — Precentral gyrus (207.4), Lateral amygdala (195.2), Central amygdala (185.8), Basal amygdala (181.7), Posterior thalamic nucleus (181.3).

Regulation

Is transcription factor: no

Upstream regulators (CollecTRI, top): E2F1, E2F4

miRNA regulators (miRDB)

Targeting PDXK by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific).

showing 30 of 199 miRNAs:

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-4673	100.00	66.64	1490
HSA-MIR-513A-5P	100.00	69.77	2465
HSA-MIR-4481	100.00	66.42	1669
HSA-MIR-3613-3P	100.00	76.36	7965
HSA-MIR-4533	100.00	69.48	2758
HSA-MIR-188-3P	100.00	68.76	1240
HSA-MIR-4747-5P	100.00	67.90	2681
HSA-MIR-5196-5P	100.00	67.98	2761
HSA-MIR-4455	100.00	65.48	1587
HSA-MIR-4692	100.00	67.32	2066
HSA-MIR-34A-5P	99.99	71.21	1784
HSA-MIR-449A	99.99	71.05	1776
HSA-MIR-6870-5P	99.99	68.55	2115
HSA-MIR-4514	99.99	67.10	1870
HSA-MIR-4645-5P	99.98	65.81	1284
HSA-MIR-4745-5P	99.98	65.95	1028
HSA-MIR-34C-5P	99.97	70.45	1577
HSA-MIR-449B-5P	99.97	70.26	1580
HSA-MIR-548AN	99.97	70.91	2817
HSA-MIR-4723-5P	99.97	68.70	2034
HSA-MIR-5698	99.97	68.49	2029
HSA-MIR-7111-5P	99.97	68.48	2062
HSA-MIR-4725-3P	99.96	69.53	2520
HSA-MIR-6780B-5P	99.96	69.60	2562
HSA-MIR-6825-5P	99.96	69.81	3431
HSA-MIR-570-3P	99.96	72.41	4910
HSA-MIR-4267	99.96	66.53	2368
HSA-MIR-6778-3P	99.96	67.29	2693
HSA-MIR-128-3P	99.95	71.17	2484
HSA-MIR-216A-3P	99.95	71.19	2505

Functional genomics

gnomAD constraint: pLI 0.771, LOEUF 0.597, missense Z 0.816 — population loss-of-function intolerance (pLI ≥ 0.9 = LoF-intolerant; lower LOEUF = more constrained). gnomAD

Regional missense constraint (gnomAD RMC): no regional variation along ENST00000291565 — one region, missense o/e 0.82.

Literature-anchored findings (GeneRIF, showing 9)

• Pyridoxal kinase expression was compared in fetal Down syndrome (DS) brain and controls; PDXK levels were found to be similar. (PMID:15082224)
• A promoter mutation with potential erythroid-specific properties that could be the basis of a novel mechanism of controlling cell-specific decreased activity of an essential enzyme in erythrocytes. (PMID:16704963)
• The crystal structure of the MgATP complex also reveals Mg(2+) and Na(+) acting in tandem to anchor the ATP at the active site of pyridoxal kinase. (PMID:17766369)
• These results document the role of Asp235 in PL kinase activity. (PMID:19351586)
• This study identified a DNA variant (rs2010795) in PDXK associated with an increased risk of PD in the German cohort This association was confirmed in the British and Italian cohorts individually and reached a combined value. (PMID:20035503)
• The pyridoxal kinase showed decreased levels and was highly carbonylated in the gene-on mice (PMID:20639122)
• The affected pyridoxine metabolism is discussed as an inborn genetic trait in epilepsy in general, rather than a specific sign of pyridoxine-dependent epilepsy solely. (PMID:22647618)
• The expression of four pyridoxal kinase (PDXK) human variants in Drosophila impacts on genome integrity. (PMID:31578392)
• [Pyridoxal kinase (PDXK) promotes the proliferation of serous ovarian cancer cells and is associated with poor prognosis]. (PMID:32696745)

Cross-species orthologs

7 orthologs

Organism	Symbol	Gene ID
danio_rerio	pdxkb	ENSDARG00000036546
danio_rerio	pdxka	ENSDARG00000088959
mus_musculus	Pdxk	ENSMUSG00000032788
rattus_norvegicus	Pdxk	ENSRNOG00000049937
rattus_norvegicus	Pdxkl1	ENSRNOG00000068407
drosophila_melanogaster	Pdxk	FBGN0085484
caenorhabditis_elegans	pdxk-1	WBGENE00019008

Mouse-model phenotypes

Observed phenotypes of the mouse ortholog (MGI:1351869) from MGI (Alliance of Genome Resources) — knockout/mutant phenotypes, ranked by annotation count. 1 distinct phenotype terms.

Mouse phenotype (MP)	Records
preweaning lethality, complete penetrance	1

Additional cross-species homologs

Sequence homologs in species beyond Ensembl Compara’s model organisms, by Diamond local protein alignment (% sequence identity; best hit per species). Lower-identity rows are more distant homologs. The matched accessions’ gene symbols aren’t in biobtree yet, so each row shows the UniProt accession.

Organism	UniProt	Identity	Method
Histophilus somni 2336	B0UUD2	100.0%	Diamond
Escherichia coli K-12	P0A9J6	100.0%	Diamond
Escherichia coli O157:H7	P0A9J7	100.0%	Diamond
Histophilus somni 129PT	Q0I3D2	100.0%	Diamond
Escherichia coli 536	Q0THJ1	100.0%	Diamond
Yersinia pestis Antiqua	Q1C792	100.0%	Diamond
Yersinia pestis Nepal516	Q1CIM6	100.0%	Diamond
Escherichia coli UTI89	Q1RBF9	100.0%	Diamond
Shigella boydii Sb227	Q320Z3	100.0%	Diamond
Salmonella enterica subsp. enterica serovar Choleraesuis str. SC-B67	Q57PI7	100.0%	Diamond
Salmonella enterica subsp. enterica serovar Paratyphi A str. ATCC 9150	Q5PIK8	100.0%	Diamond
Yersinia pestis	Q7CIR8	100.0%	Diamond
Salmonella enterica subsp. enterica serovar Typhi	Q8Z6Q3	100.0%	Diamond
Salmonella enterica subsp. enterica serovar Typhimurium str. LT2	Q8ZPM8	100.0%	Diamond
Burkholderia pseudomallei 1710b	Q3JQA6	99.7%	Diamond
Shigella sonnei Ss046	Q3Z1Z2	99.7%	Diamond
Burkholderia mallei ATCC 23344	Q62LP6	99.7%	Diamond
Burkholderia pseudomallei K96243	Q63SC2	99.7%	Diamond
Yersinia pseudotuberculosis IP 32953	Q66A50	99.7%	Diamond
Vibrio vulnificus YJ016	Q7MGA4	99.7%	Diamond
Vibrio vulnificus CMCP6	Q8D4Q2	99.7%	Diamond
Escherichia coli CFT073	Q8FH89	99.7%	Diamond
Actinobacillus pleuropneumoniae serovar 5b str. L20	A3N2D3	99.3%	Diamond
Haemophilus influenzae PittEE	A5UA83	99.3%	Diamond
Actinobacillus pleuropneumoniae serovar 7 str. AP76	B3H2H2	99.3%	Diamond
Haemophilus influenzae Rd KW20	P44690	99.3%	Diamond
Shigella dysenteriae Sd197	Q32FD7	99.3%	Diamond
Shigella flexneri	Q83KY1	99.3%	Diamond
Ovis aries	P82197	98.4%	Diamond
Bos taurus	Q0II59	98.4%	Diamond
Burkholderia thailandensis E264	Q2SXQ4	98.3%	Diamond
Burkholderia orbicola AU 1054	Q1BXQ7	97.9%	Diamond
Burkholderia lata	Q39I40	97.9%	Diamond
Pseudomonas paraeruginosa PA7	A6VEZ4	97.6%	Diamond
Vibrio campbellii ATCC BAA-1116	A7N5Q6	96.5%	Diamond
Pseudomonas putida W619	B1JFM7	94.1%	Diamond
Pseudomonas [fluorescens] SBW25	C3K4G7	93.1%	Diamond
Pseudomonas fluorescens Pf0-1	Q3K4B8	93.1%	Diamond
Pseudomonas protegens Pf-5	Q4K3F6	93.1%	Diamond
Vibrio parahaemolyticus RIMD 2210633	Q87FP6	91.6%	Diamond

Genomic neighbors (locus context)

Genes flanking this one on the chromosome (NCBI/Entrez gene neighborhood). Positional context only — some neighbors share regulatory elements (bidirectional promoters, antisense/overlapping transcripts), but chromosomal adjacency is not itself a functional relationship (see Interactions for that).

Symbol	Type	Entrez
CSTB	protein-coding	1476
RRP1	protein-coding	8568
RRP1B	protein-coding	23076

Protein

Protein identifiers

Pyridoxal kinase — O00764 (reviewed: O00764)

Alternative names: Pyridoxine kinase

All UniProt accessions (6): O00764, A0A0B4J2C9, A8MT14, A8MV33, F2Z2Y4, V9HWC3

UniProt curated annotations — full annotation on UniProt →

Function. Catalyzes the phosphorylation of the dietary vitamin B6 vitamers pyridoxal (PL), pyridoxine (PN) and pyridoxamine (PM) to form pyridoxal 5’-phosphate (PLP), pyridoxine 5’-phosphate (PNP) and pyridoxamine 5’-phosphate (PMP), respectively. PLP is the active form of vitamin B6, and acts as a cofactor for over 140 different enzymatic reactions.

Subunit / interactions. Homodimer.

Subcellular location. Cytoplasm. Cytosol.

Tissue specificity. Ubiquitous. Highly expressed in testis. In adult testis and spermatozoa.

Disease relevance. Neuropathy, hereditary motor and sensory, 6C, with optic atrophy (HMSN6C) [MIM:618511] An autosomal recessive neurologic disorder characterized by childhood onset of axonal, sensorimotor polyneuropathy affecting mainly the lower limbs, and adult-onset optic atrophy. Clinical features include progressive distal muscle weakness and atrophy, significant standing and walking difficulties, areflexia, neurogenic pain and progressive visual impairment. The disease is caused by variants affecting the gene represented in this entry.

Activity regulation. Catalytic activity is inhibited competitively by 4-deoxypyridoxine, and is also inhibited by the benzodiazepine receptor ligands 1012S and ethyl-beta-carboline-3-carboxylate. Inhibited by ginkgotoxin, theophylline, lamotrigine, enprofylline, theobromine, and caffeine. Activity is increased in the presence of K(+)or Na(+).

Cofactor. Zn(2+) is the most effective divalent metal cation in vitro, followed by Co(2+), Mn(2+) and Mg(2+).

Induction. Transcriptionally regulated by Sp1 transcription factor.

Pathway. Cofactor metabolism; pyridoxal 5’-phosphate salvage; pyridoxal 5’-phosphate from pyridoxal: step 1/1. Cofactor metabolism; pyridoxal 5’-phosphate salvage; pyridoxine 5’-phosphate from pyridoxine: step 1/1. Cofactor metabolism; pyridoxal 5’-phosphate salvage; pyridoxamine 5’-phosphate from pyridoxamine: step 1/1.

Similarity. Belongs to the pyridoxine kinase family.

Isoforms (3)

UniProt ID	Names	Canonical?
O00764-1	1	yes
O00764-2	2
O00764-3	3, PKH-T

RefSeq proteins (2): NP_001317959, NP_003672* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR004625	PyrdxlKinase	Family
IPR013749	PM/HMP-P_kinase-1	Domain
IPR029056	Ribokinase-like	Homologous_superfamily

Pfam: PF08543

Enzyme classification (BRENDA)

• EC 2.7.1.35 — pyridoxal kinase (BRENDA: 31 organisms, 59 substrates, 123 inhibitors, 121 Km, 69 kcat entries)

Substrate kinetics (BRENDA)

8 substrates with measured Km, best-characterized 8. Km ranges are aggregated across organisms/conditions.

Substrate	Km (mM)	Measurements
PYRIDOXAL	0.0012–3.839	42
ATP	0.0091–3.096	40
PYRIDOXINE	0.0017–2.07	17
PYRIDOXAMINE	0.006–0.1818	10
4-AMINO-5-HYDROXYMETHYL-2-METHYLPYRIMIDINE	1.85–2.03	3
GINKGOTOXIN	0.005–0.0466	3
4’-DEOXYPYRIDOXINE	0.0216	2
4’-O-METHYLPYRIDOXINE	0.005	1

Catalyzed reactions (Rhea)

• pyridoxal + ATP = pyridoxal 5’-phosphate + ADP + H(+) (RHEA:10224)
• pyridoxamine + ATP = pyridoxamine 5’-phosphate + ADP + H(+) (RHEA:25104)
• pyridoxine + ATP = pyridoxine 5’-phosphate + ADP + H(+) (RHEA:25108)

UniProt features (53 total): helix 14, binding site 13, strand 11, modified residue 5, splice variant 2, sequence variant 2, mutagenesis site 2, turn 2, chain 1, active site 1

Structure

Experimental structures (PDB)

10 structures by resolution:

PDB	Title	Method	Resolution (Å)
8WR2	Crystal Structure of Human Pyridoxal Kinase with bound Luteolin	X-RAY DIFFRACTION	1.94
2YXT	Human Pyridoxal Kinase	X-RAY DIFFRACTION	2
3KEU	Crystal Structure of Human PL Kinase with bound PLP and ATP	X-RAY DIFFRACTION	2.1
4EOH	Crystal Structure of Human PL Kinase with bound Theophylline	X-RAY DIFFRACTION	2.1
4EN4	Crystal Structure of the Ternary Human PL Kinase-Ginkgotoxin-MgATP Complex	X-RAY DIFFRACTION	2.15
2YXU	Human Pyridoxal Kinase	X-RAY DIFFRACTION	2.2
3FHY	Crystal structure of D235N mutant of human pyridoxal kinase	X-RAY DIFFRACTION	2.3
2AJP	Crystal structure of a human pyridoxal kinase	X-RAY DIFFRACTION	2.5
3FHX	Crystal structure of D235A mutant of human pyridoxal kinase	X-RAY DIFFRACTION	2.5
2F7K	Crystal Structure of Human Pyridoxal Kinase	X-RAY DIFFRACTION	2.8

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-O00764-F1	95.83	0.92

Human Protein Atlas

Protein class: Enzymes, ENZYME proteins, Transferases, Metabolic proteins, Predicted intracellular proteins, Plasma proteins, Disease related genes, FDA approved drug targets, Small molecule drugs, Human disease related genes

Protein evidence: Evidence at protein level

Subcellular location (HPA, imaging): nucleoplasm

Antibody reliability (HPA): IH enhanced · IF enhanced

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Catalytic / active sites (1)

Position	Role
235	proton acceptor

Ligand- & substrate-binding residues (13)

Position	Role
186–187	ATP
186	Na(+)
226–228	ATP
233	ATP
234–235	pyridoxal 5’-phosphate
12	pyridoxal
47	pyridoxal
47	pyridoxal 5’-phosphate
113	ATP
113	Na(+)
118	Mg(2+)
148	Na(+)
150–153	ATP

Post-translational modifications (5)

Type	Positions
N-acetylmethionine	1
Phosphoserine	59, 164, 213, 285

Mutagenesis-validated functional residues (2)

Position	Phenotype
235	15-fold decrease in pyridoxal kinase activity, and a 7-fold decrease in affinity for pyridoxal.
235	2-fold decrease in pyridoxal kinase activity and pyridoxal affinity.

Function

Pathways and Gene Ontology

Reactome pathways

2 curated (TAS) of 7; 0 disease pathways. Curated-first; evidence = TAS (manually curated) vs IEA (electronic inference).

7 pathways:

ID	Pathway	Evidence
R-HSA-6798695	Neutrophil degranulation	curated
R-HSA-964975	Vitamin B6 activation to pyridoxal phosphate	curated
R-HSA-168256	Immune System	—
R-HSA-168249	Innate Immune System	—
R-HSA-1430728	Metabolism	—
R-HSA-196854	Metabolism of vitamins and cofactors	—
R-HSA-196849	Metabolism of water-soluble vitamins and cofactors	—

MSigDB gene sets: 398 (showing top): REACTOME_INNATE_IMMUNE_SYSTEM, GOCC_SECRETORY_GRANULE, GRAESSMANN_APOPTOSIS_BY_SERUM_DEPRIVATION_DN, ACEVEDO_NORMAL_TISSUE_ADJACENT_TO_LIVER_TUMOR_DN, MITSIADES_RESPONSE_TO_APLIDIN_DN, GOBP_ORGANOPHOSPHATE_METABOLIC_PROCESS, GOBP_ORGANOPHOSPHATE_BIOSYNTHETIC_PROCESS, GOBP_SMALL_MOLECULE_BIOSYNTHETIC_PROCESS, ONKEN_UVEAL_MELANOMA_UP, LI_WILMS_TUMOR_VS_FETAL_KIDNEY_1_UP, CCTGTGA_MIR513, GOBP_VITAMIN_BIOSYNTHETIC_PROCESS, DER_IFN_BETA_RESPONSE_UP, CREIGHTON_ENDOCRINE_THERAPY_RESISTANCE_5, GOBP_ALDEHYDE_METABOLIC_PROCESS

GO Biological Process (3): pyridoxal 5’-phosphate salvage (GO:0009443), vitamin B6 metabolic process (GO:0042816), pyridoxal 5’-phosphate metabolic process (GO:0042822)

GO Molecular Function (14): magnesium ion binding (GO:0000287), ATP binding (GO:0005524), zinc ion binding (GO:0008270), pyridoxal kinase activity (GO:0008478), pyridoxal phosphate binding (GO:0030170), potassium ion binding (GO:0030955), sodium ion binding (GO:0031402), lithium ion binding (GO:0031403), protein homodimerization activity (GO:0042803), nucleotide binding (GO:0000166), kinase activity (GO:0016301), transferase activity (GO:0016740), phosphotransferase activity, alcohol group as acceptor (GO:0016773), metal ion binding (GO:0046872)

GO Cellular Component (7): extracellular region (GO:0005576), nucleus (GO:0005634), nucleoplasm (GO:0005654), cytosol (GO:0005829), secretory granule lumen (GO:0034774), specific granule lumen (GO:0035580), extracellular exosome (GO:0070062)

Reactome top-level categories

5 top-level categories:

Category	Pathways
Innate Immune System	1
Metabolism of water-soluble vitamins and cofactors	1
Immune System	1
Metabolism of vitamins and cofactors	1
Metabolism	1

GO top-level categories

32 GO namespaces:

Category	Terms
alkali metal ion binding	3
cellular anatomical structure	3
anion binding	2
transferase activity, transferring phosphorus-containing groups	2
pyridoxal 5’-phosphate biosynthetic process	1
metabolic compound salvage	1
vitamin metabolic process	1
pyridine-containing compound metabolic process	1
aldehyde metabolic process	1
organophosphate metabolic process	1
vitamin B6 metabolic process	1
metal ion binding	1
adenyl ribonucleotide binding	1
purine ribonucleoside triphosphate binding	1
transition metal ion binding	1
kinase activity	1
phosphotransferase activity, alcohol group as acceptor	1
vitamin B6 binding	1
identical protein binding	1
protein dimerization activity	1
nucleoside phosphate binding	1
heterocyclic compound binding	1
catalytic activity	1
cation binding	1
intracellular membrane-bounded organelle	1
nuclear lumen	1
cytoplasm	1
secretory granule	1
cytoplasmic vesicle lumen	1
secretory granule lumen	1
specific granule	1
extracellular vesicle	1

Experimentally-supported GO annotations

GO terms backed by direct experimental evidence (ECO experimental codes) — 14 of 24 annotations. The rest are phylogenetic / computational / electronic (IEA).

14 experimentally-supported GO terms:

GO term	NS	Evidence
pyridoxal 5’-phosphate salvage	BP	direct assay
cytosol	CC	high-throughput assay
extracellular exosome	CC	high-throughput assay
nucleoplasm	CC	direct assay
nucleus	CC	high-throughput assay
ATP binding	MF	direct assay
lithium ion binding	MF	direct assay
magnesium ion binding	MF	direct assay
potassium ion binding	MF	direct assay
protein homodimerization activity	MF	direct assay
pyridoxal kinase activity	MF	direct assay
pyridoxal phosphate binding	MF	direct assay
sodium ion binding	MF	direct assay
zinc ion binding	MF	direct assay

Protein interactions and networks

STRING

showing 15 of 1,359 interactions by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
PDXK	PNPO	Q9NVS9	834
PDXK	TEF	Q10587	828
PDXK	RRP1B	Q14684	717
PDXK	DBP	Q10586	700
PDXK	PDXP	Q96GD0	673
PDXK	ZBTB21	Q9ULJ3	670
PDXK	PLPBP	O94903	620
PDXK	TRAPPC4	Q9Y296	572
PDXK	PPOX	P50336	465
PDXK	CPOX	P36551	453
PDXK	PRMT2	P55345	436
PDXK	EVA1C	P58658	434
PDXK	SRGAP3	O43295	429
PDXK	SRGAP2	O75044	429
PDXK	SLC35F6	Q8N357	425

IntAct

Human interaction partners of PDXK in IntAct, one row per partner (best MIscore; records = supporting IntAct interaction records).

4 partners by confidence:

Partner	Interaction type	MIscore	Records
YWHAZ	physical association	0.400	1
PARP12	association	0.350	1
IKBKE	physical association	0.000	1
PRKAB1	physical association	0.000	1

BioGRID (80 interactions; top human partners by supporting records): PARK2 (Proximity Label-MS; 2 records), ABAT (Co-fractionation), ACTR2 (Co-fractionation), ACTR3 (Co-fractionation), ACTR3B (Co-fractionation), AKT1 (Co-fractionation), AMBRA1 (Proximity Label-MS), ARPC1A (Co-fractionation), ARPC1B (Co-fractionation), ARPC2 (Co-fractionation), ARPC3 (Co-fractionation), ARPC4 (Co-fractionation), ARPC5 (Co-fractionation), ARPC5L (Co-fractionation), ATOH1 (Affinity Capture-MS)

Protein complexes (CORUM) (1)

Experimentally-characterized complexes this protein is a subunit of (★ = the complex contains a known drug target).

1 complexes by size:

Complex	Subunits	Members
DNA repair complex NEIL1-PNK-Pol(beta)-LigIII(alpha)-XRCC1	5	PDXK, POLB, XRCC1, LIG3, NEIL1

Disease & clinical

Genetic variants

Variant evidence for PDXK: 114 ClinVar records (5 pathogenic / likely pathogenic); 4 GWAS associations. Per-variant detail is on Sugi Variant.

ClinVar

114 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	4
Likely pathogenic	1
Uncertain significance	32
Likely benign	26
Benign	25

Top pathogenic / likely-pathogenic (5)

Showing all 5 pathogenic / likely-pathogenic ClinVar records, ranked by ClinVar review status (expert panel → multiple submitters → single submitter), then by number of submitting labs.

Variant ID	HGVS	Classification	Review	Submitters
636264	NM_003681.5(PDXK):c.682G>A (p.Ala228Thr)	Pathogenic	criteria provided, multiple submitters, no conflicts	3
2652725	NM_003681.5(PDXK):c.465-15_489delinsGCA	Pathogenic	criteria provided, single submitter	1
812519	NM_003681.5(PDXK):c.225T>A (p.Asn75Lys)	Likely pathogenic	criteria provided, single submitter	3
830405	NC_000021.8:g.(?44836602)(45629566_?)del	Pathogenic	criteria provided, single submitter	1
636265	NM_003681.5(PDXK):c.659G>A (p.Arg220Gln)	Pathogenic	no assertion criteria provided	1

Per-variant reference — Sugi Variant

Explore PDXK’s pathogenic and likely-pathogenic variants individually — each with its ClinVar classification and conditions, applied ACMG criteria (ClinGen expert panel, where curated), the calibrated in-silico predictors (AlphaMissense, REVEL, SaProt, conservation), gnomAD frequency, and the predictor-disagreement QC signal — on Sugi Variant.

SpliceAI

Top 10 splice-impact sites by Δscore (adjacent positions with the same effect merged into one range; 33 predictions of 1,344):

Position(s)	Effect	Δscore	Sites
21:43719382–43719383	donor_loss	1.0000	4
21:43734067–43734068	acceptor_loss	1.0000	5
21:43734124–43734125	donor_loss	1.0000	5
21:43741772–43741773	donor_loss	1.0000	3
21:43748985	acceptor_gain	1.0000
21:43748988–43748989	acceptor_gain	1.0000	2
21:43749081–43749082	donor_loss	1.0000	5
21:43750546–43750547	donor_loss	1.0000	4
21:43753581–43753582	acceptor_loss	1.0000	3
21:43753582	acceptor_gain	1.0000

AlphaMissense

788 missense substitutions predicted likely pathogenic (of 2,059 scored), across 199 residues. Top 20 hotspot residues, ranked by the number of likely-pathogenic substitutions (of those reachable by a single-nucleotide change), then by mean score:

Residue	Likely-pathogenic substitutions	Mean am_pathogenicity	Max am_pathogenicity
D235	8	0.989	0.996
D113	8	0.976	0.991
S12	8	0.956	0.994
H46	8	0.935	0.981
D36	8	0.934	0.958
F230	8	0.907	0.991
D118	8	0.879	0.935
H13	8	0.875	0.963
H176	8	0.858	0.979
F237	8	0.850	0.965
F90	8	0.835	0.969
E153	7	0.977	0.995
F43	7	0.958	0.992
C112	7	0.953	0.991
F152	7	0.947	0.989
F26	7	0.936	0.971
N150	7	0.936	0.984
E290	7	0.933	0.977
N21	7	0.920	0.982
Q11	7	0.905	0.977

HPA cancer prognostics

RNA cancer specificity: Low cancer specificity

Human Protein Atlas survival analysis — favorable = higher expression predicts better survival.

1 prognostic cancer types:

Cancer	Prognostic	p-value
Thyroid Carcinoma (TCGA)	unfavorable	0.000937

Disease associations

OMIM: gene MIM:179020 | disease phenotypes: MIM:618511, MIM:616341

GenCC curated gene-disease

1 curated gene-disease records:

Disease	Classification	Inheritance	Records
neuropathy, hereditary motor and sensory, type VIc, with optic atrophy	Strong	Autosomal recessive	2

Genomics England panels (PanelApp)

Clinical diagnostic gene panels including this gene (2 panels, 2 green/diagnostic-grade). Confidence: green = diagnostic, amber = moderate.

2 panels:

Panel	Rating
Hereditary neuropathy or pain disorder	green
Optic neuropathy	green

Mondo (2): neuropathy, hereditary motor and sensory, type VIc, with optic atrophy (MONDO:0032792), developmental and epileptic encephalopathy, 30 (MONDO:0014595)

HPO phenotypes

18 phenotypes (HPO-id order):

HPO	Term
HP:0000007	Autosomal recessive inheritance
HP:0000543	Optic disc pallor
HP:0000551	Color vision defect
HP:0000648	Optic atrophy
HP:0001284	Areflexia
HP:0001761	Pes cavus
HP:0001765	Hammertoe
HP:0002403	Positive Romberg sign
HP:0003484	Upper limb muscle weakness
HP:0003621	Juvenile onset
HP:0003676	Progressive
HP:0006886	Impaired distal vibration sensation
HP:0007210	Lower limb amyotrophy
HP:0007328	Impaired pain sensation
HP:0007340	Lower limb muscle weakness
HP:0007663	Reduced visual acuity
HP:0011463	Childhood onset
HP:0034337	Claw hand deformity

GWAS associations

4 associations:

Study	Trait	p-value
GCST010002_377	Refractive error	3e-10
GCST006585_1102	Blood protein levels	5e-9
GCST003825_4	Systolic blood pressure change trajectory	7e-7
GCST003825_7	Systolic blood pressure change trajectory	1e-6

EFO canonical traits (from GWAS)

1 canonical traits:

EFO ID	Trait name
EFO:0006944	systolic blood pressure change measurement

Drugs & pharmacology

Drug and pharmacology data

Is drug target: yes

ChEMBL targets (1): CHEMBL1075181 (SINGLE PROTEIN)

Molecules with ChEMBL bioactivity

Phase ≥1, by development phase (incl. off-target/promiscuous compounds). Patent mentions across the top 20 by phase: 86,335 (via chembl_molecule»patent_compound — counts attach to the compound, not the gene–compound relationship, so off-target/promiscuous molecules can dominate).

6 molecules by phase:

Molecule	Name	Phase	Patents
CHEMBL535	SUNITINIB	4	80,232
CHEMBL1233528	VOLASERTIB	3	1,597
CHEMBL513909	BI-2536	2	932
CHEMBL3907479	FGFR INHIBITOR DEBIO 1347	2	790
CHEMBL2220486	LUCITANIB	2	1,198
CHEMBL230011	TG100-115	2	1,586

PharmGKB: 1 entry (CPIC guideline: no)

Binding affinities (BindingDB)

7 measured of 8 human assays (9 total across all organisms); most potent 7 below. Values come from heterogeneous assays and are not directly comparable.

Ligand	Measure	Value
ML349	KI	180 nM
CHEMBL5653589	KD	1440 nM
CHEMBL3244684	KI	22500 nM
CHEMBL3245250	KI	24000 nM
CHEMBL3244690	KI	68100 nM
CHEMBL3245268	KI	105000 nM
CHEMBL3275146	KI	125000 nM

ChEMBL bioactivities

9 potent at pChembl≥5 of 13 total, top 9 by pChembl (potency: 10 = 0.1 nM, 6 = 1 µM).

pChembl	Type	Value	Unit	Molecule
8.29	Kd	5.092	nM	CHEMBL3752910
8.29	ED50	5.092	nM	CHEMBL3752910
6.54	Kd	286	nM	VOLASERTIB
6.41	Kd	387	nM	BI-2536
5.92	Kd	1195	nM	CHEMBL5653589
5.92	ED50	1195	nM	CHEMBL5653589
5.68	Kd	2110	nM	FGFR INHIBITOR DEBIO 1347
5.28	Kd	5251	nM	TG100-115
5.22	Kd	6021	nM	SUNITINIB

PubChem BioAssay actives

8 with measured affinity, of 274 total; 8 most potent distinct compounds. Largely complementary to BindingDB; screening values are coarse (µM, 4 dp), so sub-nM hits tie at the floor.

Compound	Assay	Type	Value	Unit
4-methyl-3-[(1-methyl-6-pyridin-3-ylpyrazolo[3,4-d]pyrimidin-4-yl)amino]-N-[3-(trifluoromethyl)phenyl]benzamide	2148973: Binding affinity to human PDXK incubated for 45 mins by Kinobead based pull down assay	kd	0.0051	uM
N-[4-[4-(cyclopropylmethyl)piperazin-1-yl]cyclohexyl]-4-[[(7R)-7-ethyl-5-methyl-6-oxo-8-propan-2-yl-7H-pteridin-2-yl]amino]-3-methoxybenzamide	1425106: Kinobeads (epsilon), multiple immobilized ATP-competitive broad spectrum kinase inhibitors, used to assess residual binding of ~300 proteins simultaneously from cell lysate in the presence of a compound. Quantitative readout performed by mass spectrometry.	kd	0.2860	uM
4-[[(7R)-8-cyclopentyl-7-ethyl-5-methyl-6-oxo-7H-pteridin-2-yl]amino]-3-methoxy-N-(1-methylpiperidin-4-yl)benzamide	1425106: Kinobeads (epsilon), multiple immobilized ATP-competitive broad spectrum kinase inhibitors, used to assess residual binding of ~300 proteins simultaneously from cell lysate in the presence of a compound. Quantitative readout performed by mass spectrometry.	kd	0.3870	uM
4-methyl-3-[(2-methyl-6-pyridin-3-ylpyrazolo[3,4-d]pyrimidin-4-yl)amino]-N-[3-(trifluoromethyl)phenyl]benzamide	2148973: Binding affinity to human PDXK incubated for 45 mins by Kinobead based pull down assay	kd	1.1949	uM
[5-amino-1-(2-methyl-3H-benzimidazol-5-yl)pyrazol-4-yl]-(1H-indol-2-yl)methanone	1425106: Kinobeads (epsilon), multiple immobilized ATP-competitive broad spectrum kinase inhibitors, used to assess residual binding of ~300 proteins simultaneously from cell lysate in the presence of a compound. Quantitative readout performed by mass spectrometry.	kd	2.1100	uM
3-[2,4-diamino-7-(3-hydroxyphenyl)pteridin-6-yl]phenol	1425106: Kinobeads (epsilon), multiple immobilized ATP-competitive broad spectrum kinase inhibitors, used to assess residual binding of ~300 proteins simultaneously from cell lysate in the presence of a compound. Quantitative readout performed by mass spectrometry.	kd	5.2510	uM
Sunitinib	1425106: Kinobeads (epsilon), multiple immobilized ATP-competitive broad spectrum kinase inhibitors, used to assess residual binding of ~300 proteins simultaneously from cell lysate in the presence of a compound. Quantitative readout performed by mass spectrometry.	kd	6.0210	uM
6-[7-[(1-aminocyclopropyl)methoxy]-6-methoxyquinolin-4-yl]oxy-N-methylnaphthalene-1-carboxamide	1425106: Kinobeads (epsilon), multiple immobilized ATP-competitive broad spectrum kinase inhibitors, used to assess residual binding of ~300 proteins simultaneously from cell lysate in the presence of a compound. Quantitative readout performed by mass spectrometry.	kd	16.4040	uM

CTD chemical–gene interactions

67 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
bisphenol F	increases expression, affects cotreatment, decreases expression, decreases methylation	3
bisphenol A	decreases expression, decreases methylation, affects cotreatment	3
Cadmium Chloride	increases expression	3
sodium arsenite	increases abundance, affects expression, decreases expression	2
bisphenol S	decreases methylation, increases expression	2
Smoke	decreases expression	2
Tretinoin	decreases expression, increases expression	2
Tunicamycin	increases expression	2
Valproic Acid	affects expression, increases methylation	2
Metribolone	affects splicing, decreases expression	2
testosterone enanthate	affects expression	1
methylmercuric chloride	increases expression	1
triphenyl phosphate	affects expression	1
propionaldehyde	increases expression	1
sodium arsenate	increases expression	1
decabromobiphenyl ether	decreases expression	1
sodium bichromate	decreases expression	1
tris(1,3-dichloro-2-propyl)phosphate	decreases expression	1
cobaltous chloride	decreases expression	1
tetrabromobisphenol A	decreases expression	1
ochratoxin A	increases expression	1
pyridoxal phosphate gamma-aminobutyric acid	decreases reaction, increases phosphorylation	1
di-n-butylphosphoric acid	affects expression	1
chloropicrin	decreases expression	1
nutlin 3	affects cotreatment, increases secretion	1
ICG 001	increases expression	1
bisphenol B	increases expression	1
abrine	decreases expression	1
pentabrominated diphenyl ether 100	decreases expression	1
2-(1H-indazol-4-yl)-6-(4-methanesulfonylpiperazin-1-ylmethyl)-4-morpholin-4-ylthieno(3,2-d)pyrimidine	increases response to substance, decreases expression	1

ChEMBL screening assays

21 unique, capped per target: 20 binding, 1 admet

Representative assays (with source publication via chembl_document):

Assay ID	Type	Description	Source paper
CHEMBL1116771	Binding	Activity at human PKH kinase expressed in Escherichia coli by affinity chromatography	Ginkgo biloba and ginkgotoxin. — *J Nat Prod*
CHEMBL3821394	ADMET	Binding affinity to PDXK in human HepG2 assessed as intensity fold change of cumulated normalized intensity of protein between capture and competition assay at 100 uM after 1 hr in presence of inactive Tcp-CC 14 by differential competition	Identification of Potential Off-target Toxicity Liabilities of Catechol-O-methyltransferase Inhibitors by Differential Competition Capture Compound Mass Spectrometry. — *J Med Chem*

Cellosaurus cell lines

4 cell lines: 3 cancer cell line, 1 transformed cell line

First 10 cell lines (id-ordered, not curated):

Cellosaurus	Name	Category	Sex
CVCL_B3DP	Abcam HEK293T PDXK KO	Transformed cell line	Female
CVCL_F6E9	EDITGENE PDXK Knockout HeLa Cell Line	Cancer cell line	Female
CVCL_TC88	HAP1 PDXK (-) 1	Cancer cell line	Male
CVCL_XR51	HAP1 PDXK (-) 2	Cancer cell line	Male

Clinical trials (associated diseases)

Via MONDO — disease-level, not drug-specific.

3 trials:

NCT	Phase	Status	Title
NCT05687474	Not specified	COMPLETED	Baby Detect : Genomic Newborn Screening
NCT06593951	Not specified	RECRUITING	Registry and Natural History Study for Progressive Myoclonus Epilepsy Type 1 (EPM1)
NCT06923241	Not specified	COMPLETED	Nutri-score Labelling in a UK Restaurant Setting: a Randomised Control Trial

Predicted chemistry — Sugi Predict

The predicted patent-compound landscape for PDXK across ~30M SureChEMBL compounds — explore on Sugi Predict.