PET117

Summary

PET117 (PET117 cytochrome c oxidase chaperone, HGNC:40045) is a protein-coding gene on chromosome 20p11.23, encoding Protein PET117 homolog, mitochondrial (Q6UWS5). It is a selective cancer dependency (DepMap: 30.5% of cell lines).

Predicted to be involved in mitochondrial cytochrome c oxidase assembly. Located in mitochondrion. Implicated in mitochondrial complex IV deficiency nuclear type 19.

Source: NCBI Gene 100303755 — RefSeq curated summary.

At a glance

• Gene–disease (curated): cytochrome-c oxidase deficiency disease (Supportive, GenCC) — +3 more curated relationships
• GWAS associations: 1
• Clinical variants (ClinVar): 1 total
• Phenotypes (HPO): 17
• Cancer dependency (DepMap): dependent in 30.5% of screened cell lines
• MANE Select transcript: NM_001164811

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:40045
Approved symbol	PET117
Name	PET117 cytochrome c oxidase chaperone
Location	20p11.23
Locus type	gene with protein product
Status	Approved
Aliases	CSRP2BP
Ensembl gene	ENSG00000232838
Ensembl biotype	protein_coding
OMIM	614771
Entrez	100303755

Gene structure

Transcript identifiers

Ensembl transcripts: 1 — 1 protein_coding

ENST00000432901

RefSeq mRNA: 1 — MANE Select: NM_001164811 NM_001164811

CCDS: CCDS54450

Canonical transcript exons

ENST00000432901 — 2 exons

Exon	Start	End
ENSE00001664430	18142208	18143169
ENSE00003596071	18137863	18138051

Expression profiles

Bgee: expression breadth ubiquitous, 253 present calls, max score 97.19.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 14.3814 / max 219.7914, expressed in 1773 samples.

FANTOM5 promoters (2 alternative TSS)

Promoter ID	TPM avg	Samples expressed
183676	14.3814	1773
183677	4.3706	1628

Top tissues by expression

255 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
endothelial cell	CL:0000115	97.19	gold quality
primordial germ cell in gonad	CL:0000670 ∩ UBERON:0000991	93.97	gold quality
epithelial cell of pancreas	CL:0000083	92.68	gold quality
oviduct epithelium	UBERON:0004804	89.09	gold quality
jejunal mucosa	UBERON:0000399	88.38	gold quality
pancreatic ductal cell	CL:0002079	88.35	gold quality
adrenal tissue	UBERON:0018303	86.57	gold quality
pigmented layer of retina	UBERON:0001782	86.46	gold quality
mucosa of transverse colon	UBERON:0004991	86.29	gold quality
Brodmann (1909) area 23	UBERON:0013554	86.17	gold quality
ileal mucosa	UBERON:0000331	85.73	gold quality
germinal epithelium of ovary	UBERON:0001304	85.31	gold quality
left adrenal gland	UBERON:0001234	84.97	gold quality
male germ line stem cell (sensu Vertebrata) in testis	CL:0000089 ∩ UBERON:0000473	84.96	gold quality
gastrocnemius	UBERON:0001388	84.95	gold quality
anterior cingulate cortex	UBERON:0009835	84.85	gold quality
left adrenal gland cortex	UBERON:0035825	84.83	gold quality
prefrontal cortex	UBERON:0000451	84.78	gold quality
muscle of leg	UBERON:0001383	84.41	gold quality
Brodmann (1909) area 9	UBERON:0013540	84.32	gold quality
dorsolateral prefrontal cortex	UBERON:0009834	84.30	gold quality
amniotic fluid	UBERON:0000173	84.26	gold quality
right adrenal gland cortex	UBERON:0035827	84.26	gold quality
adrenal gland	UBERON:0002369	84.13	gold quality
palpebral conjunctiva	UBERON:0001812	84.12	gold quality
right adrenal gland	UBERON:0001233	84.05	gold quality
C1 segment of cervical spinal cord	UBERON:0006469	84.05	gold quality
caudate nucleus	UBERON:0001873	83.82	gold quality
duodenum	UBERON:0002114	83.75	gold quality
putamen	UBERON:0001874	83.70	gold quality

Single-cell (SCXA)

Detected in 1 experiment(s), a significant marker in 1.

Experiment	Marker?	Max mean expression
E-ANND-3	yes	5.54

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

26 targeting PET117, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-513A-5P	100.00	69.77	2465
HSA-MIR-8485	100.00	77.57	4731
HSA-MIR-302C-5P	99.97	72.56	3642
HSA-MIR-96-5P	99.95	72.80	2140
HSA-MIR-1236-3P	99.94	68.04	1695
HSA-MIR-12133	99.92	71.82	2006
HSA-MIR-1271-5P	99.91	71.99	1972
HSA-MIR-7162-3P	99.89	68.16	1682
HSA-MIR-4307	99.82	70.45	3374
HSA-MIR-3942-3P	99.57	69.03	2854
HSA-MIR-12122	99.56	69.33	1672
HSA-MIR-12123	99.52	71.79	2990
HSA-MIR-3123	99.47	67.15	2693
HSA-MIR-7151-5P	99.37	67.82	613
HSA-MIR-32-3P	99.36	68.20	2517
HSA-MIR-130A-5P	99.33	70.26	2623
HSA-MIR-892C-5P	99.16	70.56	2116
HSA-MIR-320A-5P	98.88	66.75	1248
HSA-MIR-501-5P	98.77	68.88	1328
HSA-MIR-892B	98.00	67.11	821
HSA-MIR-12127	97.93	66.67	793
HSA-MIR-4475	97.36	66.95	761
HSA-MIR-4448	97.04	66.22	752
HSA-MIR-500B-3P	96.49	65.40	1087
HSA-MIR-4268	94.45	64.09	819
HSA-MIR-4636	91.87	64.93	40

Functional genomics

DepMap (CRISPR cell-line fitness): dependent in 30.5% of screened cell lines.

Literature-anchored findings (GeneRIF, showing 3)

• Ortholog of fungal COX assembly protein PET117 (PMID:22356826)
• The short isoform of the myofibrillogenesis regulator 1 (MR-1S) as a new COX assembly factor, which works with the highly conserved PET100 and PET117 chaperones to assist COX biogenesis in higher eukaryotes. (PMID:28199844)
• case presentation thus implicates mutations in PET117 as a novel cause of mitochondrial disease (PMID:28386624)

Cross-species orthologs

2 orthologs

Organism	Symbol	Gene ID
mus_musculus	Pet117	ENSMUSG00000098387
rattus_norvegicus	Pet117	ENSRNOG00000077573

Protein

Protein identifiers

Protein PET117 homolog, mitochondrial — Q6UWS5 (reviewed: Q6UWS5)

All UniProt accessions (2): Q6UWS5, L0R6F6

UniProt curated annotations — full annotation on UniProt →

Subcellular location. Mitochondrion.

Disease relevance. Mitochondrial complex IV deficiency, nuclear type 19 (MC4DN19) [MIM:619063] An autosomal recessive mitochondrial disorder with onset in infancy or early childhood. MC4DN19 is characterized by global developmental delay, impaired intellectual development, developmental regression, loss of acquired motor and language skills, and motor dysfunction. Patient tissues show decreased levels and activity of mitochondrial respiratory complex IV. The disease may be caused by variants affecting the gene represented in this entry.

Similarity. Belongs to the PET117 family.

RefSeq proteins (1): NP_001158283* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR031568	Pet117	Family

Pfam: PF15786

UniProt features (3 total): transit peptide 1, chain 1, sequence variant 1

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q6UWS5-F1	94.94	0.93

Function

Pathways and Gene Ontology

Reactome pathways

1 pathways

ID	Pathway
R-HSA-9864848	Complex IV assembly

MSigDB gene sets: 94 (showing top): GOBP_RESPIRATORY_CHAIN_COMPLEX_IV_ASSEMBLY, GOBP_MITOCHONDRIAL_RESPIRATORY_CHAIN_COMPLEX_ASSEMBLY, GOBP_CYTOCHROME_COMPLEX_ASSEMBLY, LEE_RECENT_THYMIC_EMIGRANT, chr20p11, JOHNSTONE_PARVB_TARGETS_3_DN, CEBPZ_TARGET_GENES, DIDO1_TARGET_GENES, E2F5_TARGET_GENES, FEV_TARGET_GENES, FOXN3_TARGET_GENES, HOXB4_TARGET_GENES, KAT2A_TARGET_GENES, SKIL_TARGET_GENES, TFEB_TARGET_GENES

GO Biological Process (1): mitochondrial respiratory chain complex IV assembly (GO:0033617)

GO Molecular Function (0):

GO Cellular Component (1): mitochondrion (GO:0005739)

Reactome top-level categories

Rollup of top-1 pathways:

Category	Pathways
Respiratory electron transport	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
mitochondrion	1
respiratory chain complex IV assembly	1
mitochondrial respiratory chain complex assembly	1
cytoplasm	1
intracellular membrane-bounded organelle	1

Protein interactions and networks

STRING

420 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
PET117	PNKD	Q8N490	913
PET117	COX15	Q7KZN9	909
PET117	PET100	P0DJ07	842
PET117	COA6	Q5JTJ3	686
PET117	SURF1	Q15526	678
PET117	COX11	Q9Y6N1	676
PET117	COX17	Q14061	666
PET117	COX10	Q12887	665
PET117	COA5	Q86WW8	640
PET117	SCO1	O75880	638
PET117	COX14	Q96I36	621
PET117	COX18	Q8N8Q8	593
PET117	SCO2	O43819	584
PET117	COX20	Q5RI15	583
PET117	COA3	Q9Y2R0	582

IntAct

2 interactions, top by confidence:

A	B	Type	Score
INSR	RIMOC1	psi-mi:“MI:0914”(association)	0.350

BioGRID (6): PET117 (Positive Genetic), PET117 (Negative Genetic), PET117 (Negative Genetic), PET117 (Negative Genetic), PET117 (Affinity Capture-MS), PET117 (Affinity Capture-RNA)

ESM2 similar proteins: A0A0B4J2F0, A1XQT2, A3KP48, A7TQM5, A8E7D3, A8KB87, B3DFP2, B7Z0X7, C0HLN0, C5DE77, E9QJ05, G2TRJ9, O64725, O94705, P04038, P07255, P09669, P0DJF2, P0DKM0, P11950, P19173, P80977, Q1RMH3, Q3T0E3, Q42841, Q5R7J0, Q5R987, Q5XFV8, Q63ZZ0, Q6BPV1, Q6CWK9, Q6FWE8, Q6UWS5, Q757F0, Q7S5M7, Q7YRJ9, Q7YRK0, Q7YRK1, Q7YRK2, Q7YRK3

Diamond homologs: E9QJ05, P0DJF2, Q02771, Q6UWS5

SIGNOR signaling

0 interactions.

Disease & clinical

Clinical variants and AI predictions

ClinVar

1 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	0
Likely benign	1
Benign	0

Top pathogenic / likely-pathogenic (0)

SpliceAI

596 predictions. Top by Δscore:

Variant	Effect	Δscore
20:18142202:TTTTA:T	acceptor_loss	1.0000
20:18142203:TTTA:T	acceptor_loss	1.0000
20:18142204:TTA:T	acceptor_loss	1.0000
20:18142205:TA:T	acceptor_loss	1.0000
20:18142206:A:AG	acceptor_gain	1.0000
20:18142206:AG:A	acceptor_loss	1.0000
20:18142206:AGAG:A	acceptor_gain	1.0000
20:18142207:G:GG	acceptor_gain	1.0000
20:18142207:GA:G	acceptor_gain	1.0000
20:18142207:GAGG:G	acceptor_gain	1.0000
20:18142207:GAGGC:G	acceptor_gain	1.0000
20:18142916:GCCA:G	donor_gain	1.0000
20:18142920:G:GG	donor_gain	1.0000
20:18138047:AGCAG:A	donor_loss	0.9900
20:18138048:GCAG:G	donor_gain	0.9900
20:18138049:CAGGT:C	donor_loss	0.9900
20:18138051:GGTC:G	donor_loss	0.9900
20:18138052:GTCG:G	donor_loss	0.9900
20:18138053:T:G	donor_loss	0.9900
20:18138920:GGTCA:G	donor_gain	0.9800
20:18142199:C:CA	acceptor_gain	0.9800
20:18142925:G:GT	donor_gain	0.9800
20:18138057:TGTC:T	donor_gain	0.9700
20:18138862:A:G	donor_gain	0.9700
20:18142198:AC:A	acceptor_gain	0.9700
20:18142891:TGAC:T	donor_gain	0.9700
20:18143022:GA:G	donor_gain	0.9700
20:18138066:ACC:A	donor_gain	0.9600
20:18139138:G:GT	donor_gain	0.9600
20:18137976:G:GA	donor_gain	0.9500

AlphaMissense

515 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
20:18142233:A:C	D41A	0.976
20:18142233:A:T	D41V	0.973
20:18142234:C:A	D41E	0.972
20:18142234:C:G	D41E	0.972
20:18142232:G:C	D41H	0.969
20:18138002:C:A	T16K	0.964
20:18142221:G:A	G37E	0.964
20:18142255:A:C	K48N	0.964
20:18142255:A:T	K48N	0.964
20:18142212:T:C	L34P	0.950
20:18137993:T:A	V13E	0.949
20:18138002:C:G	T16R	0.947
20:18142220:G:A	G37R	0.941
20:18142220:G:C	G37R	0.941
20:18142233:A:G	D41G	0.940
20:18137983:G:C	G10R	0.938
20:18142275:T:C	L55S	0.933
20:18138014:T:A	V20E	0.932
20:18142232:G:A	D41N	0.930
20:18138008:C:A	A18D	0.928
20:18142224:T:A	V38D	0.927
20:18142254:A:T	K48I	0.924
20:18137984:G:A	G10D	0.920
20:18138011:C:A	T19K	0.920
20:18142221:G:T	G37V	0.917
20:18142305:T:C	L65P	0.912
20:18142254:A:C	K48T	0.911
20:18142245:A:C	Q45P	0.908
20:18142232:G:T	D41Y	0.904
20:18142272:T:C	L54P	0.904

dbSNP variants (sampled 300 via entrez): RS1000376615 (20:18137270 T>A,C), RS1000407681 (20:18137489 G>C), RS1001363401 (20:18141473 A>AT), RS1001413040 (20:18142994 G>A,C,T), RS1002079537 (20:18136108 G>A), RS1002265035 (20:18136114 A>T), RS1002302528 (20:18142305 T>C), RS1002608231 (20:18141858 C>T), RS1002973740 (20:18138928 G>T), RS1002992993 (20:18140760 TAAGATCGTGCCATGGAGCC>T), RS1004029386 (20:18140187 G>T), RS1004255278 (20:18136545 G>A), RS1004255968 (20:18137998 C>T), RS1004846719 (20:18142189 CTG>C), RS1005413055 (20:18141195 A>G)

Disease associations

OMIM: gene MIM:614771 | disease phenotypes:

GenCC curated gene-disease

Disease	Classification	Inheritance
cytochrome-c oxidase deficiency disease	Supportive	Autosomal recessive
Leigh syndrome	Limited	Autosomal recessive
mitochondrial complex IV deficiency, nuclear type 19	Limited	Unknown

ClinGen Gene-Disease Validity (2)

Expert-panel classifications — Definitive > Strong > Moderate > Limited > Disputed > Refuted.

Disease	Classification	Inheritance
mitochondrial disease	Limited	AR
Leigh syndrome	Limited	AR

Mondo (3): Leigh syndrome (MONDO:0009723), mitochondrial complex IV deficiency, nuclear type 19 (MONDO:0033654), (MONDO:0009068)

Orphanet (0):

HPO phenotypes

17 total (17 of 17 shown, HPO-id order):

HPO	Term
HP:0000007	Autosomal recessive inheritance
HP:0001270	Motor delay
HP:0002067	Bradykinesia
HP:0002151	Increased circulating lactate concentration
HP:0002154	Hyperglycinemia
HP:0002205	Recurrent respiratory infections
HP:0002243	Protein-losing enteropathy
HP:0002375	Hypokinesia
HP:0002376	Developmental regression
HP:0002490	Increased CSF lactate
HP:0003487	Babinski sign
HP:0003621	Juvenile onset
HP:0003648	Lacticaciduria
HP:0008347	Decreased activity of mitochondrial complex IV
HP:0011463	Childhood onset
HP:0040014	Increased mitochondrial number
HP:0500233	Increased CSF alanine concentration

GWAS associations

1 associations (top):

Study	Trait	p-value
GCST011037_8	Parkinson’s disease progression (cognitive)	8.000000e-06

EFO canonical traits (1, from GWAS)

EFO ID	Trait name
EFO:0008336	disease progression measurement

MeSH disease descriptors (1)

Descriptor	Name	Tree numbers
D007888	Leigh Disease	C10.228.140.163.100.412; C16.320.565.189.412; C16.320.565.202.810.444; C18.452.132.100.412; C18.452.648.189.412; C18.452.648.202.810.444; C18.452.660.520

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

12 total (human), top 12 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Valproic Acid	affects expression, decreases expression	3
Cadmium Chloride	decreases expression	2
trichostatin A	affects expression	1
sodium arsenite	decreases expression	1
Air Pollutants	affects expression, increases abundance	1
Benzo(a)pyrene	affects methylation	1
Carbamazepine	affects expression	1
Ozone	affects expression, increases abundance	1
Silver	decreases expression	1
Urethane	decreases expression	1
Cyclosporine	decreases expression	1
p-Chloromercuribenzoic Acid	decreases expression	1

Clinical trials (associated diseases)

14 trials via MONDO — disease-level, not drug-specific.

Trial	Phase	Status	Title
NCT01721733	PHASE2	COMPLETED	Safety and Efficacy Study of EPI-743 in Children With Leigh Syndrome
NCT02352896	PHASE2	COMPLETED	Long-Term Safety and Efficacy Evaluation of EPI-743 in Children With Leigh Syndrome
NCT03747328	PHASE2	WITHDRAWN	ABI-009 (Nab-sirolimus) in Patients With Genetically-confirmed Leigh or Leigh-like Syndrome
NCT06843811	PHASE2	ENROLLING_BY_INVITATION	Sirolimus for Leigh Syndrome
NCT06990984	PHASE2	NOT_YET_RECRUITING	A Dose-ranging Study of TTI-0102 in Adults and Children With Leigh Syndrome Spectrum (LSS)
NCT02544217	PHASE1	COMPLETED	A Dose-escalating Clinical Trial With KH176
NCT04378075	PHASE2/PHASE3	TERMINATED	A Study to Evaluate Efficacy and Safety of Vatiquinone for Treating Mitochondrial Disease in Participants With Refractory Epilepsy
NCT01780168	Not specified	RECRUITING	The NIH MINI Study: Metabolism, Infection, and Immunity in Inborn Errors of Metabolism
NCT01793168	Not specified	RECRUITING	Rare Disease Patient Registry & Natural History Study - Coordination of Rare Diseases at Sanford
NCT01803906	Not specified	ENROLLING_BY_INVITATION	Tissue Sample Study for Mitochondrial Disorders
NCT03137355	Not specified	RECRUITING	The International Registry for Leigh Syndrome
NCT05277363	Not specified	WITHDRAWN	A Study of the Natural Course of SURF1 Deficiency
NCT05554835	Not specified	RECRUITING	Global Registry and Natural History Study for Mitochondrial Disorders
NCT06967831	Not specified	RECRUITING	Drug Repurposing for Mitochondrial Disorders Using iPSCs Derived Neural Cells