PFDN6

Summary

PFDN6 (prefoldin subunit 6, HGNC:4926) is a protein-coding gene on chromosome 6p21.32, encoding Prefoldin subunit 6 (O15212). Binds specifically to cytosolic chaperonin (c-CPN) and transfers target proteins to it. It is a common-essential gene (DepMap: required in 99.1% of cancer cell lines).

PFDN6 is a subunit of the heteromeric prefoldin complex that chaperones nascent actin (see MIM 102560) and alpha- and beta-tubulin (see MIM 602529 and MIM 191130, respectively) chains pending their transfer to the cytosolic chaperonin containing TCP1 (MIM 186980) (CCT) complex (Hansen et al., 1999 [PubMed 10209023]).

Source: NCBI Gene 10471 — RefSeq curated summary.

At a glance

• GWAS associations: 2
• Clinical variants (ClinVar): 12 total
• Druggable target: yes
• Cancer dependency (DepMap): dependent in 99.1% of screened cell lines (common-essential)
• MANE Select transcript: NM_001185181

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:4926
Approved symbol	PFDN6
Name	prefoldin subunit 6
Location	6p21.32
Locus type	gene with protein product
Status	Approved
Aliases	KE-2, H2-KE2, PFD6
Ensembl gene	ENSG00000204220
Ensembl biotype	protein_coding
OMIM	605660
Entrez	10471

Gene structure

Transcript identifiers

Ensembl transcripts: 9 — 7 protein_coding, 2 retained_intron

ENST00000374606, ENST00000374607, ENST00000374610, ENST00000395131, ENST00000395134, ENST00000463584, ENST00000491382, ENST00000883725, ENST00000940443

RefSeq mRNA: 4 — MANE Select: NM_001185181 NM_001185181, NM_001265595, NM_001265596, NM_014260

CCDS: CCDS4773

Canonical transcript exons

ENST00000374606 — 4 exons

Exon	Start	End
ENSE00001722716	33290326	33290450
ENSE00001749953	33290716	33290933
ENSE00001896952	33289601	33289920
ENSE00003506495	33290174	33290244

Expression profiles

Bgee: expression breadth ubiquitous, 134 present calls, max score 97.35.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 20.2979 / max 266.7659, expressed in 1804 samples.

FANTOM5 promoters (2 alternative TSS)

Promoter ID	TPM avg	Samples expressed
67269	19.8587	1804
67270	0.4392	218

Top tissues by expression

134 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
left testis	UBERON:0004533	97.35	gold quality
right testis	UBERON:0004534	97.33	gold quality
hypothalamus	UBERON:0001898	97.32	gold quality
islet of Langerhans	UBERON:0000006	97.29	gold quality
Brodmann (1909) area 9	UBERON:0013540	97.28	gold quality
testis	UBERON:0000473	97.22	gold quality
Ammon’s horn	UBERON:0001954	97.18	gold quality
dorsolateral prefrontal cortex	UBERON:0009834	97.09	gold quality
amygdala	UBERON:0001876	97.03	gold quality
mucosa of transverse colon	UBERON:0004991	97.01	gold quality
temporal lobe	UBERON:0001871	96.95	gold quality
substantia nigra	UBERON:0002038	96.92	gold quality
caudate nucleus	UBERON:0001873	96.91	gold quality
anterior cingulate cortex	UBERON:0009835	96.90	gold quality
nucleus accumbens	UBERON:0001882	96.89	gold quality
putamen	UBERON:0001874	96.84	gold quality
C1 segment of cervical spinal cord	UBERON:0006469	96.59	gold quality
monocyte	CL:0000576	96.48	gold quality
adenohypophysis	UBERON:0002196	96.43	gold quality
gastrocnemius	UBERON:0001388	96.34	gold quality
right frontal lobe	UBERON:0002810	96.31	gold quality
leukocyte	CL:0000738	96.22	gold quality
lower esophagus mucosa	UBERON:0035834	96.18	gold quality
muscle of leg	UBERON:0001383	96.16	gold quality
primary visual cortex	UBERON:0002436	96.16	gold quality
pituitary gland	UBERON:0000007	96.07	gold quality
left adrenal gland cortex	UBERON:0035825	96.07	gold quality
placenta	UBERON:0001987	96.04	gold quality
left adrenal gland	UBERON:0001234	95.99	gold quality
vermiform appendix	UBERON:0001154	95.89	gold quality

Single-cell (SCXA)

Detected in 2 experiment(s), a significant marker in 0.

Experiment	Marker?	Max mean expression
E-MTAB-6524	no	47.29
E-ANND-3	no	2.55

Regulation

Is transcription factor: no

Upstream regulators (CollecTRI, top): MYC

Functional genomics

DepMap (CRISPR cell-line fitness): dependent in 99.1% of screened cell lines, common-essential.

Literature-anchored findings (GeneRIF, showing 2)

• The localization of the HKE2 gene to the class II region, its cytoplasmic expression and putative protein-binding domain suggest that HKE2 may function in adaptive immunity and cancer. (PMID:17257322)
• Is part of an RNA polymerase II-associated complex with possible chaperone activity. (PMID:19450687)

Cross-species orthologs

5 orthologs

Organism	Symbol	Gene ID
danio_rerio	pfdn6	ENSDARG00000037108
mus_musculus	Pfdn6	ENSMUSG00000024309
rattus_norvegicus	Pfdn6	ENSRNOG00000000473
drosophila_melanogaster	Pfdn6	FBGN0036918
caenorhabditis_elegans	pfd-6	WBGENE00009004

Protein

Protein identifiers

Prefoldin subunit 6 — O15212 (reviewed: O15212)

Alternative names: Protein Ke2

All UniProt accessions (3): O15212, A2AB88, Q5STK2

UniProt curated annotations — full annotation on UniProt →

Function. Binds specifically to cytosolic chaperonin (c-CPN) and transfers target proteins to it. Binds to nascent polypeptide chain and promotes folding in an environment in which there are many competing pathways for nonnative proteins.

Subunit / interactions. Heterohexamer of two PFD-alpha type and four PFD-beta type subunits. Component of the PAQosome complex which is responsible for the biogenesis of several protein complexes and which consists of R2TP complex members RUVBL1, RUVBL2, RPAP3 and PIH1D1, URI complex members PFDN2, PFDN6, PDRG1, UXT and URI1 as well as ASDURF, POLR2E and DNAAF10/WDR92.

Similarity. Belongs to the prefoldin subunit beta family.

RefSeq proteins (4): NP_001172110, NP_001252524, NP_001252525, NP_055075 (=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR002777	PFD_beta-like	Family
IPR009053	Prefoldin	Homologous_superfamily

Pfam: PF01920

UniProt features (7 total): modified residue 3, cross-link 2, initiator methionine 1, chain 1

Structure

Experimental structures (PDB)

6 structures.

PDB	Method	Resolution (Å)
7WU7	ELECTRON MICROSCOPY	3.85
6NR8	ELECTRON MICROSCOPY	7.8
6NRD	ELECTRON MICROSCOPY	8.2
6NRC	ELECTRON MICROSCOPY	8.3
6NR9	ELECTRON MICROSCOPY	8.5
6NRB	ELECTRON MICROSCOPY	8.7

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-O15212-F1	95.04	0.91

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Post-translational modifications (5): 2, 21, 66, 66, 66

Function

Pathways and Gene Ontology

Reactome pathways

1 pathways

ID	Pathway
R-HSA-389957	Prefoldin mediated transfer of substrate to CCT/TriC

MSigDB gene sets: 122 (showing top): STARK_PREFRONTAL_CORTEX_22Q11_DELETION_DN, GOBP_CHAPERONE_MEDIATED_PROTEIN_COMPLEX_ASSEMBLY, FOXO1_01, USF_C, PATIL_LIVER_CANCER, GOBP_NEGATIVE_REGULATION_OF_CELLULAR_COMPONENT_ORGANIZATION, PUJANA_CHEK2_PCC_NETWORK, MUELLER_PLURINET, GOBP_PROTEIN_MATURATION, WANG_LMO4_TARGETS_DN, MORF_PPP5C, GOBP_PROTEIN_STABILIZATION, DAZARD_RESPONSE_TO_UV_SCC_UP, GOBP_PROTEIN_FOLDING, GOBP_REGULATION_OF_PROTEIN_STABILITY

GO Biological Process (4): protein folding (GO:0006457), protein stabilization (GO:0050821), chaperone-mediated protein complex assembly (GO:0051131), negative regulation of amyloid fibril formation (GO:1905907)

GO Molecular Function (4): amyloid-beta binding (GO:0001540), obsolete unfolded protein binding (GO:0051082), protein-folding chaperone binding (GO:0051087), protein binding (GO:0005515)

GO Cellular Component (5): cytoplasm (GO:0005737), prefoldin complex (GO:0016272), protein folding chaperone complex (GO:0101031), RPAP3/R2TP/prefoldin-like complex (GO:1990062), protein-containing complex (GO:0032991)

Reactome top-level categories

Rollup of top-1 pathways:

Category	Pathways
Cooperation of Prefoldin and TriC/CCT in actin and tubulin folding	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
protein-containing complex	2
cellular process	1
protein maturation	1
regulation of protein stability	1
protein-containing complex assembly	1
negative regulation of protein metabolic process	1
negative regulation of supramolecular fiber organization	1
regulation of amyloid fibril formation	1
amyloid fibril formation	1
peptide binding	1
protein binding	1
binding	1
intracellular anatomical structure	1
cellular anatomical structure	1
intracellular protein-containing complex	1
cellular_component	1

Protein interactions and networks

STRING

2605 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
PFDN6	PFDN2	Q9UHV9	997
PFDN6	PDRG1	Q9NUG6	995
PFDN6	UXT	Q9UBK9	994
PFDN6	DNAAF10	Q96MX6	984
PFDN6	PFDN5	Q99471	984
PFDN6	RPAP3	Q9H6T3	962
PFDN6	PFDN1	O60925	962
PFDN6	POLR2E	P19388	955
PFDN6	RPS18	P25232	925
PFDN6	PFDN4	Q9NQP4	922
PFDN6	RUVBL1	P82276	921
PFDN6	SLC39A7	Q92504	920
PFDN6	GPN1	Q9HCN4	895
PFDN6	RUVBL2	Q9Y230	887
PFDN6	HSD17B8	Q92506	878
PFDN6	RGL2	O15211	878

IntAct

160 interactions, top by confidence:

A	B	Type	Score
PPP1CC	CCDC85C	psi-mi:“MI:0914”(association)	0.740
PPP1CC	CCDC85C	psi-mi:“MI:2364”(proximity)	0.740
PFDN4	PFDN6	psi-mi:“MI:0914”(association)	0.730
POLR2E	MED19	psi-mi:“MI:0914”(association)	0.730
PPP1CA	CCDC85C	psi-mi:“MI:0914”(association)	0.670
PPP1CA	CCDC85C	psi-mi:“MI:2364”(proximity)	0.670
PFDN2	POLR3A	psi-mi:“MI:0914”(association)	0.670
VBP1	PFDN6	psi-mi:“MI:0914”(association)	0.640
MAPK7	PFDN6	psi-mi:“MI:0914”(association)	0.640
PFDN1	PFDN6	psi-mi:“MI:0914”(association)	0.640
DCAF12L2	CETN3	psi-mi:“MI:0914”(association)	0.640
DCAF7	PFDN6	psi-mi:“MI:2364”(proximity)	0.570
DCAF7	PFDN6	psi-mi:“MI:0914”(association)	0.570
PFDN6	MBD3	psi-mi:“MI:0915”(physical association)	0.560
PFDN6	KANK2	psi-mi:“MI:0915”(physical association)	0.560
PFDN6	KIFC3	psi-mi:“MI:0915”(physical association)	0.560
PFDN6	CCHCR1	psi-mi:“MI:0915”(physical association)	0.560
PFDN6	FBXO2	psi-mi:“MI:0915”(physical association)	0.560
PFDN6	AIMP2	psi-mi:“MI:0915”(physical association)	0.560
PFDN6	CEBPG	psi-mi:“MI:0915”(physical association)	0.560
PFDN6	MAGEB4	psi-mi:“MI:0915”(physical association)	0.560
PFDN6	RPRD1B	psi-mi:“MI:0915”(physical association)	0.560

BioGRID (292): PFDN6 (Two-hybrid), PFDN6 (Affinity Capture-MS), PFDN6 (Affinity Capture-MS), CSTF2 (Co-fractionation), PFDN2 (Co-fractionation), PFDN5 (Co-fractionation), PFDN6 (Co-fractionation), PFDN6 (Co-fractionation), PFDN6 (Co-fractionation), PFDN6 (Co-fractionation), VBP1 (Co-fractionation), PFDN6 (Proximity Label-MS), PFDN6 (Proximity Label-MS), PFDN6 (Proximity Label-MS), PFDN6 (Proximity Label-MS)

ESM2 similar proteins: A8PKH2, A8WM57, A8WVJ9, A8X0Z1, A8XPL7, A8Y197, O14334, O14450, O15212, O18054, O94307, P33313, P34339, P40005, P46988, P48363, P52553, P52554, P61758, P61759, Q03958, Q04493, Q07508, Q10143, Q17435, Q17827, Q17Q89, Q21993, Q2HIK4, Q2TBX2, Q54JS0, Q54LS2, Q54M71, Q54TB7, Q54V55, Q55GN3, Q5RCG9, Q5TJE6, Q61SU8, Q68RJ5

Diamond homologs: A8Y197, O14450, O15212, P52553, P52554, Q03958, Q17Q89, Q2HIK4, Q54M71, Q5TJE6, Q9VW56, O29115, Q4JB32, Q8I3Y6, Q975H2, A0B8V8, A1RSS5, A3CW49, A3MUN9, A4FZU2, A4WM72, A5UNR1, A6URN3, A6UTE5, A8MB97, B0R2X8, B1Y973, B6YTZ4, B8GDQ7, C3MQ51, C3MVG9, C3N5R8, C3NED4, C3NHB8, C4KHE7, C5A6Y5, O26774, O58268, Q0W2Y3, Q12ZB1

SIGNOR signaling

2 interactions.

A	Effect	B	Mechanism
PFDN6	“form complex”	“URI1 prefoldin co-chaperone”	binding
PFDN6	“form complex”	“Prefoldin co-chaperone”	binding

Enriched among interaction partners

Reactome pathways and GO biological processes over-represented among this gene’s 137 IntAct physical interaction partners (hypergeometric vs the genome-wide background, BH-FDR, gene-set size 15–500, ranked by fold). A functional readout of the neighbourhood — distinct from this gene’s own memberships above, and biased toward well-studied / hub proteins, so read it as themes rather than proof.

Reactome pathways:

Pathway	Partners	Fold	FDR
RNA Polymerase III Chain Elongation	8	53.4×	1e-10
RNA Polymerase III Transcription Termination	8	41.8×	8e-10
RNA Polymerase III Transcription Initiation From Type 2 Promoter	9	40.1×	1e-10
RNA Polymerase III Transcription Initiation From Type 1 Promoter	9	38.6×	1e-10
RNA Polymerase III Transcription Initiation From Type 3 Promoter	9	38.6×	1e-10
RNA Polymerase III Transcription Initiation	9	31.8×	8e-10
RNA Polymerase III Transcription	9	30.9×	8e-10
Gap junction trafficking and regulation	6	30.1×	1e-06

GO biological processes:

GO term	Partners	Fold	FDR
mitotic spindle organization	5	11.1×	9e-03
regulation of signal transduction	5	10.9×	9e-03
microtubule cytoskeleton organization	11	10.8×	4e-06
mitotic cell cycle	8	8.7×	7e-04
protein stabilization	12	6.5×	1e-04

Disease & clinical

Clinical variants and AI predictions

ClinVar

12 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	8
Likely benign	0
Benign	1

Top pathogenic / likely-pathogenic (0)

SpliceAI

3380 predictions. Top by Δscore:

Variant	Effect	Δscore
6:33288690:TGGGT:T	acceptor_gain	1.0000
6:33288692:GGT:G	acceptor_gain	1.0000
6:33288692:GGTC:G	acceptor_gain	1.0000
6:33288693:GT:G	acceptor_gain	1.0000
6:33288693:GTCTA:G	acceptor_gain	1.0000
6:33288695:C:CC	acceptor_gain	1.0000
6:33288695:CT:C	acceptor_loss	1.0000
6:33288696:T:A	acceptor_loss	1.0000
6:33288836:T:TA	donor_gain	1.0000
6:33289916:GAAGG:G	donor_gain	1.0000
6:33289919:GG:G	donor_gain	1.0000
6:33289920:GG:G	donor_gain	1.0000
6:33290172:A:AG	acceptor_gain	1.0000
6:33290173:G:GG	acceptor_gain	1.0000
6:33290242:GAG:G	donor_gain	1.0000
6:33290320:CATCA:C	acceptor_loss	1.0000
6:33290321:ATCAG:A	acceptor_gain	1.0000
6:33290322:T:G	acceptor_gain	1.0000
6:33290322:TCA:T	acceptor_loss	1.0000
6:33290323:CAGG:C	acceptor_loss	1.0000
6:33290324:A:AT	acceptor_loss	1.0000
6:33290324:AG:A	acceptor_gain	1.0000
6:33290325:GG:G	acceptor_gain	1.0000
6:33290446:GAAAT:G	donor_gain	1.0000
6:33290447:AAATG:A	donor_loss	1.0000
6:33290448:AATG:A	donor_loss	1.0000
6:33290449:ATGTG:A	donor_loss	1.0000
6:33290450:TG:T	donor_loss	1.0000
6:33290451:G:GG	donor_gain	1.0000
6:33290451:GTGA:G	donor_loss	1.0000

AlphaMissense

0 scored. Top likely-pathogenic:

dbSNP variants (sampled 300 via entrez): RS1001362190 (6:33287440 T>C), RS1001895197 (6:33287803 T>C), RS1001922739 (6:33287373 G>A,C), RS1004404194 (6:33288908 T>C), RS1008084563 (6:33290398 G>A), RS1009186901 (6:33288772 C>G,T), RS1011229092 (6:33290065 C>A,G,T), RS1011507635 (6:33291304 G>A), RS1012185291 (6:33291149 T>G), RS1012216426 (6:33290873 G>A,C,T), RS1013633017 (6:33287814 G>A,T), RS1013855763 (6:33289543 T>A), RS1014140787 (6:33287967 TCCAGTTCGAGAGTAGTTTAGTCTGTAGGGTCCAAACTG>T), RS1015065908 (6:33288779 G>A,T), RS1015525601 (6:33290027 C>A,G)

Disease associations

OMIM: gene MIM:605660 | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

2 associations (top):

Study	Trait	p-value
GCST004521_251	Autism spectrum disorder or schizophrenia	6.000000e-12
GCST004521_287	Autism spectrum disorder or schizophrenia	5.000000e-08

Drugs & pharmacology

Drug and pharmacology data

Is drug target: yes

ChEMBL targets (1): CHEMBL6067048 (SINGLE PROTEIN)

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

23 total (human), top 23 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
bisphenol A	decreases expression, decreases methylation	2
sodium arsenite	increases expression	2
Valproic Acid	affects expression, increases methylation	2
arsenite	affects binding, increases reaction	1
cobaltous chloride	decreases expression	1
di-n-butylphosphoric acid	affects expression	1
CGP 52608	affects binding, increases reaction	1
oxidized-L-alpha-1-palmitoyl-2-arachidonoyl-sn-glycero-3-phosphorylcholine	affects expression, increases reaction	1
ICG 001	increases expression	1
jinfukang	increases expression	1
Vehicle Emissions	affects expression, increases reaction	1
Benzalkonium Compounds	affects response to substance	1
Benzo(a)pyrene	affects methylation	1
Dichlorodiphenyl Dichloroethylene	increases expression	1
Diethylstilbestrol	decreases expression	1
Ivermectin	decreases expression	1
Thiram	decreases expression	1
Urethane	decreases expression	1
Aflatoxin B1	decreases expression	1
Antirheumatic Agents	increases expression	1
Copper Sulfate	decreases expression	1
tert-Butylhydroperoxide	increases expression	1
Particulate Matter	affects expression, increases reaction	1

ChEMBL screening assays

1 unique, capped per target: 1 binding

Representative assays (with source publication via chembl_document):

Assay ID	Type	Description	Source paper
CHEMBL5652023	Binding	Binding affinity to human PFDN6 incubated for 45 mins by Kinobead based pull down assay	NVP-BHG712: Effects of Regioisomers on the Affinity and Selectivity toward the EPHrin Family. — ChemMedChem

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.