PHF7

Summary

PHF7 (PHD finger protein 7, HGNC:18458) is a protein-coding gene on chromosome 3p21.1, encoding E3 ubiquitin-protein ligase PHF7 (Q9BWX1). E3 ubiquitin-protein ligase which ubiquitinates histone H3 at ‘Lys-14’.

Spermatogenesis is a complex process regulated by extracellular and intracellular factors as well as cellular interactions among interstitial cells of the testis, Sertoli cells, and germ cells. This gene is expressed in the testis in Sertoli cells but not germ cells. The protein encoded by this gene contains plant homeodomain (PHD) finger domains, also known as leukemia associated protein (LAP) domains, believed to be involved in transcriptional regulation. The protein, which localizes to the nucleus of transfected cells, has been implicated in the transcriptional regulation of spermatogenesis. Alternate splicing results in multiple transcript variants of this gene.

Source: NCBI Gene 51533 — RefSeq curated summary.

At a glance

• GWAS associations: 6
• Clinical variants (ClinVar): 53 total
• MANE Select transcript: NM_016483

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:18458
Approved symbol	PHF7
Name	PHD finger protein 7
Location	3p21.1
Locus type	gene with protein product
Status	Approved
Aliases	NYD-SP6, HSPC226
Ensembl gene	ENSG00000010318
Ensembl biotype	protein_coding
OMIM	620057
Entrez	51533

Gene structure

Transcript identifiers

Ensembl transcripts: 16 — 11 protein_coding, 3 retained_intron, 2 protein_coding_CDS_not_defined

ENST00000327906, ENST00000347025, ENST00000459935, ENST00000461861, ENST00000465863, ENST00000472337, ENST00000473145, ENST00000482327, ENST00000498509, ENST00000614886, ENST00000894733, ENST00000894734, ENST00000894735, ENST00000940047, ENST00000958980, ENST00000958981

RefSeq mRNA: 4 — MANE Select: NM_016483 NM_001278221, NM_001321126, NM_001321127, NM_016483

CCDS: CCDS2854, CCDS2855

Canonical transcript exons

ENST00000327906 — 11 exons

Exon	Start	End
ENSE00001063782	52422222	52422338
ENSE00001811001	52410660	52411247
ENSE00001860146	52423091	52423641
ENSE00002376399	52422760	52422881
ENSE00003469637	52420311	52420435
ENSE00003470533	52413996	52414048
ENSE00003532458	52419833	52419934
ENSE00003558861	52412811	52412920
ENSE00003565828	52421648	52421754
ENSE00003567348	52414496	52414587
ENSE00003621087	52420903	52421062

Expression profiles

Bgee: expression breadth ubiquitous, 215 present calls, max score 99.87.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 13.8473 / max 4647.9797, expressed in 1743 samples.

FANTOM5 promoters (6 alternative TSS)

Promoter ID	TPM avg	Samples expressed
36849	9.0204	1496
36848	4.1813	1450
36847	0.3747	158
36850	0.2358	55
36852	0.0201	4
36851	0.0149	6

Top tissues by expression

266 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
right testis	UBERON:0004534	99.87	gold quality
left testis	UBERON:0004533	99.78	gold quality
adult organism	UBERON:0007023	99.62	gold quality
sperm	CL:0000019	99.12	gold quality
male germ cell	CL:0000015	98.98	gold quality
testis	UBERON:0000473	97.53	gold quality
male germ line stem cell (sensu Vertebrata) in testis	CL:0000089 ∩ UBERON:0000473	88.23	gold quality
sural nerve	UBERON:0015488	88.14	gold quality
calcaneal tendon	UBERON:0003701	87.64	gold quality
rectum	UBERON:0001052	86.35	gold quality
transverse colon	UBERON:0001157	83.84	gold quality
mucosa of stomach	UBERON:0001199	83.75	gold quality
skin of leg	UBERON:0001511	83.55	gold quality
tendon	UBERON:0000043	83.51	gold quality
colonic epithelium	UBERON:0000397	83.43	gold quality
muscle of leg	UBERON:0001383	83.34	gold quality
body of pancreas	UBERON:0001150	83.26	gold quality
gastrocnemius	UBERON:0001388	83.14	gold quality
primordial germ cell in gonad	CL:0000670 ∩ UBERON:0000991	82.54	gold quality
popliteal artery	UBERON:0002250	82.51	gold quality
tibial artery	UBERON:0007610	82.51	gold quality
oocyte	CL:0000023	82.48	gold quality
apex of heart	UBERON:0002098	82.47	gold quality
skin of abdomen	UBERON:0001416	82.33	gold quality
small intestine Peyer’s patch	UBERON:0003454	82.18	gold quality
olfactory segment of nasal mucosa	UBERON:0005386	81.92	gold quality
hindlimb stylopod muscle	UBERON:0004252	81.68	gold quality
minor salivary gland	UBERON:0001830	81.53	gold quality
tibial nerve	UBERON:0001323	81.23	gold quality
lower esophagus muscularis layer	UBERON:0035833	81.21	gold quality

Single-cell (SCXA)

Detected in 3 experiment(s), a significant marker in 3.

Experiment	Marker?	Max mean expression
E-GEOD-124263	yes	3185.49
E-GEOD-134144	yes	2594.65
E-ANND-3	no	0.00

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

25 targeting PHF7, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-196A-1-3P	99.99	72.15	2772
HSA-MIR-3065-5P	99.97	71.56	3281
HSA-MIR-570-3P	99.96	72.41	4910
HSA-MIR-3529-3P	99.90	73.55	3045
HSA-MIR-6780A-5P	99.88	66.69	2776
HSA-MIR-765	99.84	68.24	2442
HSA-MIR-1273H-5P	99.77	66.32	2471
HSA-MIR-11181-3P	99.75	66.38	2205
HSA-MIR-3680-3P	99.75	72.51	3095
HSA-MIR-30B-3P	99.70	65.76	2325
HSA-MIR-3689A-3P	99.70	65.73	2306
HSA-MIR-3689B-3P	99.70	65.71	2311
HSA-MIR-3689C	99.70	65.71	2311
HSA-MIR-6779-5P	99.70	65.76	2363
HSA-MIR-646	99.68	67.84	1645
HSA-MIR-7106-5P	99.53	67.47	3574
HSA-MIR-4784	99.15	67.41	1733
HSA-MIR-3150B-3P	98.81	67.21	1728
HSA-MIR-548AO-5P	98.55	69.57	1362
HSA-MIR-548AX	98.55	69.58	1362
HSA-MIR-1304-3P	98.29	66.44	1207
HSA-MIR-6778-5P	98.19	66.59	1239
HSA-MIR-1262	98.17	66.52	757
HSA-MIR-4701-3P	98.17	66.25	788
HSA-MIR-6736-5P	98.17	66.43	760

Literature-anchored findings (GeneRIF, showing 1)

• PHF7 promoter binds H4K12ac in mature spermatozoa. (PMID:22894908)

Cross-species orthologs

7 orthologs

Organism	Symbol	Gene ID
danio_rerio	g2e3	ENSDARG00000001313
danio_rerio	si:ch211-37e10.1	ENSDARG00000055506
danio_rerio	si:ch211-57f7.7	ENSDARG00000093131
mus_musculus	Phf7	ENSMUSG00000021902
rattus_norvegicus	Phf7	ENSRNOG00000018996
drosophila_melanogaster	pie	FBGN0005683
drosophila_melanogaster	Phf7	FBGN0031091

Paralogs (3): G2E3 (ENSG00000092140), PHF11 (ENSG00000136147), PHF6 (ENSG00000156531)

Protein

Protein identifiers

E3 ubiquitin-protein ligase PHF7 — Q9BWX1 (reviewed: Q9BWX1)

Alternative names: PHD finger protein 7, Testis development protein NYD-SP6

All UniProt accessions (4): Q9BWX1, A0A024R336, H7C4N0, H7C5Q8

UniProt curated annotations — full annotation on UniProt →

Function. E3 ubiquitin-protein ligase which ubiquitinates histone H3 at ‘Lys-14’. Required for male fertility, via inhibition of SPOP-mediated BRDT degradation when in the presence of acetylated histone H4 in early condensing spermatids. Stabilization of BRDT allows it to facilitate histone removal in early condensing spermatids and promote the progression of histone-to-protamine exchange. Promotes the expression of steroidogenesis proteins in the testes, and as a result plays a role in maintaining testosterone levels and repressing osteoclastogenesis. Promotes transcription of cardiac enhancer genes by facilitating binding of cardiac transcription factors such as MEF2C and GATA4 to target gene promoters. Ubiquitinates histone H4. Ubiquitinates histone H2A and H3 as part of the nucleosome core particle.

Subunit / interactions. Interacts with MEF2C; the interaction promotes MEF2C binding to its transcription targets. Interacts with GATA4; the interaction promotes GATA4 binding to its transcription targets. Interacts with UBE2D2; the interaction inhibits cleavage of PHF7 and promotes association of the complex with the nucleosome core particle.

Subcellular location. Nucleus.

Tissue specificity. Highly expressed in Sertoli cells, but not in germ cells in adult testis. Expression in embryonic testis is 30-times lower. Highly expressed in colon, spleen, white blood cells, pancreas, lung, liver, placenta and brain. Detected at lower levels in thymus, small intestine, ovary and kidney.

Domain organisation. The extended PHD (ePHD) domain is required for interaction with the nucleosome core particle via binding to DNA. The C-terminal PHD domain is required for histone H3 substrate binding. The RING, Linker and PHD domains act as a combined interaction interface for UBE2D2.

Pathway. Protein modification; protein ubiquitination.

Isoforms (2)

UniProt ID	Names	Canonical?
Q9BWX1-1	1	yes
Q9BWX1-2	2

RefSeq proteins (4): NP_001265150, NP_001308055, NP_001308056, NP_057567* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR001841	Znf_RING	Domain
IPR001965	Znf_PHD	Domain
IPR011011	Znf_FYVE_PHD	Homologous_superfamily
IPR013083	Znf_RING/FYVE/PHD	Homologous_superfamily
IPR034732	EPHD	Domain
IPR042013	PHF7/G2E3_ePHD	Domain
IPR051188	PHD-type_Zinc_Finger	Family
IPR059102	PHD_PHF7/G2E3-like	Domain

Pfam: PF13771, PF26054

UniProt features (46 total): binding site 28, mutagenesis site 7, region of interest 4, zinc finger region 3, chain 1, site 1, splice variant 1, sequence variant 1

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q9BWX1-F1	76.11	0.60

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Catalytic / active sites (1): 149–150 (cleavage)

Ligand- & substrate-binding residues (28): 58; 61; 98; 101; 110; 115; 120; 123; 141; 144; 160; 163 …

Mutagenesis-validated functional residues (7):

Position	Phenotype
119	reduces ubiquitination of histone h3.
126	no effect on ubiquitination of histone h3.
133	reduces ubiquitination of histone h3.
140	no effect on ubiquitination of histone h3.
140	reduces ubiquitination of histone h3.
160	abolishes ubiquitination of histone h3.
186	abolishes ubiquitination of histone h3.

Function

Pathways and Gene Ontology

Reactome pathways

0 pathways

MSigDB gene sets: 114 (showing top): GSE45365_CD8A_DC_VS_CD11B_DC_IFNAR_KO_MCMV_INFECTION_UP, GOBP_REGULATION_OF_LEUKOCYTE_PROLIFERATION, GOBP_NEGATIVE_REGULATION_OF_LEUKOCYTE_PROLIFERATION, CMYB_01, CAGCTG_AP4_Q5, CHANG_IMMORTALIZED_BY_HPV31_DN, GOBP_LEUKOCYTE_PROLIFERATION, GNF2_CCNA1, MYB_Q3, WEBER_METHYLATED_HCP_IN_SPERM_UP, CP2_01, GOCC_NUCLEAR_SPECK, GOCC_NUCLEAR_BODY, GOCC_RIBONUCLEOPROTEIN_GRANULE, GOMF_ACYLTRANSFERASE_ACTIVITY

GO Biological Process (1): negative regulation of osteoclast proliferation (GO:0090291)

GO Molecular Function (5): zinc ion binding (GO:0008270), ubiquitin protein ligase activity (GO:0061630), protein binding (GO:0005515), transferase activity (GO:0016740), metal ion binding (GO:0046872)

GO Cellular Component (6): nucleus (GO:0005634), nucleoplasm (GO:0005654), Golgi apparatus (GO:0005794), cytosol (GO:0005829), plasma membrane (GO:0005886), nuclear speck (GO:0016607)

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
intracellular membrane-bounded organelle	2
cellular anatomical structure	2
cytoplasm	2
osteoclast proliferation	1
negative regulation of leukocyte proliferation	1
regulation of osteoclast proliferation	1
transition metal ion binding	1
ubiquitin-protein transferase activity	1
ubiquitin-like protein ligase activity	1
binding	1
catalytic activity	1
cation binding	1
nuclear lumen	1
endomembrane system	1
membrane	1
cell periphery	1
nuclear ribonucleoprotein granule	1

Protein interactions and networks

STRING

1556 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
PHF7	H3-4	Q16695	626
PHF7	H3-3A	P06351	625
PHF7	H3C1	P02295	625
PHF7	H3-7	Q5TEC6	625
PHF7	H3-5	Q6NXT2	625
PHF7	H3C14	Q71DI3	625
PHF7	MAGEF1	Q9HAY2	508
PHF7	TCP11	Q8WWU5	474
PHF7	YIF1A	O95070	446
PHF7	PLAAT5	Q96KN8	425
PHF7	KLHDC3	Q9BQ90	422
PHF7	CFAP276	Q5T5A4	418
PHF7	CRISP2	P16562	413
PHF7	SHISA4	Q96DD7	408
PHF7	SH3GL2	Q99962	408

IntAct

30 interactions, top by confidence:

A	B	Type	Score
PHF7	UBE2D4	psi-mi:“MI:0915”(physical association)	0.560
UBE2D4	PHF7	psi-mi:“MI:0915”(physical association)	0.560
UBE2D2	PHF7	psi-mi:“MI:0915”(physical association)	0.560
PHF7		psi-mi:“MI:0915”(physical association)	0.560
PHF7	GRN	psi-mi:“MI:0915”(physical association)	0.560
PHF7	SPRED1	psi-mi:“MI:0915”(physical association)	0.560
SRPK1	PHF7	psi-mi:“MI:0217”(phosphorylation reaction)	0.440
PHF7	TRIM41	psi-mi:“MI:0915”(physical association)	0.370
PHF7	MDM2	psi-mi:“MI:0915”(physical association)	0.370
TRIM26	PHF7	psi-mi:“MI:0915”(physical association)	0.370
RNF14	PHF7	psi-mi:“MI:0915”(physical association)	0.370
ARIH2	PHF7	psi-mi:“MI:0915”(physical association)	0.370
PHF7	RNF111	psi-mi:“MI:0915”(physical association)	0.370
PHF7	RNF34	psi-mi:“MI:0915”(physical association)	0.370
PHF7	DTX3L	psi-mi:“MI:0915”(physical association)	0.370
PHF7	PPP1R12A	psi-mi:“MI:0914”(association)	0.350
PHF7	CREB1	psi-mi:“MI:0914”(association)	0.350
UBE2D2	PHF7	psi-mi:“MI:0915”(physical association)	0.000
PHF7	IKBKG	psi-mi:“MI:0407”(direct interaction)	0.000

BioGRID (40): UBE2D4 (Two-hybrid), USP7 (Affinity Capture-MS), MICA (Affinity Capture-MS), TCEAL1 (Affinity Capture-MS), PPP1R12A (Affinity Capture-MS), ADNP (Affinity Capture-MS), PHF7 (Reconstituted Complex), PHF7 (Synthetic Lethality), PHF7 (Two-hybrid), PPP1R12A (Affinity Capture-MS), MICA (Affinity Capture-MS), TCEAL1 (Affinity Capture-MS), USP7 (Affinity Capture-MS), IDE (Affinity Capture-MS), UBE2D2 (Two-hybrid)

ESM2 similar proteins: A0A0G2JXT6, A0A1B0GW35, A6H5X4, B9EK06, F4I7Y2, F6QZ15, J9SQF3, O35309, O82617, O88509, O95789, P0CL83, P0DOY1, P35125, P83946, P86265, Q02395, Q10NJ6, Q13287, Q1L721, Q1LZ50, Q2RBJ4, Q3SZ89, Q3ZCL3, Q4R6N0, Q53H64, Q569R5, Q5E9T7, Q5F476, Q5H9U9, Q5I0J8, Q5R7T9, Q6AXW4, Q7X7E9, Q7Z569, Q8BVM9, Q8L7A4, Q8TBR4, Q99388, Q9BWX1

Diamond homologs: A6H5X4, F4I443, Q08DR0, Q2HJ93, Q4R9C4, Q5F4A1, Q5I0E2, Q5I0J8, Q5R5Z2, Q5RJY2, Q61818, Q6AXW4, Q7L622, Q7Z5J4, Q8BVM9, Q8IWS0, Q9BWX1, Q9D4J7, Q9DAG9, Q9UIL8, O08550, P55200, Q03164, Q24742, Q8BRH4, Q8NEZ4, Q9UMN6, Q6PDK2, Q9EPQ8, Q9UGU0, Q9VKW2, O14686, P20659

SIGNOR signaling

2 interactions.

A	Effect	B	Mechanism
PHF7	“form complex”	SMARCD3	binding
Ub:E2	“up-regulates activity”	PHF7	ubiquitination

Enriched among interaction partners

Reactome pathways and GO biological processes over-represented among this gene’s 16 IntAct physical interaction partners (hypergeometric vs the genome-wide background, BH-FDR, gene-set size 15–500, ranked by fold). A functional readout of the neighbourhood — distinct from this gene’s own memberships above, and biased toward well-studied / hub proteins, so read it as themes rather than proof.

Reactome pathways:

Pathway	Partners	Fold	FDR
Class I MHC mediated antigen processing & presentation	5	21.9×	2e-04
Antigen processing: Ubiquitination & Proteasome degradation	8	18.6×	5e-07
Adaptive Immune System	5	9.3×	9e-03

GO biological processes:

GO term	Partners	Fold	FDR
protein K48-linked ubiquitination	5	52.7×	2e-06
ubiquitin-dependent protein catabolic process	8	37.1×	3e-09
protein ubiquitination	8	20.7×	1e-07

Disease & clinical

Clinical variants and AI predictions

ClinVar

53 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	38
Likely benign	2
Benign	4

Top pathogenic / likely-pathogenic (0)

SpliceAI

1923 predictions. Top by Δscore:

Variant	Effect	Δscore
3:52422337:GG:G	donor_gain	1.0000
3:52422338:GG:G	donor_gain	1.0000
3:52421646:A:AG	acceptor_gain	0.9900
3:52421647:G:GG	acceptor_gain	0.9900
3:52421647:GAA:G	acceptor_gain	0.9900
3:52421647:GAAAT:G	acceptor_gain	0.9900
3:52421726:C:G	donor_gain	0.9900
3:52422331:G:GT	donor_gain	0.9900
3:52423089:A:AG	acceptor_gain	0.9900
3:52423090:G:GG	acceptor_gain	0.9900
3:52410740:G:GG	donor_gain	0.9800
3:52410968:A:G	donor_gain	0.9800
3:52411237:G:GT	donor_gain	0.9800
3:52420427:A:T	donor_gain	0.9800
3:52421642:TTACA:T	acceptor_loss	0.9800
3:52421643:TACA:T	acceptor_loss	0.9800
3:52421644:ACAG:A	acceptor_loss	0.9800
3:52421645:CAGAA:C	acceptor_loss	0.9800
3:52421646:A:T	acceptor_loss	0.9800
3:52421647:G:GT	acceptor_loss	0.9800
3:52421750:GACAG:G	donor_gain	0.9800
3:52423085:CACCA:C	acceptor_loss	0.9800
3:52423086:ACCAG:A	acceptor_loss	0.9800
3:52423087:CCAGA:C	acceptor_loss	0.9800
3:52423088:CAG:C	acceptor_loss	0.9800
3:52423089:A:C	acceptor_loss	0.9800
3:52423090:G:A	acceptor_loss	0.9800
3:52411208:A:T	donor_gain	0.9700
3:52411394:G:GT	donor_gain	0.9700
3:52423090:GA:G	acceptor_gain	0.9700

AlphaMissense

2542 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
3:52422232:T:A	W231R	1.000
3:52422232:T:C	W231R	1.000
3:52422234:G:C	W231C	1.000
3:52422234:G:T	W231C	1.000
3:52419887:T:C	F81L	0.999
3:52419889:T:A	F81L	0.999
3:52419889:T:G	F81L	0.999
3:52421736:G:A	G221E	0.999
3:52422253:T:C	F238L	0.999
3:52422255:C:A	F238L	0.999
3:52422255:C:G	F238L	0.999
3:52420419:T:C	F133L	0.998
3:52420421:T:A	F133L	0.998
3:52420421:T:G	F133L	0.998
3:52421655:C:A	A194D	0.998
3:52421684:T:C	C204R	0.998
3:52421693:T:A	C207S	0.998
3:52421694:G:C	C207S	0.998
3:52421711:T:C	F213L	0.998
3:52421712:T:G	F213C	0.998
3:52421713:T:A	F213L	0.998
3:52421713:T:G	F213L	0.998
3:52421735:G:A	G221R	0.998
3:52421735:G:C	G221R	0.998
3:52421736:G:T	G221V	0.998
3:52414582:T:C	C61R	0.997
3:52421712:T:C	F213S	0.997
3:52422227:C:A	A229D	0.997
3:52422233:G:C	W231S	0.997
3:52419888:T:C	F81S	0.996

dbSNP variants (sampled 300 via entrez): RS1000004251 (3:52414718 C>A), RS1000182619 (3:52420194 C>G,T), RS1000889665 (3:52420913 G>A), RS1001003121 (3:52414999 A>C), RS1001357740 (3:52419700 G>A), RS1001390247 (3:52419564 G>T), RS1001711910 (3:52409932 TGCCCCCACCGGGA>T,TGCCCCCACCGGGAGCCCCCACCGGGA), RS1002311882 (3:52421866 A>C,G), RS1002361554 (3:52421396 C>G), RS1002512500 (3:52416509 G>A), RS1002612084 (3:52410020 C>G,T), RS1003000605 (3:52410715 G>A), RS1003021301 (3:52410304 G>A,C), RS1003027985 (3:52418352 T>C), RS1003058207 (3:52416904 A>G)

Disease associations

OMIM: gene MIM:620057 | disease phenotypes: MIM:614327, MIM:619762

GenCC curated gene-disease

Mondo (3): BAP1-related tumor predisposition syndrome (MONDO:0013692), hereditary neoplastic syndrome (MONDO:0015356), Kury-Isidor syndrome (MONDO:0859230)

Orphanet (2): Inherited cancer-predisposing syndrome (Orphanet:140162), BAP1-related tumor predisposition syndrome (Orphanet:289539)

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

6 associations (top):

Study	Trait	p-value
GCST001241_15	Bipolar disorder	2.000000e-06
GCST002149_14	Schizophrenia	1.000000e-08
GCST004521_123	Autism spectrum disorder or schizophrenia	3.000000e-12
GCST004521_201	Autism spectrum disorder or schizophrenia	4.000000e-08
GCST004902_20	Parkinson’s disease	3.000000e-08
GCST010173_17	Triglyceride levels	5.000000e-22

EFO canonical traits (1, from GWAS)

EFO ID	Trait name
EFO:0004530	triglyceride measurement

MeSH disease descriptors (1)

Descriptor	Name	Tree numbers
D009386	Neoplastic Syndromes, Hereditary	C04.700; C16.320.700

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

19 total (human), top 19 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
sodium arsenite	decreases expression, increases expression	3
Nickel	decreases expression	2
GSK-J4	decreases expression	1
pentanal	decreases expression	1
di-n-butylphosphoric acid	affects expression	1
CGP 52608	affects binding, increases reaction	1
2-palmitoylglycerol	increases expression	1
abrine	decreases expression	1
jinfukang	affects cotreatment, increases expression	1
Resveratrol	affects cotreatment, increases expression	1
Acetaminophen	increases expression	1
Cisplatin	affects cotreatment, increases expression	1
Ketoconazole	increases expression	1
Naled	affects expression	1
Plant Extracts	affects cotreatment, increases expression	1
Tobacco Smoke Pollution	decreases expression	1
Aflatoxin B1	increases methylation	1
Zinc Sulfate	decreases expression	1
Okadaic Acid	decreases expression	1

Clinical trials (associated diseases)

32 trials via MONDO — disease-level, not drug-specific.

Trial	Phase	Status	Title
NCT03050268	Not specified	RECRUITING	Familial Investigations of Childhood Cancer Predisposition
NCT04431024	Not specified	RECRUITING	Prospective Evaluation of High Resolution Dual Energy Computed Tomographic Imaging, Noninvasive (Liquid) Biopsies, and Minimally Invasive Surgical Surveillance for Early Detection of Mesotheliomas in Patients With BAP1 Tumor Predisposition Syndrome
NCT05534854	Not specified	UNKNOWN	Frequency, Clinical Phenotype and Genetic Analysis of Heritable Kidney Cancer Syndromes
NCT00001496	Not specified	COMPLETED	Establishment of Normal Breast Epithelial Cell Lines From Patients at High Risk for Breast Cancer
NCT00001898	Not specified	COMPLETED	Microarray Analysis for Human Genetic Disease
NCT00026884	Not specified	RECRUITING	Collection of Serum and Tissue Samples From Patients With Biopsy-Proved or Suspected Malignant Disease
NCT02289326	Not specified	COMPLETED	Biomarker Monitoring in TP53 Mutation Carriers
NCT02958462	Not specified	RECRUITING	Pre-myeloid Cancer and Bone Marrow Failure Clinic Study
NCT03160274	Not specified	RECRUITING	Genetic Analysis of Pheochromocytomas, Paragangliomas and Associated Conditions
NCT03426878	Not specified	COMPLETED	Cancer Health Assessments Reaching Many
NCT03857594	Not specified	ACTIVE_NOT_RECRUITING	Integrative Sequencing In Germline and Hereditary Tumours
NCT03973450	Not specified	UNKNOWN	Epidemiology of Pituitary Tumours: Prevalence of Associated Neoplasia
NCT03979612	Not specified	UNKNOWN	Evaluation of the Adhesion to the GENEPY Network
NCT04261972	Not specified	ACTIVE_NOT_RECRUITING	Cell-free DNA in Hereditary And High-Risk Malignancies 1
NCT04494945	Not specified	RECRUITING	Identifying and Caring for Individuals With Inherited Cancer Syndrome
NCT04541654	Not specified	RECRUITING	Li-Fraumeni & TP53 (LiFT UP): Understanding and Progress
NCT04763915	Not specified	ACTIVE_NOT_RECRUITING	Improving Care After Inherited Cancer Testing
NCT05562778	Not specified	RECRUITING	Chatbot to Maximize Hereditary Cancer Genetic Risk Assessment
NCT05664867	Not specified	RECRUITING	Implementation of Population Cancer Genetic Services in Federally Qualified Health Centers (FQHC)
NCT05721326	Not specified	COMPLETED	Sequential EHR Based Interventions to Increase Genetic Testing for Breast and Ovarian Cancer Predisposition
NCT06096688	Not specified	RECRUITING	Discovering New Targets for Colorectal and Endometrial Cancer Risk Reduction
NCT06654466	Not specified	RECRUITING	Closing the GAPS: Guideline Adherence, Prevention and Surveillance in Hereditary Cancer
NCT06708429	Not specified	RECRUITING	Lynch Syndrome X-Talk of Enteral Mucosa With Immune System
NCT06726642	Not specified	RECRUITING	CfDNA in Hereditary And High-risk Malignancies 2
NCT06914726	Not specified	ENROLLING_BY_INVITATION	Patient Centered Clinical Decision Support for Hereditary Cancer Syndromes
NCT06927947	Not specified	RECRUITING	Navigation Interventions to Improve Cascade Genetic Testing Among Relatives of Patients With Hereditary Cancer Syndromes
NCT06999954	Not specified	RECRUITING	Shwachman-Diamond Syndrome Global Patient Survey and Partnering Platform
NCT07052266	Not specified	RECRUITING	Trial of Combined Obstetric Carrier Screening and Hereditary Cancer Screening
NCT07195071	Not specified	RECRUITING	Feasibility Trial of Combination of Obstetrical Carrier Screening and Hereditary Cancer Screening
NCT07378423	Not specified	RECRUITING	Questionnaire on Congenital Cancer Signs Through Self-Assessment
NCT07381985	Not specified	ENROLLING_BY_INVITATION	Strategy for Management of Patients With Hereditary Cancer Syndromes (HCS) in a Rural Environment
NCT07542405	Not specified	NOT_YET_RECRUITING	A Web-Based Program (Kindred) to Improve the Understanding of Genetic Cancer Risk and Cancer Genetic Testing in African American Families