PHLDB3

Summary

PHLDB3 (pleckstrin homology like domain family B member 3, HGNC:30499) is a protein-coding gene on chromosome 19q13.31, encoding Pleckstrin homology-like domain family B member 3 (Q6NSJ2).

Enables enzyme binding activity.

Source: NCBI Gene 653583 — RefSeq curated summary.

At a glance

• Clinical variants (ClinVar): 171 total
• MANE Select transcript: NM_198850

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:30499
Approved symbol	PHLDB3
Name	pleckstrin homology like domain family B member 3
Location	19q13.31
Locus type	gene with protein product
Status	Approved
Aliases	FLJ40193
Ensembl gene	ENSG00000176531
Ensembl biotype	protein_coding
OMIM	621041
Entrez	653583

Gene structure

Transcript identifiers

Ensembl transcripts: 12 — 8 protein_coding, 3 retained_intron, 1 nonsense_mediated_decay

ENST00000292140, ENST00000595498, ENST00000596141, ENST00000596902, ENST00000598849, ENST00000599242, ENST00000600660, ENST00000601646, ENST00000905838, ENST00000905839, ENST00000934851, ENST00000959614

RefSeq mRNA: 1 — MANE Select: NM_198850 NM_198850

CCDS: CCDS12621

Canonical transcript exons

ENST00000292140 — 16 exons

Exon	Start	End
ENSE00001053622	43479377	43479593
ENSE00001161631	43475103	43475544
ENSE00003069387	43494702	43494815
ENSE00003530467	43503906	43504132
ENSE00003575684	43487024	43487123
ENSE00003616561	43478047	43478132
ENSE00003935758	43504589	43504746
ENSE00004282199	43495495	43495620
ENSE00004282201	43486780	43486870
ENSE00004282203	43486266	43486322
ENSE00004282204	43497748	43497876
ENSE00004282205	43501734	43501871
ENSE00004282207	43486609	43486696
ENSE00004282208	43497118	43497279
ENSE00004282209	43495256	43495339
ENSE00004282210	43502101	43502283

Expression profiles

Bgee: expression breadth ubiquitous, 189 present calls, max score 96.93.

FANTOM5 (CAGE): breadth broad, TPM avg 2.3517 / max 41.8655, expressed in 666 samples.

FANTOM5 promoters (6 alternative TSS)

Promoter ID	TPM avg	Samples expressed
181280	1.1477	360
181281	0.7191	355
181279	0.4063	170
181278	0.0308	4
208852	0.0245	8
181277	0.0233	4

Top tissues by expression

237 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
lower esophagus mucosa	UBERON:0035834	96.93	gold quality
skin of leg	UBERON:0001511	93.41	gold quality
skin of abdomen	UBERON:0001416	92.89	gold quality
esophagus mucosa	UBERON:0002469	92.52	gold quality
zone of skin	UBERON:0000014	90.97	gold quality
sural nerve	UBERON:0015488	89.28	gold quality
left testis	UBERON:0004533	89.21	gold quality
mucosa of transverse colon	UBERON:0004991	89.01	gold quality
right testis	UBERON:0004534	88.41	gold quality
right lobe of liver	UBERON:0001114	87.35	gold quality
olfactory segment of nasal mucosa	UBERON:0005386	86.90	gold quality
testis	UBERON:0000473	86.10	gold quality
esophagus	UBERON:0001043	85.45	gold quality
ectocervix	UBERON:0012249	85.38	gold quality
minor salivary gland	UBERON:0001830	84.75	gold quality
left ovary	UBERON:0002119	84.46	gold quality
mouth mucosa	UBERON:0003729	84.41	gold quality
adenohypophysis	UBERON:0002196	84.38	gold quality
oral cavity	UBERON:0000167	83.99	gold quality
gingival epithelium	UBERON:0001949	83.66	silver quality
gingiva	UBERON:0001828	83.12	gold quality
left adrenal gland cortex	UBERON:0035825	82.93	gold quality
granulocyte	CL:0000094	82.33	gold quality
right ovary	UBERON:0002118	82.26	gold quality
vagina	UBERON:0000996	82.18	gold quality
pituitary gland	UBERON:0000007	82.16	gold quality
left adrenal gland	UBERON:0001234	81.90	gold quality
right adrenal gland cortex	UBERON:0035827	81.66	gold quality
amniotic fluid	UBERON:0000173	81.54	gold quality
adrenal cortex	UBERON:0001235	80.97	gold quality

Single-cell (SCXA)

Detected in 1 experiment(s), a significant marker in 1.

Experiment	Marker?	Max mean expression
E-ANND-3	yes	5.00

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

15 targeting PHLDB3, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-29A-3P	100.00	73.11	1835
HSA-MIR-29B-3P	100.00	73.18	1833
HSA-MIR-29C-3P	100.00	73.15	1833
HSA-MIR-95-5P	99.89	72.17	3973
HSA-MIR-3663-3P	99.84	70.39	798
HSA-MIR-3121-3P	99.82	71.96	3630
HSA-MIR-6749-3P	99.00	65.73	1443
HSA-MIR-4691-5P	98.41	66.77	1343
HSA-MIR-6792-3P	98.41	66.86	1359
HSA-MIR-1972	97.67	67.38	1172
HSA-MIR-6787-5P	97.54	63.85	457
HSA-MIR-10396B-5P	94.99	63.57	358
HSA-MIR-1908-5P	94.99	63.41	352
HSA-MIR-663A	94.99	63.54	378
HSA-MIR-7108-3P	94.37	64.79	183

Literature-anchored findings (GeneRIF, showing 1)

• PHLDB3 promotes tumour growth by inactivating p53 in a negative feedback fashion. (PMID:28008906)

Cross-species orthologs

4 orthologs

Organism	Symbol	Gene ID
mus_musculus	Phldb3	ENSMUSG00000074277
rattus_norvegicus	Phldb3	ENSRNOG00000055259
drosophila_melanogaster	dos	FBGN0016794
caenorhabditis_elegans		WBGENE00004928

Paralogs (7): PHLDB1 (ENSG00000019144), GAB2 (ENSG00000033327), GAB1 (ENSG00000109458), PHLDB2 (ENSG00000144824), PLEKHS1 (ENSG00000148735), GAB3 (ENSG00000160219), GAB4 (ENSG00000215568)

Protein

Protein identifiers

Pleckstrin homology-like domain family B member 3 — Q6NSJ2 (reviewed: Q6NSJ2)

All UniProt accessions (4): Q6NSJ2, M0QXT7, M0R038, M0R353

UniProt curated annotations — full annotation on UniProt →

Domain organisation. The PH domain mediates the binding to phosphoinositides.

Isoforms (2)

UniProt ID	Names	Canonical?
Q6NSJ2-1	1	yes
Q6NSJ2-2	2

RefSeq proteins (1): NP_942147* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR001849	PH_domain	Domain
IPR011993	PH-like_dom_sf	Homologous_superfamily
IPR037810	PHLDB1/2/3_PH	Domain
IPR052212	PH-like_domain	Family

Pfam: PF00169

UniProt features (15 total): region of interest 5, compositionally biased region 3, splice variant 2, coiled-coil region 2, chain 1, domain 1, sequence variant 1

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q6NSJ2-F1	70.64	0.37

Function

Pathways and Gene Ontology

Reactome pathways

0 pathways

MSigDB gene sets: 51 (showing top): GCANCTGNY_MYOD_Q6, GGGTGGRR_PAX4_03, AP1_Q4_01, MYOD_01, TGANTCA_AP1_C, NRF2_01, CP2_01, SCGGAAGY_ELK1_02, MGGAAGTG_GABP_B, MZF1_02, HNF4ALPHA_Q6, SREBP1_Q6, WARTERS_IR_RESPONSE_5GY, ZWANG_TRANSIENTLY_UP_BY_2ND_EGF_PULSE_ONLY, NFKBIA_TARGET_GENES

GO Biological Process (0):

GO Molecular Function (2): enzyme binding (GO:0019899), protein binding (GO:0005515)

GO Cellular Component (0):

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
protein binding	1
binding	1

Protein interactions and networks

STRING

310 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
PHLDB3	ETHE1	O95571	646
PHLDB3	TEX101	Q9BY14	623
PHLDB3	ZNF575	Q86XF7	617
PHLDB3	LYPD3	O95274	536
PHLDB3	RAB30	Q15771	517
PHLDB3	LYSMD1	Q96S90	513
PHLDB3	SCNM1	Q9BWG6	445
PHLDB3	TTC12	Q9H892	396
PHLDB3	LYPD5	Q6UWN5	389
PHLDB3	ANKRD49	Q8WVL7	387
PHLDB3	PINLYP	A6NC86	384
PHLDB3	TCEAL4	Q96EI5	379
PHLDB3	CABP5	Q9NP86	374
PHLDB3	ZSWIM9	Q86XI8	371
PHLDB3	ZFP62	Q8NB50	369

IntAct

93 interactions, top by confidence:

A	B	Type	Score
KBTBD7	METTL15	psi-mi:“MI:0914”(association)	0.730
GPR156	PLD2	psi-mi:“MI:0914”(association)	0.640
CRHBP	CCNB2	psi-mi:“MI:0914”(association)	0.640
RALBP1	JUN	psi-mi:“MI:0914”(association)	0.640
IL13RA2	METTL15	psi-mi:“MI:0914”(association)	0.530
RAB30	UBB	psi-mi:“MI:0914”(association)	0.530
PHLDB3		psi-mi:“MI:0915”(physical association)	0.370
	PHLDB3	psi-mi:“MI:0915”(physical association)	0.370
RIPK4	VWA8	psi-mi:“MI:0914”(association)	0.350
PB2	IPO5	psi-mi:“MI:0914”(association)	0.350
MBIP	CIBAR1	psi-mi:“MI:0914”(association)	0.350
CDC16	KRBA1	psi-mi:“MI:0914”(association)	0.350
SKAP1	MYO9A	psi-mi:“MI:0914”(association)	0.350
CNKSR1	TRIM24	psi-mi:“MI:0914”(association)	0.350
TMEM52B	PIK3R2	psi-mi:“MI:0914”(association)	0.350
MIER2	AGAP1	psi-mi:“MI:0914”(association)	0.350
KLHL2	DCTN6	psi-mi:“MI:0914”(association)	0.350
TNFRSF19	NOP56	psi-mi:“MI:0914”(association)	0.350
RALBP1	AP2A1	psi-mi:“MI:0914”(association)	0.350
RALBP1	ABLIM1	psi-mi:“MI:0914”(association)	0.350
KRT2	IFT56	psi-mi:“MI:0914”(association)	0.350
CDC16	IFT56	psi-mi:“MI:0914”(association)	0.350
CCDC85A	CIBAR1	psi-mi:“MI:0914”(association)	0.350
SPANXN2	ZNF320	psi-mi:“MI:0914”(association)	0.350

BioGRID (110): PHLDB3 (Affinity Capture-MS), PHLDB3 (Affinity Capture-MS), PHLDB3 (Affinity Capture-MS), PHLDB3 (Affinity Capture-MS), PHLDB3 (Affinity Capture-MS), PHLDB3 (Affinity Capture-MS), PHLDB3 (Affinity Capture-MS), PHLDB3 (Affinity Capture-MS), PHLDB3 (Proximity Label-MS), PHLDB3 (Affinity Capture-MS), PHLDB3 (Affinity Capture-MS), MDM2 (Affinity Capture-Western), PHLDB3 (Affinity Capture-Western), PHLDB3 (Reconstituted Complex), PHLDB3 (Affinity Capture-MS)

ESM2 similar proteins: A0A140LIT1, A0A1B0GVG4, A0JNH6, A1A5D9, A6NC98, A6NGB0, A6NJZ7, A6NNM3, F6XLV1, O15049, O54887, P0C7N4, P58660, P60531, Q0D2H9, Q0P5D1, Q2KJ21, Q2TAC2, Q3LUD3, Q3T1I3, Q3TMW1, Q3V0F0, Q4QRL3, Q5JTB6, Q5RD60, Q66HR5, Q6NSJ2, Q6PHN1, Q6QZQ4, Q80VM7, Q8BP01, Q8C7U1, Q8CB62, Q8CGU1, Q8CHW5, Q8K2I2, Q8N137, Q8N283, Q8N6Y0, Q8R370

Diamond homologs: E9PXF8, O95248, P54644, Q63312, Q6NSJ2, Q6NTN5, Q6PDH0, Q6ZPE2, Q86IV4, Q86SQ0, Q86UU1, Q86WG5, Q8BSM5, Q8K1N2, Q8WWW8, Q9W5D0, B1AVY7, O35889, Q80TF6, Q96L93, Q9EQW7, Q9H1H9, Q9NQT8, Q9P2P6, Q9QZQ1, A8JQ65, B4I4Y1, B4PRE2, B4R0A5, B6RSP1, D3YXJ0, D3ZL52, O08967, O43739, P63034, P63035, P97694, P97696, Q15438, Q1ZXH8

SIGNOR signaling

0 interactions.

Enriched among interaction partners

Reactome pathways and GO biological processes over-represented among this gene’s 104 IntAct physical interaction partners (hypergeometric vs the genome-wide background, BH-FDR, gene-set size 15–500, ranked by fold). A functional readout of the neighbourhood — distinct from this gene’s own memberships above, and biased toward well-studied / hub proteins, so read it as themes rather than proof.

GO biological processes:

GO term	Partners	Fold	FDR
endocytic recycling	5	14.5×	8e-03

Disease & clinical

Clinical variants and AI predictions

ClinVar

171 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	136
Likely benign	6
Benign	4

Top pathogenic / likely-pathogenic (0)

SpliceAI

2121 predictions. Top by Δscore:

Variant	Effect	Δscore
19:43475541:GGCTC:G	acceptor_loss	1.0000
19:43475542:GCTC:G	acceptor_loss	1.0000
19:43475543:CT:C	acceptor_gain	1.0000
19:43475544:TC:T	acceptor_loss	1.0000
19:43475545:C:CA	acceptor_loss	1.0000
19:43475545:C:CC	acceptor_gain	1.0000
19:43478081:T:TA	donor_gain	1.0000
19:43478133:C:CC	acceptor_gain	1.0000
19:43486692:CACAG:C	acceptor_gain	1.0000
19:43486693:ACAG:A	acceptor_gain	1.0000
19:43486694:CAG:C	acceptor_gain	1.0000
19:43486694:CAGC:C	acceptor_gain	1.0000
19:43486695:AG:A	acceptor_gain	1.0000
19:43486695:AGC:A	acceptor_loss	1.0000
19:43486696:GC:G	acceptor_loss	1.0000
19:43486697:C:CC	acceptor_gain	1.0000
19:43494769:T:TA	donor_gain	1.0000
19:43495490:CTCA:C	donor_loss	1.0000
19:43495491:TCACC:T	donor_loss	1.0000
19:43495492:CA:C	donor_loss	1.0000
19:43495493:A:AT	donor_loss	1.0000
19:43495494:C:A	donor_loss	1.0000
19:43497114:TCA:T	donor_loss	1.0000
19:43497116:A:AC	donor_gain	1.0000
19:43497116:ACT:A	donor_gain	1.0000
19:43497117:C:CT	donor_gain	1.0000
19:43497117:CT:C	donor_gain	1.0000
19:43497117:CTC:C	donor_gain	1.0000
19:43497117:CTCT:C	donor_gain	1.0000
19:43497275:CTCAT:C	acceptor_gain	1.0000

AlphaMissense

4110 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
19:43475457:A:G	W626R	0.999
19:43475457:A:T	W626R	0.999
19:43475516:A:T	V606D	0.999
19:43479418:A:G	F554S	0.999
19:43479434:A:G	W549R	0.999
19:43479434:A:T	W549R	0.999
19:43475513:T:A	K607I	0.998
19:43475521:G:C	F604L	0.998
19:43475521:G:T	F604L	0.998
19:43475522:A:G	F604S	0.998
19:43475523:A:G	F604L	0.998
19:43479432:C:A	W549C	0.998
19:43479432:C:G	W549C	0.998
19:43479456:C:A	K541N	0.998
19:43479456:C:G	K541N	0.998
19:43475494:G:C	F613L	0.997
19:43475494:G:T	F613L	0.997
19:43475496:A:G	F613L	0.997
19:43475512:T:A	K607N	0.997
19:43475512:T:G	K607N	0.997
19:43478087:A:T	I583N	0.997
19:43478111:T:A	K575I	0.997
19:43479386:A:C	Y565D	0.997
19:43479391:A:G	L563S	0.997
19:43479417:G:C	F554L	0.997
19:43479417:G:T	F554L	0.997
19:43479419:A:G	F554L	0.997
19:43479438:C:A	K547N	0.997
19:43479438:C:G	K547N	0.997
19:43497229:G:C	F238L	0.997

dbSNP variants (sampled 300 via entrez): RS1000099097 (19:43484847 CCAATGCCCTAGAATTATTCTTATAATTCTAG>C), RS1000158147 (19:43504193 C>A,T), RS1000188780 (19:43485026 A>G), RS1000580805 (19:43498314 G>A,T), RS1000729823 (19:43504328 A>G), RS1000762629 (19:43504180 G>A,C,T), RS1000953062 (19:43498470 AAG>A), RS1000993444 (19:43492763 A>G), RS1001010634 (19:43486801 A>G), RS1001090450 (19:43502309 G>A), RS1001104943 (19:43492441 C>G), RS1001111332 (19:43502798 T>C), RS1001179291 (19:43475484 C>A,G,T), RS1001234271 (19:43483480 T>C), RS1001333663 (19:43496311 G>A)

Disease associations

OMIM: gene MIM:621041 | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

0 associations (top):

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

33 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
sodium arsenite	affects cotreatment, decreases expression, increases abundance, increases expression	3
Aflatoxin B1	decreases methylation, increases expression	3
aristolochic acid I	increases expression	1
GSK-J4	decreases expression	1
FR900359	decreases phosphorylation	1
bisphenol F	affects cotreatment, decreases expression	1
bisphenol A	affects cotreatment, decreases methylation	1
arsenite	increases reaction, affects binding	1
tris(1,3-dichloro-2-propyl)phosphate	increases expression	1
benzo(e)pyrene	decreases methylation	1
aflatoxin B2	decreases methylation	1
entinostat	increases expression	1
K 7174	increases expression	1
abrine	increases expression	1
Sunitinib	decreases expression	1
Fulvestrant	affects cotreatment, decreases methylation	1
Arsenic	increases abundance, affects cotreatment, decreases expression	1
Caffeine	decreases phosphorylation	1
Dexamethasone	affects cotreatment, decreases expression	1
Ethyl Methanesulfonate	increases expression	1
Formaldehyde	increases expression	1
Indomethacin	affects cotreatment, decreases expression	1
Methapyrilene	decreases methylation	1
Methyl Methanesulfonate	increases expression	1
Niclosamide	increases expression	1
Rotenone	increases expression	1
Smoke	decreases expression	1
Thimerosal	decreases expression	1
1-Methyl-3-isobutylxanthine	affects cotreatment, decreases expression	1
7,8-Dihydro-7,8-dihydroxybenzo(a)pyrene 9,10-oxide	increases expression	1

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.